RNA Genomics. BME 110: CompBio Tools Todd Lowe May 14, 2010
|
|
|
- Abel Park
- 6 years ago
- Views:
Transcription
1 RNA Genomics BME 110: CompBio Tools Todd Lowe May 14, 2010
2 Admin WebCT quiz on Tuesday cover reading, using Jalview & Pfam Homework #3 assigned today due next Friday (8 days)
3 In Genomes, Two Types of Genes Protein-coding: [Start codon] [codon 1] [codon 2] [ ] [Stop codon] + DNA codons translated to amino acids to form a protein Non-coding RNAs (NcRNAs) No consistent patterns common to all RNA genes + Not translated to proteins, functional as RNA molecules
4 Rules of Engagement Alphabet: A, C, G, U (T~U) Canonical pairings: A-U, G-C Non-canonical: G-U (very common), A-C, A-G, etc. ncrnas are riddled with nucleotide modifications which may affect H-bond base pairing Depending on the modification, can make noncanonical pairings more or less favorable Example: wobble base modif. in trnas
5 Features of ncrnas Secondary structure is conserved, but often not primary sequence Additional sources of functional information easily derived from sequence and/or structure (i.e. anticodon in trna)
6 SRP RNA Orthologs: Same Function, Similar Structure, < 70% sequence identity
7 Common Attributes of ncrnas Structural many fold into complex 3-D structures Antisense many form specific base pairings with external target RNAs, no structure required for function Catalytic some catalyze biochemical reactions ribozymes (RNaseP, group I & II introns, hammerhead RNA, & others) Regulatory some interact with DNA or RNA targets for gene regulation (micrornas, many bacterial small RNAs)
8 RNA + Proteins = Complexes RNAs usually do no act alone, but are complexed with proteins Sites of interaction with RNAs or proteins exert selective pressure to conserve sequence or structure Sites of interaction make up conserved motifs one looks for to help identify RNA and/or determine function
9 How To Keep Track of All Types of RNA? General Database: RFAM Attempt to catalogue, align, and create search models for all known RNAs Just like PFAM (protein sister site) can paste your sequence in and look for matches to RNA gene models Nice alignments, excellent resource Sometimes not as good as customized search programs, when they exist
10 Examples of ncrna Genes Ribosomal RNAs (rrnas) protein translation Examples : large subunit rrna (aka LSU/28S/ 25S/23S), small subunit rrna (aka SSU/ 18S/16S), 5.8S, and 5S rrna Highly structured scaffold for dozens of ribosomal proteins; catalytic role in forming peptide bonds
11 Baker s Yeast (S. cerevisiae) Large Subunit rrna 2-D structure
12 trnas: A well-studied ncrna Gene family Transfer RNAs (trnas) decode mrna codons into cognate amino acids in protein translation Examples: trna-agc(ala), trna-acc(gly) (62 kinds possible) Structured RNA and antisense interaction between trna anticodon and mrna codon Can find them easily using the trnascan-se web server: Can get example sequences from the Genomic trna Database:
13 trna cloverleaf 2-D structure 3-D structure
14 Some Functional RNA Structures are found in mrnas Specific secondary structure can act with with regulatory roles Examples Riboswitches (example: TPP riboswitch) Selenocysteine insertion sequences (SECIS) Iron Response Element (IRE)
15 Many Different Types of Riboswitches Functional RNA is part of mrna molecule, usually at 5 end Riboswitch functions by binding a specific small molecule (i.e. free lysine, or free purine nucleotides) Binding state of riboswitch modulates on/off control of transcription or translation of attached gene From Nudler & Mironov, TIBS 29:11-17, 2004.
