Supplementary material
|
|
|
- Jessie Wilson
- 6 years ago
- Views:
Transcription
1 Supplementary material Tracking mesenchymal stem cell contributions to regeneration in an immunocompetent cartilage regeneration model Daniela Zwolanek, María Satué, Verena Proell, Josè R. Godoy, Kathrin I. Odörfer, Magdalena Flicker, Sigrid Hoffmann, Thomas Rülicke, and Reinhold G. Erben Corresponding Author Reinhold G. Erben, MD, DVM Institute of Physiology, Pathophysiology, and Biophysics Department of Biomedical Sciences, University of Veterinary Medicine Vienna Veterinärplatz 1, 1210 Vienna, Austria, Tel: , Fax: , 1
2 Supplementary Figure S1. Histochemical ALPP staining and long-term tolerance of Tg(ALPPm) recipients to skin grafts from Tg(ALPP) donors. (A) ALPP histochemistry on plastic sections from knee joints of Tg(ALPP), Tg(ALPPm), and wild-type mice after a 35min heat inactivation at 72 C (upper panels) or without heat pretreatment (lower panels). Tg(ALPP) donors show strong staining in all tissues, whereas no enzyme activity could be detected in wild-type and Tg(ALPPm) mice upon heat pretreatment. Non heat-treated tissues 2
3 show similar enzyme activity in all mouse lines. Scale bar = 100 µm. n = 3 per group. (B) ALPP histochemistry of skin sections from Tg(ALPP), Tg(ALPP m ) and wild-type rats after 35 min heat inactivation at 72 C. Strong ALPP staining was present in Tg(ALPP) rats compared to Tg(ALPP m ) and wild-type littermates. Scale bar = 100 µm. n =5 per group. (C) Histochemistry of skin grafts from Tg(ALPP) grafts transplanted into Tg(ALPP m ) recipient mice showing more host tissue as shown in Figure 2B. Scale bar = 500 µm. n = 10 per group. (D) Immunohistochemical staining of skin grafts from wild-type and Tg(ALPP m ) recipient mice using an anti-cd45r antibody, 3 weeks post-surgery. Red-stained cells represent CD45Rpositive leukocytes. Scale bar = 100 µm. n 5 per group. (E) Histochemistry of skin grafts from Tg(ALPP) rats transplanted into Tg(ALPP m ) recipient rats showing more host tissue as shown in Figure 2D. Scale bar = 500 µm. n = 10 per group. (F) Immunohistochemical staining of skin grafts from wild-type and Tg(ALPP m ) recipient rats using an anti-cd45 antibody, 4 weeks post-surgery. Red-stained cells represent CD45-positive leukocytes. Scale bar = 100 µm n 5 per group. ALPP m, ALPP E451G mutant; ALPP ALPP m, transplantation from Tg(ALPP) donor into Tg(ALPP m ) recipient; TX, transplantation; WT, wild-type. 3
4 Supplementary Figure S2. Macroscopic analysis of skin grafts from Tg(ALPP) donors in mouse and rat marker-tolerant models. (A) Macroscopic appearance of skin grafts (white dashed box) of indicated recipient mice, 3 weeks post-transplantation. The left dashed box indicates the donor transplant; the right box indicates the auto-transplant. (B) Macroscopic 4
5 scoring of skin graft rejection over the 24-week experimental period in mice. No significant differences were observed in the scoring of the transplants. Dots represent score per animal. n 10 per group. Data represent means SEM. (C) Macroscopic appearance of skin grafts (black dashed box) of indicated recipients in the rat model, 4 weeks post-transplantation. The left dashed box indicates the donor transplant; the right box indicates the auto-transplant. (D) Macroscopic scoring of skin graft rejection in the rat model, showing clear signs of rejection in wild-type recipients. Dots represent score per animal. n = 10 per group. * p < 0.05 by Kruskal-Wallis test followed by Mann-Whitney U-test. ALPP m, ALPP E451G mutant; ALPP ALPP m, transplantation from Tg(ALPP) donor into Tg(ALPP m ) recipient; TX, transplantation; WT, wild-type. 5
