The Generation of Lymphocyte Antigen Receptors
|
|
- Dominic Wilson
- 5 years ago
- Views:
Transcription
1 The Generation of Lymphocyte Antigen Receptors Questions (outlines): 1. Do you really understand V(D)J recombination? Functions of RAG? 2. What are the differences between the Ig and TCR gene recombination? 3. What is class switch? Functions of AID? 不提 : Evolution of the adaptive immune response (page 186 最後一段 - 195)
2 The generation of diversity in immunoglobulins Repertoire: a group of diverse molecules, segments, or motifs (page 158)
3 10 11 Ab in humans Dryer and Bennett 2-gene model, 1965 Tonegawa gene recombination model, 1976
4 Susumu Tonegawa ( 利根川進, 1939-) The Nobel Prize in Physiology or Medicine 1987, for his discovery of the genetic mechanism that produces antibody. Although he won the Nobel Prize for his work in Immunology, he has turned his attention to the molecular and cellular basis of memory formation In his later years. David Baltimore (1938-) The Nobel Prize in Physiology or Medicine in 1975 (shared with Howard Temin and Tenato Dulbecco), for the discovery of reverse transcriptase. In 1981, working with Vincent Racaniello, Baltimore generated a plasmid encoding the polio virus genome, using recombinant DNA technology. Other important breakthroughs from Baltimore's lab include the discovery the transcription factor NF- B and the recombination activating genes RAG-1 and RAG-2. 曾擔任校長 : Rockefeller University California Institute of Technology
5 Ig genes are rearranged in B cells A population of normal B cells has many different rearranged genes, so they yield a smear of DNA fragment sizes.
6 Probe: mrna encoding light chain ( )
7 The germline organization of the Ig heavyand light-chain loci in the human genome (Ch #22) (8 families or clans) (Ch #2) (7 families or clans) (Ch #14) (3 families or clans)
8 V-region genes are constructed from gene segments ( aa) (< 13 aa) (90-95 aa) (2-3 aa) (10-15 aa) CDR 3
9 V-region sequences are constructed from gene segments V l aa aa V aa 2-3 aa aa H ( 原始體細胞狀態 )
10 老鼠胚胎發芽母細胞基因發生重組連接 所有可能產生之不同抗體數目 輕鏈 V 區 = 3 * J 區 = 3 組合數 = 3X3 = 9 k 輕鏈 V k 區 = 250 J l 區 = 4 組合數 = 250X4 = 1,000 重鏈 V H 區 = 250 D H 區 = 10 J H 區 = 4 組合數 = 250X4 X10 = 10,000 抗體多樣性含 k 抗體 = 10,000 X1,000 = 10 7 種含 l 抗體 = 9 X10,000 = 90,000 種 * 大約數
11
12 but naive
13 The numbers of functional gene segments for the V regions of human heavy and light chains usually with pseudogenes (page 160)
14 Conserved heptamer and nonamer sequences (recombination signal sequences, RSSs) flank the gene segments encoding the V regions of heavy (H) and light ( and ) chains
15
16 (recombination signal sequences)
17 The V-region gene segments are joined by recombination Deletional recombination Inversional recombination (more for V -J )
18 The reaction that recombines V, D, and J gene segments involves both lymphocyte-specific and ubiquitous DNA-modifying enzymes RAG: recombination-activating genes (no introns) Ku70:Ku80 + DNA-PKcs to form DNA-PK Artemis (with nuclease activity) TdT: terminal deoxynucleotidyl transferase DNA ligase IV (form complex with XRCC4) DNA polymerase and λ SCID: severe combined immune deficiency -Lack of DNA-PKcs, Ku, Artemis, RAG-1/2 Human diseases: Omenn syndrome : mutations of RAG1/RAG2 RS-SCID: sensitive to radiation, Artemis defect Ataxia telangiectasia: ATM (protein kinase, 似 DNA-PK C ) defect (low # T and B cells/ 少 class switch, 但機制尙不明確 ) film 課本 Fig 5-6
19 The introduction of P-and N-nucleotides at the joints between gene segments during Ig gene rearrangement
20 RAG: recombinationactivating gene 1/2 P-nucleotide addition (palindrome) N-nucleotide addition TdT: terminal deoxynucleotidyl transferase 3 OH 5 P DSBR: double-strand break repair
21
22 allelic exclusion
23
24 T-cell receptor gene rearrangement The germline organization of the human T-cell receptor and loci C1 and C2 are highly homologous.