16 Riboswitch Web Analyses Ribex: Riboswitch Finder:
17 Other kinds of ncrnas Small nuclear RNAs (snrnas) Examples: Spliceosomal RNAs: U1, U2, U4, U5, U6, & others found in spliceosome, involved in removing introns from mrnas in eukaryotes Can usually detect by BLASTN since highly conserved, like ribosomal RNA Small nucleolar RNAs (snornas): located in the nucleolus, these process ribosomal RNA (chopping up & adding nucleotide modifications) BLASTN only works for some family members from very closely related species
18 S. cerevisiae Large Subunit Ribosomal RNA Highly conserved primary sequence and secondary structure Many interacting molecules constrain changes
19 Methylation guide C/D box snorna Very little secondary structure, but short box motifs and antisense guide sequence conserved
20 Pseudouridine guide H/ACA snorna Weak primary sequence motifs, but conserved secondary structure
21 snorna Web Searches C/D Box methylation guide snornas H/ACA pseudouridine guide snornas
22 More NcRNAs micrornas / sirnas - short ~22nt RNAs that pair with mrna to regulate expression MiRscan: Bacterial small RNAs: OxyS RNA (antisense temp. sensor), tmrna in bacteria (incomplete protein translation termination), CsrB (carbon storage regulation) guide RNAs in trypansomes post-transcriptional addition/deletion of nucleotides from mrnas
23 RNA Tracks in Genome Browsers In UCSC genome browsers, look for: RNA Genes sno/mirna genes transfer RNAs Genbank RNAs RFAM RNAs Or anything listed at ncrna
24 Some On-line Databases Ribosomal RNA databases: Ribosomal Database Project: rrna WWW Server: trna Databases Genomic trna Database Sprinzl trna Database snorna Databases Yeast snorna database Yeast_snoRNA_Database/snoRNA_DataBase.html
25 More Databases SRP RNA Database: RNAse P Database: tmrna Database: tmrdb.html Other RNA Lists of Links RNA IMB Jena (software & databases) NAR Databases Index (annual update) NAR Web Server List
26 RNA Folding mfold - Zuker Click on RNA Folding option a. hairpin loop b. internal loop c. bulge loop d. multibranched loop e. stem f. pseudoknot
27 RNA Folding Caveats mfold, often will not give you the true structure, it is just a reasonable approximation Concept: well-determined base pairing If you have candidate homologs from multiple species, use mfold to see if secondary structure is being preserved (compensatory mutations maintaining structure)
28 mfold Information Paste in RNA sequence (can be in DNA letters) Use defaults, except, set structure annotation to p-num Look at energy dot-plot Black dots are in optimal structure Colored dots in sub-optimal structures Look at top structures (within 5% of optimal) Are there many? Which features are consistent between structures? These are the most dependable aspects of structure Use compare selected foldings to see differences between different folds
29 mfold of a Leu-CAA trna
30 Finding RNA Genes Non-coding RNAs (ncrnas) are not detected effectively by general gene finders (unlike proteins) BLAST and other similarity-based search methods often miss ncrnas secondary structure conserved, not primary; incorrect boundaries Therefore, we need specialized gene finders for accurate detection for each RNA gene family
31 Mysterious new conserved element (PAE0935) What next? Try the obvious first: BLAST at NCBI Hmm, you get a strong match against other genomes Other close hits to related species, but no good annotation
32 BlastN v. BlastX Perhaps your sequence is a protein, studied in another species, but BlastN is not sensitive enough Try BlastX protein comparison is better at picking up more distantly related, conserved protein coding genes
33 Is it a protein? No convincing BlastX hits either! You are beginning to suspect this might not be a protein So, translate your protein, look for long open reading frames One reasonably long open reading frame, but still no evidence it is a real protein Perhaps a non-protein coding RNA (ncrna)?