6 Supplemental Figure S3. Rapid rejection of MSC from Tg(ALPP) donors in the knee joint of wild-type recipient rats. (A) Quantification of the ALPP-positive area in the synovium of the joint capsule and within the full-thickness defects after histochemical ALPP staining, 1 day after intra-articular injection of serum or 10 7 MSC from Tg(ALPP) donor rats into the knee of wild-type and Tg(ALPP m ) recipient rats. Dots represent ALPP-positive area per animal. n 5 per group. * p < 0.05 vs. WT recipients by Kruskal-Wallis test followed by Mann- Whitney U-test. (B) Western blotting analysis of joint capsule extract 1 day after injection of serum or 10 7 MSC from Tg(ALPP) donor rats into the knee of Tg(ALPP m ) recipients. GAPDH was used as loading control. n 5 per group. (C) ALPP protein expression in joint capsule extracts from intact knees and knees carrying a cartilage defect, 1 day after intraarticular injection of MSC from Tg(ALPP) donor rats into Tg(ALPP m ) or wild-type recipients. GAPDH was used for normalization. * p < 0.05 by Student s t-test. n = 5 per group. (D) Western blotting analysis of MPO expression in joint capsule extracts, 1 day after intraarticular injection of MSC from Tg(ALPP) donor rats into Tg(ALPP m ) or wild-type recipi- 6
7 ents. GAPDH was used for normalization. Lysates of neutrophils served as positive control. n 3 per group. ALPP m, ALPP E451G mutant; ALPP ALPP m, transplantation from Tg(ALPP) donor into Tg(ALPP m ) recipient; TX, transplantation; MPO, myeloperoxidase; pos. co, positive control; WT, wild-type. 7
8 Supplementary Figure S4. Serum controls for experiments with intra-articularly injected MSC in wild-type and Tg(ALPPm) recipient rats. (A and B) Toluidine blue staining of cryosections from full-thickness cartilage defects in the patellar groove, 1 month (left panel) and 6 months (right panel) after injection of 50 µl rat serum into the knee joint of wild-type or Tg(ALPPm) recipients. No neocartilage formation can be observed at 6 months posttreatment. Scale bar = 50 µm. n = 3 (A) and 5 (B) per group. (C - H) Immunofluorescence staining of cryosections of full-thickness cartilage defects, using anti-collagen II (green) and anti-alpp antibodies (red) (C and D), anti-alpp (green) and anti-sox9 antibodies (red) (E and F), or anti-comp (green) and anti-alpp antibodies (red) (G and H), 1 month (left panels) and 6 months (right panels) after injection of rat serum into wild-type or Tg(ALPPm) recipients. Neither COL2-containing cartilaginous neomatrix, nor SOX9 and COMP expression was detectable in the defects of serum-injected wild-type and Tg(ALPPm) recipients, 6 months post-injection. No ALPP-expressing cells were found in Tg(ALPPm) and wild-type recipients. Scale bar = 50 µm. n = 5 per group. ALPP, human placental alkaline phosphatase; ALPPm, ALPPE451G mutant; ALPP ALPPm, transplantation from Tg(ALPP) donor into Tg(ALPPm) recipient; WT, wild-type. 8
9 Supplementary Table 1: PCR products after amplification PCR product Sequence (5 3 ) R26S E3r R26f U3Kr U3Kf 3U1r GTCGACTAGATGAAGGAGAGC GAGCCACATATGGGAAGCGGT TGAATTCCTGCCTCGCCACTGT GAAAGGAGCCTGCCTGGTACC GGTACCAGGCAGGCTCCTTTC GAGGCAGAATCTCGCTCTGTC 9
10 Supplementary Table 2: PCR primers for cloning. fw forward, rev - reverse Primer Direction Use Sequence (5 3 ) SOE-f1 fw ΔALPP cloning TAGCACGTGGGAGACACTCCA SOE-r1 rev ΔALPP cloning GTGCCCCTGGACGGAGAGACCCACGCAGGCGAGGAC SOE-f2 fw ΔALPP cloning TGCGTGGGTCTCTCCGTCCAGGGGCACTGCTGACTG SOE-r2 rev ΔALPP cloning GAAAGGAGCCTGCCTGGTACC R26f fw genotyping TGAATTCCTGCCTCGCCACTGT E2r rev genotyping AAGGCCTGGCTCACTCACCATC U3f fw genotyping GATGGAGACCATCCTGGCTAAC U4r rev genotyping GATCTAGTAACGGCCGCCAGTG E5r rev screening GCTACGCAGCTCATCTCCAA E5f fw screening GCTACGCAGCTCATCTCCAA E9r rev screening CTCTCAATGGCGTCGTCGAA E8f fw screening GATCCACCGAGACTCCACACT E11r rev screening AGGCCATGACGTGCGCTATGAA U3f fw screening GATGGAGACCATCCTGGCTAAC U4r rev screening GATCTAGTAACGGCCGCCAGTG 10
11 Supplementary Methods Skin graft scoring. Scoring of grafts to evaluate rejection was performed on the basis of Hedrich (1) with minor modifications. Photographs of mouse allo- and autografts taken 3, 6, 9, 12, 20, and 24 weeks post-surgery and of rat grafts taken 4 weeks post-surgery were randomized and evaluated independently by three experienced observers on the basis of the following scoring: 1 - no signs of rejection, characterized by full grown pelt and original size of graft; 2 - signs of rejection, manifested by reduced number of hairs, cankerous appearance and reduction of graft size and/or dry scrap; 3 - rejection, characterized by reduction of graft to scar. For each graft the mean value of the individual scores given by the observers was used for quantification. Immunoblotting. Joint capsule homogenates ( µg) were separated by SDS-PAGE and immunoblotting was carried out using a rabbit polyclonal anti-mpo (myeloperoxidase) antibody (4162S, Cell Signaling). 