25 TCR - and -chain gene rearrangement and expression CDR1 CDR2 CDR3
26 The organization of the human T-cell receptor and loci page 172 -chain locus is located within the -chain locus
27
28 TCR Ig (all TCR molecules) -gene is within -gene fewer V fragments, more Js of and chain use RAG1/2 enzymes follow the one-turn/two turn joining rule allelic exclusion is less stringent
29 The numbers of human TCR gene segments and the sources for TCR diversity compared with those of Igs
30 Structural variation in immunoglobulin constant regions
31 The properties of the human Ig isotypes
32 The Ig isotypes are encoded by a cluster of Ig heavy-chain C-region genes : pseudogene
33 The IgM and IgA molecules can form multimers
34 2 forms of Igs
35 Transmembrane and secreted forms of Ig are derived from the same heavy-chain sequence by alternative RNA processing
36 Coexpression of IgD and IgM is regulated by RNA processing
37 Synthesis, assembly, and secretion of the Igs IgM: H+L HL (HL) 2 IgG: 2H H 2 +L H 2 L+L H 2 L 2 (rough endoplasmic reticulum)
38 Immunoglobulin isotype (class) switch IgM 多 IgG 多
39 Isotype switching involves DNA recombination between specific switch signals 150 X (GAGCT)n(GGGGGT), n=3-7 Enzyme: unknown AID (activation-induced cytidine deaminase) UNG, APE1, Ku70:Ku80
40 AID (activation-induced cytidine deaminase) in class switching and somatic hypermutation Normal IgM, little IgG in AID -/- mice. AID 基因缺損相關疾病 ;hyper-igm syndrome (type II) AID 基因發現 : by Dr. Honjo in 2002
41 AID (activation-induced cytidine deaminase) in class switching and somatic hypermutation No somatic hypermutation in AID -/- mice.
42 Activation-induced cytidine deaminase (AID) is the initiator of mutations in somatic hypermutation, gene conversion, and class switching The sequence of AID is related to that of a protein known as APOBEC1 (apolipoprotein B mrna editing catalytic polypeptide 1), which convert cytosine to uracil by deamination in apolipoprotein B mrna.
43 Generation of single strand nicks in DAN by sequential action of AID, UNG, and APE1 UNG: uracil-dna-glycosylase (to form abasic site in the DNA) APE1: apurinic/apyrimidinic endonuclease 1 (to generate a single-strand nick) C U
44 Somatic hypermutation introduces variation into the rearranged Ig variable region that is subject to negative and positive selection to yield improved Ag binding (affinity maturation)
45 AID initiates processes that lead to somatic hypermutation, gene conversion and class switch recombination (synthesize DNA over the abasic sites and have a random nucleotide insertion ) (through homologous recombination with pseudogenes)
46 The primary antibody repertoire is diversified by three processes that modify the rearranged Ig gene
47 Class switching involves recombination between specific switch signals S : 150 repeats of (GAGCT) 3-7 (GGGGGT) - form R-loop 與 V(D)J recombination 不同之處? (page 186)
48 Changes in Ig and TCR genes that occur during B-cell and T-cell development and differentiation
49 Transcription regulation promoter enhancer NF- B 許多與癌症或細胞凋亡相關的重要轉錄因子
50
51 translocation bcl-i bcl-ii
Chapter 5. Genetic Models. Organization and Expression of Immunoglobulin Genes 3. The two-gene model: Models to Explain Antibody Diversity