34 Rule out the Easiest First Let s assume we know it s an RNA gene now Which one?! Start with RFAM, which has the largest, most diverse collection of RNA gene models Will not detect all types of ncrna (i.e. snornas), or novel types of ncrnas
35 Next: Specialized ncrna Gene Finders Two specialized gene finders developed specifically for particular gene families: trnascan-se: searches for transfer RNAs using probabilistic models to search genome sequence Fast, accurate
36 snorna searches Snoscan search for C/D box methylation guide snornas snogps search for H/ACA guide snornas
37 Example of a Customized RNA Search program: Snoscan
38 Cloned srnas from S. acidocaldarius
39 snorna Probabilistic Model
40 Check Current ncrna Databases Some have search options RNAse P database: tmrna Database: dbs/tmrdb/tmrdb.html New databases and resources always coming online check links at IMB Jenna (given earlier) and annual database issue of Nucleic Acids Research
41 Check 2-D Structure for Clues Michael Zuker s mfold server Is there one good optimal structure, or many within 5% of optimum? If you have candidate homologs from multiple species, use mfold to see if secondary structure is being preserved (compensatory mutations maintaining structure)
42 Comparative analysis of 2D mfoldpred icted structures (Tam, Gene 274:157-67, 2001)
43 A Practical Guide: So you think you ve found a novel RNA? 1. Try BLAST first to look for very similar hits (any long ORFs?) 2. Try battery of existing ncrna search tools to verify RNA is in a novel class 3. Attempt to determine secondary structure with mfold; are any portions particularly well-determined? 4. Collect candidate orthologs from closely related species 5. Create a training set of sequences to model (verified/studied experimentally), align structurally if possible using known biological features 6. Model primary/secondary structure with an SCFG, search other genomes for hits 7. Collaborate with an experimental lab to determine null function / cell localization / interactions with other proteins
44 How Do People Find New ncrnas? Traditional biochemistry (immunoprecipitation to interacting proteins) Genetic screens are often difficult to find ncrnas Mining expression databases (EST sequencing, microarray data) Comparative genomics combined with other information (promotors, terminators, common secondary structure) Programs: RNAz, Qrna Direct sequencing of RNA fragments (RNA-seq)!!
Computational analysis of non-coding RNA. Andrew Uzilov BME110 Tue, Nov 16, 2010
Computational analysis of non-coding RNA Andrew Uzilov auzilov@ucsc.edu BME110 Tue, Nov 16, 2010 1 Corrected/updated talk slides are here: http://tinyurl.com/uzilovrna redirects to: http://users.soe.ucsc.edu/~auzilov/bme110/fall2010/
RNA Genomics II. BME 110: CompBio Tools Todd Lowe & Andrew Uzilov May 17, 2011
RNA Genomics II BME 110: CompBio Tools Todd Lowe & Andrew Uzilov May 17, 2011 1 TIME Why RNA? An evolutionary perspective The RNA World hypotheses: life arose as self-replicating non-coding RNA (ncrna)
RNA secondary structure prediction and analysis
RNA secondary structure prediction and analysis 1 Resources Lecture Notes from previous years: Takis Benos Covariance algorithm: Eddy and Durbin, Nucleic Acids Research, v22: 11, 2079 Useful lecture slides
RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.
The Versatility of RNA Primary structure of RNA RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. Each nucleotide subunit is composed of a ribose sugar,
RNA folding & ncrna discovery
I519 Introduction to Bioinformatics RNA folding & ncrna discovery Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Non-coding RNAs and their functions RNA structures RNA folding
Protein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
CH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
Review of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
RNA Structure and the Versatility of RNA. Mitesh Shrestha
RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis
Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?
Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist
Protein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
produces an RNA copy of the coding region of a gene
1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the
Gene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
BIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
Ch Molecular Biology of the Gene
Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it
Lecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
DNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
2. From the first paragraph in this section, find three ways in which RNA differs from DNA.
Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours
RNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
From DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
Chapter 31. Transcription and RNA processing
Chapter 31 Transcription and RNA processing RNA polymerase (RNAP) E. coli promoters Components of E. coli RNA Polymerase Holoenzyme (α 2 ββ'ωσ) Structure of prokaryotic RNAP The closed and open state of
Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
DNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
Ch. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
COMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
Chapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
Gene Prediction: Preliminary Results
Gene Prediction: Preliminary Results Outline Preliminary Pipeline Programs Program Comparison Tests Metrics Gene Prediction Tools: Usage + Results GeneMarkS Glimmer 3.0 Prodigal BLAST ncrna Prediction
Chapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
Chem 465 Biochemistry II
Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Which of the following is not true of trna molecules? A) The 3'-terminal sequence is -CCA. B) Their anticodons are complementary
Genome and DNA Sequence Databases. BME 110: CompBio Tools Todd Lowe April 5, 2007
Genome and DNA Sequence Databases BME 110: CompBio Tools Todd Lowe April 5, 2007 Admin Reading: Chapters 2 & 3 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring07/bme110-calendar.html
Chapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
Computational aspects of ncrna research. Mihaela Zavolan Biozentrum, Basel Swiss Institute of Bioinformatics
Computational aspects of ncrna research Mihaela Zavolan Biozentrum, Basel Swiss Institute of Bioinformatics Computational aspects on ncrna Bacterial ncrnas research Gene discovery Target discovery Discovery
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
Ch 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
RNA and Protein Synthesis
Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College RNA and Protein Synthesis Considerable evidence suggests that RNA molecules evolved prior to DNA molecules and proteins, and that
Chapter 11. Gene Expression and Regulation. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc..