50 µg lysate of 1.5*10 6 neutrophils served as positive control. Anti-GAPDH rabbit antibody (MAB374, Sigma) was used as loading control and for normalization. References 1. Hedrich HJ. Testing for Isohistogeneity (Skin Grafting). In: Adams M and Hedrich HJ, eds. Genetic Monitoring of Inbred Strains of Rats: A Manual on Colony Management, Basic Monitoring Techniques, and Genetic Variants of the Laboratory Rat. New York: John Wiley & Sons Inc; 1990:
Tracking mesenchymal stem cell contributions to regeneration in an immunocompetent cartilage regeneration model
Downloaded from http:// on April 5, 2018. Tracking mesenchymal stem cell contributions to regeneration in an immunocompetent cartilage regeneration model Daniela Zwolanek, 1 María Satué, 1 Verena Proell,
Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse
Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp)
Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy
Supplementary Material Levels of protein drive the reparative process in acute muscle injury and muscular dystrophy Francesca Riuzzi 1,4 *, Sara Beccafico 1,4 *, Roberta Sagheddu 1,4, Sara Chiappalupi
Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin
Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,
SUPPLEMENTARY INFORMATION
a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm
Supplementary Information
Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on
Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss
SUPPLEMENTARY INFORMATION Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss Yunjong Lee, Senthilkumar S. Karuppagounder, Joo-Ho Shin, Yun-Il Lee, Han Seok Ko, Debbie Swing,
Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.
Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out
Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl
Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into
Background. Background. Background. Background. Background 3/4/2013
3/4/213 Human Very Small Embryonic-like Stem Cells (s) Capacity to Regenerate Bone Tissue: A Potential Cell-based Therapy for Autogenous Bone Grafting Aaron M. Havens, DMD Need to discover an improved
Journal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
Isolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
FORENSIC SEROLOGY. Chapter PRENTICE HALL 2008 Pearson Education, Inc. Upper Saddle River, NJ 07458
Chapter 8 FORENSIC SEROLOGY 8-1 Nature of Blood The word blood refers to a highly complex mixture of cells, enzymes, proteins, and inorganic substances. Plasma, which is the fluid portion of blood, is
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
Supplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
Materials and Methods: All strains were derivatives of SK1 and are listed in Supplemental Table 1.
Supplemental Online Material: Materials and Methods: All strains were derivatives of SK1 and are listed in Supplemental Table 1. Constructs: pclb2-3ha-cdc5 and pclb2-3ha-cdc2 strains were constructed by
Supplementary information
Supplementary information Inhibition of mitochondrial dysfunction and neuronal cell death in models of Huntington s disease and in HD patients-derived cells Xing Guo 1,#, Marie-Helene Disatnik 3,#, Marie
SUPPLEMENTARY INFORMATION. Integrin alpha 11 in regulation of myofibroblasts phenotype: Implication for fibrotic diseases
SUPPLEMENTARY INFORMATION Integrin alpha 11 in regulation of myofibroblasts phenotype: Implication for fibrotic diseases Ruchi Bansal 1, Shigeki Nakagawa 2, Saleh Yazdani 1, Joop van Baarlen 3, Anu Venkatesh
Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by. Regulating Occludin
Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by Regulating Occludin Chaithanya Chelakkot 1,ǂ, Jaewang Ghim 2,3,ǂ, Nirmal Rajasekaran 4, Jong-Sun Choi 5, Jung-Hwan
Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans
Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,
SANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1.