Chapter 5 Organization and Expression of Immunoglobulin Genes 3 4 5 6 Genetic Models How to account for: ) Vast diversity of antibody specificities ) Presence of Variable regions at the amino end of Heavy
More informationAntibody Structure. Antibodies
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
More informationAntibody Structure supports Function
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
More informationT and B cell gene rearrangement October 17, Ram Savan
T and B cell gene rearrangement October 17, 2016 Ram Savan savanram@uw.edu 441 Lecture #9 Slide 1 of 28 Three lectures on antigen receptors Part 1 (Last Friday): Structural features of the BCR and TCR
More informationIMMUNOGLOBULIN GENES UNDERGO TWO DNA REARRANGEMENTS
A Prototype Ig Gene: Murine Kappa About 10 0 V κ gene segments 4 J Gene Segment s 1 C κ Gene Segmen t Multiple V gene segments, distant from J and C A few J gene segments One C gene segment GERMLINE Ig
More informationLECTURE: 22 IMMUNOGLOBULIN DIVERSITIES LEARNING OBJECTIVES: The student should be able to:
LECTURE: 22 Title IMMUNOGLOBULIN DIVERSITIES LEARNING OBJECTIVES: The student should be able to: Identify the chromosome that contains the gene segments that encode the surface immunoglobulin heavy chain
More informationGENETIC BASIS OF ANTIBODY STRUCTURE AND DIVERSITY. Steven J. Norris, Ph.D
GENETIC BASIS OF ANTIBODY STRUCTURE AND DIVERSITY Steven J. Norris, Ph.D Topics I. General principles II. The heavy chain Ig locus and VDJ rearrangement III. Light chain rearrangement. IV. Mechanisms of
More informationAtlas of Genetics and Cytogenetics in Oncology and Haematology. IMMUNOGLOBULIN GENES: CONCEPT OF DNA REARRANGEMENT * Introduction
Atlas of Genetics and Cytogenetics in Oncology and Haematology IMMUNOGLOBULIN GENES: CONCEPT OF DNA REARRANGEMENT * Introduction I Historical questions II Answers II.1 Light chains (kappa or lambda) II.1.1
More informationImmunoglobulins Harry W Schroeder Jr MD PhD
Immunoglobulins Harry W Schroeder Jr MD PhD Division of Developmental and Clinical Immunology Departments of Medicine, Microbiology, and Genetics University of Alabama at Birmingham Immunoglobulin Has
More informationImmunoglobulin, Ig. Wei Haiming
Immunoglobulin, Ig Wei Haiming ustcwhm@ustc.edu.cn 1 1. Concept 2 制备马血清 白喉伪膜 3 Behring(1890/1901): anti-toxin antibody The Nobel Prize in Physiology or Medicine 1901 "for his work on serum therapy, especially
More informationA Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks
A Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks SARAH K. DICKERSON AND F. NINA PAPAVASILIOU Laboratory of Lymphocyte Biology, The
More informationImmunoglobulins. Harper s biochemistry Chapter 49
Immunoglobulins Harper s biochemistry Chapter 49 Immune system Detects and inactivates foreign molecules, viruses, bacteria and microorganisms Two components with 2 strategies B Lymphocytes (humoral immune
More informationSPECIFICITY, DIVERSITY, AND IMMUNOGLOBULIN GENES
SPECIFICITY, DIVERSITY, AND IMMUNOGLOBULIN GENES ANTIBODY SPECIFICITY. This can be thought of in terms of the goodness of fit (affinity) between an antigenic determinant and a lymphocyte receptor or antibody.