Chapter 11 Gene Expression and Regulation Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc.. 11.1 How Is The Information In DNA Used In A Cell? Most genes contain
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
Transcription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
Big Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
TRANSCRIPTION AND TRANSLATION
TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.
Protein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
NCBI & Other Genome Databases. BME 110/BIOL 181 CompBio Tools
NCBI & Other Genome Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2011 Admin Reading Dummies Ch 3 Assigned Review: "The impact of next-generation sequencing technology on genetics" by E.
Chapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
Gene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
RNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
Protein Synthesis. OpenStax College
OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will
Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics
Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps
The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
Annotating Fosmid 14p24 of D. Virilis chromosome 4
Lo 1 Annotating Fosmid 14p24 of D. Virilis chromosome 4 Lo, Louis April 20, 2006 Annotation Report Introduction In the first half of Research Explorations in Genomics I finished a 38kb fragment of chromosome
C. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
Nucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
Chapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis
Name: Date: Period: Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis ***Completing this study guide in its entirety will result in extra credit on the exam. You must show me the DAY OF the
RNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix
Reason: RNA has ribose sugar ring, with a hydroxyl group (OH) If RNA in B-from conformation there would be unfavorable steric contact between the hydroxyl group, base, and phosphate backbone. RNA structure
The modified RNAfold program was used with molecule specific and molecule independent
Supplemental Data The modified RNAfold program was used with molecule specific and molecule independent hairpin loop statistical potentials to predict the secondary structure for sixteen RNA molecular
BEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
Fig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?
Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA
DNA Model Stations. For the following activity, you will use the following DNA sequence.
Name: DNA Model Stations DNA Replication In this lesson, you will learn how a copy of DNA is replicated for each cell. You will model a 2D representation of DNA replication using the foam nucleotide pieces.
Agenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence
Agenda GEP annotation project overview Web Databases for Drosophila An introduction to web tools, databases and NCBI BLAST Web databases for Drosophila annotation UCSC Genome Browser NCBI / BLAST FlyBase
RNA Secondary Structure Prediction Computational Genomics Seyoung Kim
RNA Secondary Structure Prediction 02-710 Computational Genomics Seyoung Kim Outline RNA folding Dynamic programming for RNA secondary structure prediction Covariance model for RNA structure prediction
GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function
Gene Expression. Student:
Gene Expression Student: 1. A ribozyme is A. a section of the DNA that is expressed in the mrna. B. a self-splicing intron that acts like an enzyme. C. a complex made up of many ribosomes replicating the
Section DNA: The Molecule of Heredity
Ch 11: DNA and Genes - DNA: The Molecule of Heredity Inside This Section... What is DNA? The Structure of DNA DNA Replication What is DNA? Acid DNA is the blueprint of all living organisms. It controls
DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006
90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006 8 RNA Secondary Structure Sources for this lecture: R. Durbin, S. Eddy, A. Krogh und G. Mitchison. Biological sequence analysis,
Ch 10.4 Protein Synthesis
Ch 10.4 Protein Synthesis I) Flow of Genetic Information A) DNA is made into RNA which undergoes transcription and translation to be made into a protein. II) RNA Structure and Function A) RNA contains
MATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class
DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
PROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
DNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
Protein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
Bundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
Pauling/Itano Experiment
Chapter 12 Pauling/Itano Experiment Linus Pauling and Harvey Itano knew that hemoglobin, a molecule in red blood cells, contained an electrical charge. They wanted to see if the hemoglobin in normal RBC
DNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
STUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
Bio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
Year III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
Chapter 11 Quiz #8: February 13 th You will distinguish between the famous scientists and their contributions towards DNA You will demonstrate replication, transcription, and translation from a sample
TRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
Chapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
Adv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
Bundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora
DNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These