Supplementary Figure 1. Characterization and high expression of Lnc-β-Catm in liver CSCs. (a) Heatmap of differently expressed lncrnas in Liver CSCs (CD13 + CD133 + ) and non-cscs (CD13 - CD133 - ) according
Supplementary Information: ITGAV and ITGA5 diversely regulate proliferation and adipogenic differentiation of human adipose derived stem cells
Supplementary Information: ITGAV and ITGA5 diversely regulate proliferation and adipogenic differentiation of human adipose derived stem cells E. M. Morandi, R. Verstappen, M. E. Zwierzina, S. Geley, G.
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
Blot: a spot or stain, especially of ink on paper.
Blotting technique Blot: a spot or stain, especially of ink on paper. 2/27 In molecular biology and genetics, a blot is a method of transferring proteins, DNA or RNA, onto a carrier (for example, a nitrocellulose,pvdf
NEXT GENERATION ECM-BASED ALLOGRAFT TECHNOLOGY:
NEXT GENERATION ECM-BASED ALLOGRAFT TECHNOLOGY: Potent biological scaffolds strategically control stem cell fate and function, allowing our allografts to harness the regenerative potential of patient s
Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms
S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,
Alternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on
Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin
SUPPLEMENTARY MATERIAL AND METHODS
SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,
Fundamental properties of Stem Cells
Stem cells Learning Goals: Define what a stem cell is and describe its general properties, using hematopoietic stem cells as an example. Describe to a non-scientist the current progress of human stem cell
ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
GTTCGGGTTCC TTTTGAGCAG
Supplementary Figures Splice variants of the SIP1 transcripts play a role in nodule organogenesis in Lotus japonicus. Wang C, Zhu H, Jin L, Chen T, Wang L, Kang H, Hong Z, Zhang Z. 5 UTR CDS 3 UTR TCTCAACCATCCTTTGTCTGCTTCCGCCGCATGGGTGAGGTCATTTTGTCTAGATGACGTGCAATTTACAATGA
Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3'
Supplementary Table 1: Real-time PCR primer sequences for ΔEGFR, wtegfr, IL-6, LIF and GAPDH. Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3' wtegfr
FIG S1: Calibration curves of standards for HPLC detection of Dopachrome (Dopac), Dopamine (DA) and Homovanillic acid (HVA), showing area of peak vs
FIG S1: Calibration curves of standards for HPLC detection of Dopachrome (Dopac), Dopamine (DA) and Homovanillic acid (HVA), showing area of peak vs amount of standard analysed. Each point represents the
Supplemental Information Inventory
Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Svegliati Baroni S, Santillo M, Bevilacqua F, et al. Stimulatory
EGFR (Phospho-Ser695)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
Supplemental Material for
Supplemental Material for TXI TELNGIECTSI MUTTED (TM)-MEDITED DN DMGE RESPONSE IN OXIDTIVE STRESS-INDUCED VSCULR ENDOTHELIL CELL SENESCENCE Hong Zhan 1, Toru Suzuki 1,2, Kenichi izawa 1, Kiyoshi Miyagawa,
CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358
CytoGLOW IKK-α/β Colorimetric Cell-Based ELISA Kit Catalog #: CB5358 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only.
B Vehicle 1V270 (35 μg) 1V270 (100 μg) Days post tumor implantation. Vehicle 100μg 1V270 biweekly 100μg 1V270 daily
Supplemental Figure 1 A 1 1V7 (8 μg) 1 1V7 (16 μg) 8 6 4 B 1 1 8 6 4 1V7 (35 μg) 1V7 (1 μg) 5 1 15 5 1 15 C Biweekly 8 11 14 17 Days Implant SCC7 cells Daily 8 9 1 11 1 Implant SCC7 cells 1V7 i.t. treatment
TheraLin. Universal Tissue Fixative Enabling Molecular Pathology
TheraLin Universal Tissue Fixative Enabling Molecular Pathology TheraLin Universal Tissue Fixative Enabling Molecular Pathology Contents Page # TheraLin Universal Tissue Fixative 3 Introduction 5 Easy
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
Strep-tag detection in Western blots
Strep-tag detection in Western blots General protocol for the detection of Strep-tag fusion proteins Last date of revision April 2012 Version PR07-0010 www.strep-tag.com For research use only Important
Supplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
One-Step Western TM Kit using TMB
Technical Manual No. 0203 Version 03272008 I Description.. 1 II Kit Contents.. 2 III Applications 3 IV Key Features.. 3 V Storage.. 3 VI One-Step Western TM Protocol. 3 VII Examples. 3 VIII Troubleshooting..