More informationGerm-line vs somatic-variation theories
BME 128 Tuesday April 26 (1) Filling in the gaps Antibody diversity, how is it achieved? - by specialised (!) mechanisms Chp6 (Protein Diversity & Sequence Analysis) - more about the main concepts in this
More informationبسم هللا الرحمن الرحيم. Today we're going to talk about the generation of diversity of the receptors of the lymphocytes
بسم هللا الرحمن الرحيم Today we're going to talk about the generation of diversity of the receptors of the lymphocytes The receptors of lymphocytes are : 1. B cells : immunoglobulins ; which are cell bound
More information4 Themes in B cell development + Ig class switch and somatic mutation Tony DeFranco, 10/28/13 Checkpoints in B cell development: feedback from Ig
4 Themes in B cell development + Ig class switch and somatic mutation Tony DeFranco, 10/28/13 Checkpoints in B cell development: feedback from Ig gene rearrangements Lineage commitment: transcription factors
More informationLecture 3. Used anti B cell marker antibodies to deplete in mice
Lecture 3 V-Gene Rearrangement and Expression Used anti B cell marker antibodies to deplete in mice Rat anti mouse CD19, anti mouse B220, and anti mouse CD22. Mice were then injected with a secondary antibody
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationChapter 4. Antigen Recognition by B-cell and T-cell Receptors
Chapter 4 Antigen Recognition by B-cell and T-cell Receptors Antigen recognition by BCR and TCR B cells 2 separate functions of immunoglobulin (Ig) bind pathogen & induce immune responses recruit cells
More informationImmunological Techniques
Midterm Extra Office Hours Take Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina,
More informationGenomics and Biotechnology
Genomics and Biotechnology Expansion of the Central Dogma DNA-Directed-DNA-Polymerase RNA-Directed- DNA-Polymerase DNA-Directed-RNA-Polymerase RNA-Directed-RNA-Polymerase RETROVIRUSES Cell Free Protein
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationproduces an RNA copy of the coding region of a gene
1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More information1 Name. 1. (3 pts) What is apoptosis and how does it differ from necrosis? Which is more likely to trigger inflammation?
1 Name MCB 150 Midterm Eam #1 (100 points total) Please write your full name on each page of the eam!! The eam consists of 17 questions (6 pages). Each has a different point count as indicated. Please
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationMutagenesis. Classification of mutation. Spontaneous Base Substitution. Molecular Mutagenesis. Limits to DNA Pol Fidelity.
Mutagenesis 1. Classification of mutation 2. Base Substitution 3. Insertion Deletion 4. s 5. Chromosomal Aberration 6. Repair Mechanisms Classification of mutation 1. Definition heritable change in DNA
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationUnit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationMOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationCHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationWe are IntechOpen, the first native scientific publisher of Open Access books. International authors and editors. Our authors are among the TOP 1%
We are IntechOpen, the first native scientific publisher of Open Access books 3,350 108,000 1.7 M Open access books available International authors and editors Downloads Our authors are among the 151 Countries
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationLecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6
Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More informationThebiotutor.com A2 Biology OCR Unit F215: Control, genomes and environment Module 2.3 Genomes and gene technologies Answers
Thebiotutor.com A2 Biology OCR Unit F215: Control, genomes and environment Module 2.3 Genomes and gene technologies Answers Andy Todd 1 1. (i) plasmid cut by restriction enzyme; at specific sequence; same
More informationAmplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :
Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationANTIBODIES. Agents of Immunity
ANTIBODIES Agents of Immunity - Antibodies are: The Organization What are they? Protective agents of the immune system Neutralize foreign agents called antigens Essential part of the Adaptive Immune System
More informationGene Cloning & DNA Analysis
CSS451 CSS/HRT 451 Gene Cloning & DNA Analysis Chapter 4-5 T-DNA LB auxin cytokin opine Oncogenic genes RB vir genes ori opine catabolism Guo-qing Song Part 1 Basic principles Gene Cloning & DNA Analysis
More informationIn vitro cultures of bone marrow stromal cells and progenitor B cells can accurately recapitulate the normal steps of B cell development.
Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina, Tim, and I encourage all confused
More informationB cell development The stages of B cell development
Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina, Tim, and I encourage all confused
More informationDNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
More informationProblem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
More informationImmunology: Antibody Basics
e-learning JABSOM Immunology: Antibody Basics One :: General Structure Identify the Parts of an Antibody Two :: Isotypes Identify Antibody Isotypes Three :: Function Match Antibody Functions With Isotypes
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationSection 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?
Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationGenome editing. Knock-ins
Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in
More informationOmniAb. Naturally optimized human antibodies
OmniAb Naturally optimized human antibodies Transgenic animals for hmab discovery Only company to offer three platforms Patented technology with freedom to operate V L V H C C H 1 hinge C H 2 C H 3 2 28
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationName Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationB cell development in fetal liver and adult bone marrow
B cell development in fetal liver and adult bone marrow Von der Gemeinsamen Naturwissenschaftlichen Fakultät der Technischen Universität Carolo-Wilhelmina zu Braunschweig zur Erlangung des Grades einer
More informationAP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review
AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar
More informationLECTURE 26. a) A light-independent repair mechanism that involves three steps:
LECTURE 26 DNA REPAIR A. The capability for repair of damaged DNA is found in one form or another in all organisms. Prokaryotes (e.g., E. coli) have five repair systems, whereas higher organisms (e.g.,
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationUnit 1 Human cells. 1. Division and differentiation in human cells
Unit 1 Human cells 1. Division and differentiation in human cells Stem cells Describe the process of differentiation. Explain how differentiation is brought about with reference to genes. Name the two
More informationDNA REPLICATION. Anna Onofri Liceo «I.Versari»
DNA REPLICATION Anna Onofri Liceo «I.Versari» Learning objectives 1. Understand the basic rules governing DNA replication 2. Understand the function of key proteins involved in a generalised replication
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationSupporting Information
Supporting Information Table S1. Overview of samples used for sequencing, and the number of sequences obtained from each sample. Visit 1 is day 0, Visit 2 is day 7, Visit 3 is day 28, and Visit 4 is day
More informationProtein Synthesis. OpenStax College
OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will
More informationDNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA
DNA Replication DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA molecule can assume different structures
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationBIO303, Genetics Study Guide II for Spring 2007 Semester
BIO303, Genetics Study Guide II for Spring 2007 Semester 1 Questions from F05 1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5- Bromouracil such that
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationDNA Metabolism. I. DNA Replication. A. Template concept: 1. How can you make a copy of a molecule? 2. Complementary Hydrogen bonding
DNA Metabolism I. DNA Replication A. Template concept: 1. How can you make a copy of a molecule? 2. Complementary Hydrogen bonding B. DNA replication follows a set of fundamental rules 1. Semiconservative
More informationChapter 4: How Cells Work
Chapter 4: How Cells Work David Shonnard Department of Chemical Engineering 1 Presentation Outline: l l l l l Introduction : Central Dogma DNA Replication: Preserving and Propagating DNA Transcription:
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationLecture 18. PCR Technology. Growing PCR Industry
Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationHay fever cure.coli KAIT-JAPAN
Hay fever cure.coli KAIT-JAAN Background One of six person are developed hay fever. In JAAN Hay fever measures Take a medicine (anti-allergic drug and antihistamine drug) But There is a difference in the
More informationChapter 16: The Molecular Basis of Inheritance
AP Biology Reading Guide Name Chapter 16: The Molecular Basis of Inheritance Concept 16.1 DNA is the genetic material 1. What are the two chemical components of chromosomes? 2. The search for identifying
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationGenes found in the genome include protein-coding genes and non-coding RNA genes. Which nucleotide is not normally found in non-coding RNA genes?
Midterm Q Genes found in the genome include protein-coding genes and non-coding RNA genes Which nucleotide is not normally found in non-coding RNA genes? G T 3 A 4 C 5 U 00% Midterm Q Which of the following
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationDNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
More informationKeystone Biology Remediation B2: Genetics
Keystone Biology Remediation B2: Genetics Assessment Anchors: to describe and/or predict observed patterns of inheritance (i.e. dominant, recessive, codominance, incomplete dominance, sex-linked, polygenic,
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationCHAPTER 21 LECTURE SLIDES
CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More information