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well
Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at
A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet
A Low salt diet GV [AU]:. [mmhg]: 0..... 09 9 7 B High salt diet GV [AU]:. [mmhg]: 7 8...0. 7.8 8.. 0 8 7 C Low salt diet + mf-c GV [AU]:. [mmhg]:.0.9 8.7.7. 7 8 0 D High salt diet + mf-c E Lymph capillary
UNIT CELL PROCESSES UNDERLYING TISSUE ENGINEERING AND REGENERATIVE MEDICINE
Massachusetts Institute of Technology Harvard Medical School Brigham and Women s Hospital VA Boston Healthcare System 2.79J/3.96J/20.441/HST522J UNIT CELL PROCESSES UNDERLYING TISSUE ENGINEERING AND REGENERATIVE
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
Peter Dy, Weihuan Wang, Pallavi Bhattaram, Qiuqing Wang, Lai Wang, R. Tracy Ballock, and Véronique Lefebvre
Developmental Cell, Volume 22 Supplemental Information Sox9 Directs Hypertrophic Maturation and Blocks Osteoblast Differentiation of Growth Plate Chondrocytes Peter Dy, Weihuan Wang, Pallavi Bhattaram,
Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility
Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,
* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)
I: p-p9rsk I: p9rsk I: C I: p-p9rsk I: p9rsk 5 (ka) 5 5 (min) Ang II ( nm) p-p9rsk (Ser8) p9rsk p-p9rsk (Ser8) p9rsk (h) Mannitol 5 mm -Glucose 5 mm p9rsk (Ser8) (arbitrary units) p-p9rsk (Ser8) (arbitrary
Title. CitationThe Journal of clinical investigation, 124(5): Issue Date Doc URL. Type. Additional There Information
Title Laminins affect T cell trafficking and allograft fat Author(s)Warren, Kristi J.; Iwami, Daiki; Harris, Donald G.; CitationThe Journal of clinical investigation, 124(): 224- Issue Date 214--1 Doc
Adipose rabbit mesenchymal stem cells for the treatment of the chronic scar tissue of the vocal cords
Adipose rabbit mesenchymal stem cells for the treatment of the chronic scar tissue of the vocal cords Dr. Vasiliki E Kalodimou, Head of Flow Cytometry-Research and Regenerative Medicine Department, IASO-Maternity
Your Antibody Source. prosci-inc.com. Extensive Antibody Services Broad Antibody Catalog
Your Source prosci-inc.com Extensive Services Broad Catalog Company Overview Established in 1998, ProSci Incorporated is a leading provider of high performance antibodies and custom antibody services.
Supporting Online Material for
www.sciencemag.org/cgi/content/full/317/5837/477/dc1 Supporting Online Material for AAV Vector Integration Sites in Mouse Hepatocellular Carcinoma Anthony Donsante, Daniel G. Miller, Yi Li, Carole Vogler,
PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous
Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
supplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
Supporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
Figure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9
Supplementary Information Ultrasensitive antibody detection by agglutination-pcr (ADAP) Cheng-ting Tsai 1 *, Peter V. Robinson 1 *, Carole A. Spencer 2 and Carolyn R. Bertozzi 3,4ǂ Department of 1 Chemistry,
Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
Multiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP
Page 1 of 7 INSTRUCTIONS: Z-310 Multiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP Rockland Immunochemicals and Bio-Rad Laboratories have jointly developed an easy to use multiplex
Supplementary Information
Supplementary Information MLL histone methylases regulate expression of HDLR- in presence of estrogen and control plasma cholesterol in vivo Khairul I. Ansari 1, Sahba Kasiri 1, Imran Hussain 1, Samara
Wnt16 smact merge VK/AB
A WT Wnt6 smact merge VK/A KO ctrl IgG WT KO Wnt6 smact DAPI SUPPLEMENTAL FIGURE I: Wnt6 expression in MGP-deficient aortae. Immunostaining for Wnt6 and smooth muscle actin (smact) in aortae from 7 day
A Role for Streptococcal Collagen-Like Protein 1 (Scl-1) in M1T1 Group A
Supplemental Information for: A Role for Streptococcal Collagen-Like Protein 1 (Scl-1) in M1T1 Group A Streptococcus Resistance to Neutrophil Extracellular Traps Simon Döhrmann 1, Sabina Anik 1, Joshua
GFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Kanaani et al., http://www.jcb.org/cgi/content/full/jcb.200912101/dc1 Figure S1. The K2 rabbit polyclonal antibody is specific for GAD67,
NIH Funded Animal Resource Centers at the University of Missouri. Genetically-modified Animals: Powerful tools for biomedical research
NIH Funded Animal Resource Centers at the University of Missouri Genetically-modified Animals: Powerful tools for biomedical research Mice, Rats and Pigs Mutant Mouse Regional Resource Center (MMRRC) Rat
Center Drive, University of Michigan Health System, Ann Arbor, MI
Leukotriene B 4 -induced reduction of SOCS1 is required for murine macrophage MyD88 expression and NFκB activation Carlos H. Serezani 1,3, Casey Lewis 1, Sonia Jancar 2 and Marc Peters-Golden 1,3 1 Division
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
from α- to β-cleavage
Supplementary Information Specific antibody binding to the APP 672-699 region shifts APP processing from α- to β-cleavage Song Li 1,6,8, Juan Deng 1,7,8, Huayan Hou 1,8, Jun Tian 1, Brian Giunta 2,3, Yanjiang
BCH 462. Western Blot
BCH 462 Western Blot Blotting Immunoassay: A test that uses antibody and antigen complexes [immuno-complexes] as a means of generating measurable results. Antigens [Ag]: A substance that when introduced
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and
Directed Differentiation of Human Induced Pluripotent Stem Cells. into Fallopian Tube Epithelium
Directed Differentiation of Human Induced Pluripotent Stem Cells into Fallopian Tube Epithelium Nur Yucer 1,2, Marie Holzapfel 2, Tilley Jenkins Vogel 2, Lindsay Lenaeus 1, Loren Ornelas 1, Anna Laury
ab Ubiquitylation Assay Kit
ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.
Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney
1 Supplementary text and data for: 2 3 4 5 Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney Authors: David A. D. Munro 1*, Peter Hohenstein 2, and Jamie A.
John Gurdon was testing the hypothesis of genomic equivalence or that when cells divide they retain a full genomic compliment.
1. (15 pts) John Gurdon won the 2012 Nobel Prize in Physiology or Medicine for work he did in the 1960 s. What was the major developmental hypothesis he set out to test? What techniques did he development
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)
Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
Supporting Information
Supporting Information Signal mingle: Micropatterns of BMP-2 and fibronectin on soft biopolymeric films regulate myoblast shape and SMAD signaling. Vincent Fitzpatrick, Laure Fourel, Olivier Destaing,
ab Ubiquitylation Assay Kit (HeLa lysate-based)
ab139471 Ubiquitylation Assay Kit (HeLa lysate-based) Instructions for Use For the generation of ubiquitin-conjugated lysate proteins This product is for research use only and is not intended for diagnostic
PTH Effects Bone Healing and Vasculogenesis in Calvaria Bone Allograft Model
PTH Effects Bone Healing and Vasculogenesis in Calvaria Bone Allograft Model Dmitriy Sheyn, PhD 1, Doron Cohn-Yakubovich, BSc 2, Ilan Kallai, MSc 2, Susan Su, MD 1, Xiaoyu Da, MSc 1, Gadi Pelled, DMD,
Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer
Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means
1,500 1,000. LPS + alum. * * Casp1 p10. Casp1 p45
a NLRP3 Non-stimulation R46 BAY SI TAT LPS R46 BAY SI TAT 1,5 1, c 15 1 5 5 Pro-IL-18 Pro-IL-1 LPS + alum d e f IL-1 p17 Pro-IL-1 1 75 5 5 Casp1 p1 NLRP3 LPS + alum Supplementary Figure 1 Inhiition of
Confocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system
Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION