Supplemental Figure 1. Transcript profiles of Arabidopsis IPMS1 and IPMS2 in different tissues and developmental stages.

Transcription

1 Transcript level (intensity) Supplemental Data. Xing et al. Plant Cell (2017) /tpc IPMS1 IPMS2 Supplemental Figure 1. Transcript profiles of Arabidopsis IPMS1 and IPMS2 in different tissues and developmental stages. Transcript data are adapted from AtGenExpress ( 1

2 Transcript level of IPMS2 Supplemental Data. Xing et al. Plant Cell (2017) /tpc A ipms1-4 ipms1-5 ipms2-2 ipms2-1 IPMS1 ATG Allosteric domain IPMS2 ATG Allosteric domain B C IPMS1 (30 cycles) IPMS2 (30 cycles) ACTIN2 (30 cycles) ** ** Supplemental Figure 2. Transcript analysis of ipms loss-of-function single and double mutants. (A) T-DNA insertion sites in IPMS1 and IPMS2 gene structures in ipms loss-of-function mutants. See Figure 3A for details. (B) Transcript analysis of ipms1 and ipms2 loss-of-function mutants. IPMS1 and IPMS2 transcripts in Col-0, ipms1-4, ipms1-5, ipms2-1 and ipms1-1 D ipms2-1 (tfl102 ipms2-1) were detected using PCR. ACTIN2 mrna was measured as a control. (C) Results of qrt-pcr analysis. qrt-pcr was performed on ipms2-2 single mutant and ipms1-1 D ipms2-2 (tfl102 ipms2-2) double mutant to quantify IPMS2 transcript. IPMS2 transcript levels are normalized to that of the endogenous control E1F4A1. Data are shown as mean ± SD of four plants. The asterisks indicate significant differences compared to Col-0 wild type (** P < 0.01, Student s t- test). 2

3 Transcript level (intensity) Supplemental Data. Xing et al. Plant Cell (2017) /tpc AHASS1 AHASS2 Supplemental Figure 3. Comparison of AHASS1 and AHASS2 transcript levels during development. Transcript data are adapted from AtGenExpress ( 3

4 Transcript level of AHASS2 Transcript level of AHASS1 Transcript level of AHASS1 Transcript level of AHASS2 Supplemental Data. Xing et al. Plant Cell (2017) /tpc A ahass1-1 ahass1-2 AHASS1 ATG ACT1 ACT2 B ahass2-7 ahass2-8 AHASS2 ATG ACT1 ACT2 C 1.2 D 1.2 E 2.1 ** F ** ** ** ** ** Supplemental Figure 4. Transcript analysis of ahass loss-of-function single mutants. (A) to (B) Schematic representations of AHASS1 and AHASS2 gene structures with T-DNA insertion sites indicated. Refer to Figure 3A for gene structure details. (C) to (F) qrt-pcr analysis of transcript levels of AHASS1 and AHASS2 genes in ahass1 and ahass2 loss-of-function mutants. The transcript levels of AHASS1 and AHASS2 are normalized to that of the endogenous control gene E1F4A1. Transcript levels are shown as mean ± SD of four plants. Student s t-test was performed, ** P <

5 A D B Val + Leu (0.5mM) E Val (0.5mM) C Ile + Leu (0.5mM) F Leu (0.5mM) Val + Ile (0.5mM) Ile (0.5mM) Supplemental Figure 5. Individual and combined effects of BCAAs on the growth of wild-type Col-0. Wild-type Col-0 seeds were sown on half strength MS medium with and without 0.5mM BCAAs. For testing the effects of Val+Leu, Ile+Leu and Val+Ile on Col-0 seedling growth, equimolar amounts of these BCAAs were added to the medium. Photographs were taken one week after stratification. 5

6 Supplemental Figure 6. The AHASS2-1 D reconstituted enzyme is resistant to Val+Leu in vitro. The effect of Val+Leu on AHASS2-1 D reconstituted enzyme was tested in vitro. Enzyme activity is shown as the percentage of activity without Val and Leu. Error bars represent SD of three technical replicates (using the same sample). The substrate sodium pyruvate was added to a final concentration of 200mM in these assays. Refer to methods for more details. 6

7 Col-0 Col-0 Col-0 Col-0 Supplemental Data. Xing et al. Plant Cell (2017) /tpc A Pyr (0.5mM) Pyr (1mM) 2-OB (0.5mM) 2-OB (1mM) B C omr1-12 D Val+Leu (0.5mM) Val+Leu (0.5mM) omr1-12 D Val+Leu+Ile (0.5mM) Val+Leu+Ile (0.5mM) Supplemental Figure 7. The inhibition of wild-type Col-0 and omr1-12 D by Val+Leu can be reversed by Ile supplementation. Wild-type Col-0 and omr1-12 D seeds were sown on half strength MS medium with or without Pyruvate (Pyr), 2-oxobutanoate (2-OB), Val+Leu (equimolar) or Val+Leu+Ile (equimolar). Photographs were taken one week after stratification. 7

8 Supplemental Figure 8. Phylogenetic relationships among AHASS sequences from different species. The evolutionary history of AHASS was inferred by using the Maximum Likelihood method based on the Le_Gascuel_2008 model (Le and Gascuel, 2008) using MEGA6 software (Tamura et al., 2013). The tree with the highest log likelihood is shown. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories (+G, parameter = )). All positions with less than 90% site coverage were eliminated. Values on nodes represent support values obtained after 1000 bootstrap replicates. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Accession numbers of the sequences are given in brackets. 8

9 Supplemental Figure 9. Phylogenetic relationships among IPMS sequences from different species. The evolutionary history of IPMS was inferred by using the Maximum Likelihood method based on the Le_Gascuel_2008 model (Le and Gascuel, 2008) using MEGA6 software (Tamura et al., 2013). The tree with the highest log likelihood is shown. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories (+G, parameter = )). All positions with less than 90% site coverage were eliminated. Values on nodes represent support values obtained after 1000 bootstrap replicates. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Accession numbers of the sequences are given in brackets. 9

10 Supplemental Table 1. Summary of OMT- and TFL-resistant mutants. Allele ID Mutation AA # of mutants # of seed substitution carrying mutation pools Mutants with mutation AGI Domain affected omr1-11 D C to T Pro519Leu 2 2 omt6, omt7 a At3g10050 ACT2 omr1-12 D C to T Ala551Val 1 1 omt11 At3g10050 ACT2 omr1-13 D G to A Arg544His 1 1 omt13 At3g10050 ACT2 omr1-14 D C to T Ala422Val 1 1 omt3 At3g10050 ACT1 ahass2-1 D C to T Ser349Phe 4 2 tfl101, tfl106, tfl112, omt4 b At5g16290 ACT2 ahass2-2 D C to T Leu107Phe 3 2 tfl4,103,104 At5g16290 ACT1 ahass2-3 D G to A Gly95Glu 15 1 tfl1-3,63,64,67-69,71,74-77,80,89 At5g16290 ACT1 ahass2-4 D G to A Arg100Lys 1 1 tfl109 At5g16290 ACT1 ahass2-5 D G to A Gly101Arg 2 1 tfl116, tfl119 At5g16290 ACT1 ahass2-6 D C to T Leu321Phe 1 1 tfl110 At5g16290 ACT2 ipms1-1 D G to A Gly606Glu 2 2 tfl102, tfl111 At1g18500 C-term allosteric domain ipms1-2 D C to T Ala558Val 1 1 tfl118 At1g18500 C-term allosteric domain ipms1-3 D G to A Gly498Glu 1 1 tfl121 At1g18500 C-term allosteric domain a The omt7 mutant was sick and no further characterization was performed. b The weak OMT-resistant mutant omt4 contains the ahass2-1 D mutation. 10

11 Supplemental Table 2. Genetic linkage analysis of the OMT and TFL resistance traits. F 2 population omr1-11 D Ler F 2 omr1-12 D Ler F 2 omr1-13 D Ler F 2 ahass2-1 D (tfl106) Ler F 2 ipms1-1 D (tfl111) Ler F 2 Gene affected OMR1 OMR1 OMR1 AHASS2 IPMS1 Genetic Location of # of plants per genotype group a Total # of plants marker marker HM (Col-0) HT HM (Ler) genotyped P-value b CAPS1-1 Chr <0.01 AMU Chr CAPS1-1 Chr <0.01 AMU Chr CAPS1-1 Chr <0.01 AMU Chr CAPS2-1 Chr <0.01 AMU Chr CAPS3-1 Chr <0.01 AMU Chr a HM = Homozygotes, HT = Heterozygotes. b P-values were calculated using the chi-square test. 11

12 Supplemental Table 3. OMR1 enzyme kinetic analysis. Enzyme K m (mm) V max (nmol s -1 ) K cat (s -1 ) K cat /K m (s -1 mm -1 ) OMR1-wt 19 ± ± ± ± 0.3 OMR1-11 D 21 ± ± 0.01** 120 ± 1** 5.7 ± 0.4 OMR1-12 D 20 ± ± 0.01** 150 ± 2** 7.7 ± 0.2** OMR1-13 D 23 ± 0.7** 0.62 ± 0.01** 123 ± 2** 5.3 ± 0.2 Kinetic analysis was performed on wild-type and OMR1 D enzymes to test whether the mutations affect the catalytic efficiency of the mutant enzymes. Data are expressed as mean ± SD of three technical replicates (using the same sample). The asterisks indicate significant differences compared to the wild type OMR1 enzyme (** P < 0.01, Student s t-test). 12

13 Supplemental Table 4. Levels of free BCAAs in doubly heterozygous ahass2-1 D /AHASS2;omr1 D /OMR1 and ipms1-1 D /IPMS1;omr1 D /OMR1 mutant seedlings. Mutant Ile Ile Val Val Leu Leu Val+Leu Val+Leu (nmol/mg fw) (FC a ) (nmol/mg fw) (FC a ) (nmol/mg fw) (FC a ) (nmol/mg fw) (FC a ) Col ± A 0.11 ± A ± A 0.17 ± 0.01 A ahass2-1 D /AHASS ± A ± 0.03 B ± 0.01 B ± 0.04 C 2.4 ahass2-1 D /AHASS2;omr1-11 D /OMR1 1.5 ± 0.07 C ± 0.04 C ± 0.01 D ± 0.05 D 3.8 omr1-11 D /OMR1 1.3 ± 0.04 B ± 0.01 A ± 0.01 C ± 0.01 B 1.7 Col ± A 0.11 ± A ± A 0.17 ± 0.01 A ahass2-1 D /AHASS ± A ± 0.03 B ± 0.01 B ± 0.04 B 2.4 ahass2-1 D /AHASS2;omr1-12 D /OMR ± 0.01 B ± 0.01 B ± 0.01 B ± 0.02 B 2.1 omr1-12 D /OMR ± 0.02 C ± 0.02 A ± 0.01 B ± 0.03 A 1.4 Col ± A 0.11 ± A ± A 0.17 ± 0.01 A ipms1-1 D /IPMS ± A NC b 0.067± 0.01 C ± A ± 0.01 C 0.76 ipms1-1 D /IPMS1;omr1-11 D /OMR1 1.2 ± 0.08 B ± C ± 0.01 C ± 0.01 B 1.7 omr1-11 D /OMR1 1.3 ± 0.04 B ± 0.01 B ± 0.01 B ± 0.01 B 1.7 Col ± A 0.11 ± A ± A 0.17 ± 0.01 A ipms1-1 D /IPMS ± A NC b 0.067± 0.01 B ± AB ± 0.01 A 0.76 ipms1-1 D /IPMS1;omr1-12 D OMR ± 0.01 B ± B ± 0.01 B ± 0.01 A 0.82 omr1-12 D /OMR ± 0.02 C ± 0.02 A ± 0.01 B ± 0.03 B 1.4 a FC = Fold change compared to wild type. b NC = No change compared to Col-0 wild type. Free BCAA levels are expressed as mean ± SE of six to eight biological replicates (extracts from different individual plants). All lines were grown and assayed in the same experiment. Data were analyzed by a one-way analysis of variance (ANOVA) with a significance threshold of P < The letters indicate the outcome (P < 0.05) of multiple comparisons based on Duncan s multiple range test (Duncan, 1955). 13

14 Supplemental Table 5. Levels of free BCAAs in doubly heterozygous ahass2-1 D /AHASS2;ipms1-1 D /IPMS1 mutant seedlings. Mutant Ile Ile Val Val Leu Leu Val+Leu Val/(Val+Leu) Leu/(Val+Leu) (nmol/mg fw) (FC a ) (nmol/mg fw) (FC a ) (nmol/mg fw) (FC a ) (nmol/mg fw) (ratio 100) (ratio 100) Col-0 (WT) ± A 0.12 ± 0.01 A ± A 0.18 ± 0.01 A 70 ± 1 A 30 ± 1 A ahass2-1 D /AHASS ± A ± 0.01 D ± B ± 0.01 B 80 ± 1 B 20 ± 1 B ahass2-1 D /AHASS2;ipms1-1 D /IPMS ± B ± 0.02 C ± 0.02 C ± 0.03 B 52 ± 1 C 48 ± 1 C ipms1-1 D /IPMS ± A ± B ± AB ± 0.01 A 52 ± 2 C 48 ± 2 C a FC = Fold change compared to wild type. Data are expressed as mean ± SE of six to eight biological replicates (extracts from different individual plants). Data were analyzed by a one-way analysis of variance (ANOVA) with a significance threshold of P < The letters indicate the outcome (P < 0.05) of multiple comparisons based on Duncan s multiple range test (Duncan, 1955). 14

15 Supplemental Table 6. Levels of free BCAAs in ipms feedback-resistant and loss-of-function single and double mutant seedlings. Category Mutant Ile Ile Val Val Leu Leu Val+Leu Val+Leu Val/(Val+Leu) Leu/(Val+Leu) (nmol/mg fw) (FC a ) (nmol/mg fw) (FC a ) (nmol/mg fw) (FC a ) (nmol/mg fw) (FC a ) (ratio 100) (ratio 100) WT Col ± A 0.14 ± 0.02 A ± 0.01 A 0.19 ± 0.02 A 74 ± 1 A 26 ± 1 A ipms1 ipms2 ipms ± A ± 0.03 C ± A ± 0.03 C ± 0.5 C 9.0 ± 1 C ipms ± A ± 0.04 D ± 0.01 A ± 0.05 C ± 1 C 10 ± 1 C ipms ± A ± 0.01 A ± A ± 0.01 A NC b 70 ± 1 AD 30 ± 1 AD ipms ± A NC b 0.14 ± 0.01 A NC b ± 0.01 A ± 0.02 AD ± 1 D 33 ± 1 D ipms1-1 D tfl ± A ± 0.01 B ± 0.01 B ± 0.01 A NC b 30 ± 2 B 70 ± 2 B tfl ± A NC b ± B ± 0.01 B ± 0.01 A NC b 30 ± 1 B 70 ± 1 B ipms1-1 D ipms2 tfl102 ipms ± 0.01B ± 0.03 AB ± 0.03 C ± 0.05 B ± 3 B 72 ± 3 B tfl102 ipms ± 0.01 B ± 0.02 AB ± 0.03 D ± 0.05 BD ± 3 B 73 ± 3 B a FC = Fold change compared with wild type. b NC = No change compared to Col-0 wild type. Free BCAA levels are expressed as mean ± SE of six to eight biological replicates (extracts from different individual plants). Data were analyzed by a one-way analysis of variance (ANOVA) with a significance threshold of P < The letters indicate the outcome (P < 0.05) of multiple comparisons based on Duncan s multiple range test (Duncan, 1955). Wild-type Col-0 and ipms1-1 D mutant samples are the same as in Table 4. 15

16 Supplemental Table 7. Levels of free BCAAs in ahass1 and ahass2 loss-of-function single mutant seedlings. Mutant Ile Ile Val Val Leu Leu Val+Leu Val+Leu Val/(Val+Leu) Leu/(Val+Leu) (nmol/mg fw) (FC a ) (nmol/mg fw) (FC a ) (nmol/mg fw) (FC a ) (nmol/mg fw) (FC a ) (ratio 100) (ratio 100) Col ± ± ± ± ± 1 26 ± 1 ahass ± ± 0.01** ± ± 0.01** ± 1** 19 ± 1** ahass ± ± 0.01** ± ± 0.01** ± 1** 19 ± 1** Col ± ± ± ± ± 1 30 ± 1 ahass ± ± 0.04** ± 0.01** ± 0.004** ± 1 28 ± 1 ahass ± ± ± ± ± 1 31 ± 1 a FC = Fold Change compared with wild type. Free BCAA levels are expressed as mean ± SE of six to eight biological replicates (extracts from different individual plants). The asterisks indicate significant differences compared to wild type (** P < 0.01, Student s t- test). Wild-type Col-0 samples in the ahass1 analysis are the same as in Table 4 and Supplemental Table 6. 16

17 Supplemental Table 8. Levels of free BCAAs in ahass1/ahass1;ahass2-1 D /AHASS2 double mutant seedlings. Mutant Ile Ile Val Val Leu Leu (nmol/mg fw) (FC a ) (nmol/mg fw) (FC a ) (nmol/mg fw) (FC a ) Col ± A 0.12 ± A ± A ahass1-1/ahass ± AB ± 0.01 B ± A 1.3 ahass1-2/ahass ± AB ± 0.01 BC ± AB 1.4 ahass2-1 D /AHASS2 F ± AB ± 0.01 BC ± AB 1.4 ahass2-1 D /AHASS2 F ± C ± 0.01 D ± B 1.7 ahass1-1/ahass1-1;ahass2-1 D /AHASS2 F ± E ± 0.03 F ± 0.01 C 5.0 ahass2-1 D /AHASS2 F ± B ± C ± AB 1.4 ahass1-2/ahass1-2;ahass2-1 D /AHASS2 F ± D ± 0.02 F ± 0.01 C 5.2 ahass2-1 D /ahass2-1 D ± E ± 0.02 E ± 0.01 C 5.0 a FC = Fold Change compared with wild type. Free BCAA levels are expressed as mean ± SE of six to eight biological replicates (extracts from different individual plants). Data were analyzed by a one-way ANOVA with a significance threshold of P < The letters indicate the outcome (P < 0.05) of multiple comparisons based on Duncan s multiple range test (Duncan, 1955). 17

18 Supplemental Table 9. Primers used in this study. Primer Name Sequence Description Genotyping 1 OMR1_2F GGACGTGAATGTCGTAGCC Amplification of the two ACT domains in OMR1 2 OMR1_2R ACGCTCATCCGACAGACAC Amplification of the two ACT domains in OMR1 3 IPMS1_1F GGCTATTGTAGGAGCGAATG Amplification of the Leu allosteric domain in IPMS1 4 IPMS1_1R CTCTTTTGACATGCAACTTCG Amplification of the Leu allosteric domain in IPMS1 5 AHASS2_4F CGGCTTGTGATAGGTGCG Amplification of the 1st ACT domain in AHASS2 6 AHASS2_3R CAACTTTGAACATCCACCCA Amplification of the 1st ACT domain in AHASS2 7 AHASS2_1F TCCGTTTTGGAGATTTTCAG Amplification of the 2nd ACT domain in AHASS2 8 AHASS2_1R GAGACATCAATGGCTTTAGCAC Amplification of the 2nd ACT domain in AHASS2 9 AHASS1_2F TGGCGATGAAATGGGTAA Amplification of the 1st ACT domain in AHASS1 10 AHASS1_2R CAGGCTACAGTGCGAAACA Amplification of the 1st ACT domain in AHASS1 11 AHASS1_3F GGAGATGTTTATCCCGTTGAG Amplification of the 2nd ACT domain in AHASS1 12 AHASS1_4R AAACAGACAAGACCAGGAAATG Amplification of the 2nd ACT domain in AHASS1 13 AK-HSDH I_2F CTCTGCCCCTGGAACAAT Amplification of the ACT domains in AK-HSDH I 14 AK-HSDH I_1R GATCCCTATAACACGCAAGTC Amplification of the ACT domains in AK-HSDH I 15 SALK_101771_LP TGGTCCCTTCATGTCAGTTTC Genotyping of ipms SALK_101771_RP CAACAAGGGAAGTTGCAGAAG Genotyping of ipms WiscDsLoxHs221_05F_LP GTGCCTAACGGTCCTCTTTTC Genotyping of ipms WiscDsLoxHs221_05F_RP CCAGTTCCAATAGAACAAGCG Genotyping of ipms WiscDsLox426A07_LP ATCTACAGGTCCGGTTCCAAC Genotyping of ipms WiscDsLox426A07_RP GCCCCATAAGGCTATTGTAGG Genotyping of ipms SALK_046876_LP TAATCAGATCAACCTCCACCG Genotyping of ipms SALK_046876_RP CAGCTTCGAAATCGTCTTTTG Genotyping of ipms WiscDsLoxHs009_02G_LP ATCCGGTTTTGTACTCAACCC Genotyping of ahass WiscDsLoxHs009_02G_RP GCTGAGAGAACAGTGGCATTC Genotyping of ahass WiscDsLoxHs110_12G_LP ATCCGGTTTTGTACTCAACCC Genotyping of ahass WiscDsLoxHs110_12G_RP ACGCAATGCCAATAGAAACTG Genotyping of ahass SALK_108628_LP ATTTTTAGGTACACGTCCGGG Genotyping of ahass SALK_108628_LP ACGCTGCTGCTAGAAGAGATG Genotyping of ahass SALK_096207_LP TCTTCACCATCTATTCGCTGC Genotyping of ahass SALK_096207_RP GCTCTGAATGTGTCAACTAGCC Genotyping of ahass Lba1 TGGTTCACGTAGTGGGCCAT Insert primer for SALK lines 32 P745 AACGTCCGCAATGTGTTATTAAGTTGTC Insert primer for WiscDsLox lines 33 L4 TGATCCATGTAGATTTCCCGGACATGAAG Insert primer for WiscDsLoxHs lines Genetic markers 34 CAPS1-1F AATGCTAGTCAAACCCCACC CAPS marker adjacent to OMR1, digested with NcoI 35 CAPS1-1R ATGCAACAAGACACGGGAAG CAPS marker adjacent to OMR1, digested with NcoI 36 CAPS2-1F CGGCTTGTGATAGGTGCG CAPS marker in AHASS2, digested with ApoI 37 CAPS2-1R CAACTTTGAACATCCACCCA CAPS marker in AHASS2, digested with ApoI 38 CAPS3-1F ATGGGTGGGCGGTGAAAT CAPS marker adjacent to IPMS1, digested with BstEII 39 CAPS3-1R GCATCCAAGGACAATCTCG CAPS marker adjacent to IPMS1, digested with BstEII 40 AMU-4-272_1F GTGGGCCGGGCCTGGTAGTA INDEL marker on Chr.4 41 AMU-4-272_1R GAAGGGTCTGCTTGGGTTAC INDEL marker on Chr.4 Recombinant protein expression 42 Thr DHT_F (NcoI) CATGCCATGGCTCTTCCTTTACCACGTCTTAAGGTC For expressing pet28b_omr1 recombinant protein 43 Thr DHT_R (NotI) ATAAGAATGCGGCCGCGTGCATCAGAAGCTTAAAATAGTCG For expressing pet28b_omr1 recombinant protein 44 AHASL_C2F (NcoI) CATGCCATGGGCTCCAGCTCTCCCTCCTCC For expressing pet28b_ahasl recombinant protein 45 AHASL_C2R (XhoI) CCGCTCGAGGTATTTAATCCGGCCATCTC For expressing pet28b_ahasl recombinant protein 46 IPMS1_C1F (NcoI) CATGCCATGGGCTGCTCAATCTCAGATCCTTCTC For expressing pet28b_ipms1 recombinant protein 47 IPMS1_C1R (XhoI) CCGCTCGAGGGCAGCGACTCTGTTTTTTTG For expressing pet28b_ipms1 recombinant protein 48 AHASS2_C5F (BamHI) CGCGGATCCGCTCAATCTGTAGCTCCGAC For expressing pgex-4t-1_ahass2 recombinant protein 49 AHASS2_C2R-6 His (XhoI) CCGCTCGAGTCAGTGGTGGTGGTGGTGGTGCAAAGGAAGAGAGTATCCAC For expressing pgex-4t-1_ahass2 recombinant protein 50 ARSU-70_F (BamHI) CGCGGATCCTCTTTCTCCGAAGCTTCATCTG For expressing pgex-4t-1_ahass1 recombinant protein 51 ARSU-70_R-6 His (XhoI) CCGCTCGAGTCAGTGGTGGTGGTGGTGGTGGCCTGTTAAAGGAAAGGAGTATC For expressing pgex-4t-1_ahass1 recombinant protein qrt-pcr and transcript analysis 53 EIF4A1-qp_F TCATAGATCTGGTCCTTGAAACC Endogenous control for qrt-pcr 54 EIF4A1-qp_R GGCAGTCTCTTCGTGCTGAC Endogenous control for qrt-pcr 55 AHASS2-qp_F CCACCTCGCAGATTCCAT For qrt-pcr of AHASS2 56 AHASS2-qp_R GCTCAAGTTTTCCGTGCTAA For qrt-pcr of AHASS2 57 AHASS1-qp_F TGTGGCATTGGCTCGTG For qrt-pcr of AHASS1 58 AHASS1-qp_R TGTCTGTCTTTGAGTTGGTTCAT For qrt-pcr of AHASS1 59 IPMS2-qp_F ACGAAGTCCCTGCCTGAA For qrt-pcr of IPMS2 60 IPMS2-qp_R AAATCTTTTAGACGTTTACTCATC For qrt-pcr of IPMS2 61 ACTIN2_F CACCCTGTTCTTCTTACCGA Endogenous control for transcript analysis of ipms loss-of-function mutants 62 ACTIN2_R ATCTCCTGCTCGTAGTCAAC Endogenous control for transcript analysis of ipms loss-of-function mutants 63 IPMS1_E1F TGCTCAATCTCAGATCCTTCTC For transcript analysis of ipms loss-of-function mutants 64 IPMS1_E1R GGCAGCGACTCTGTTTTTTTG For transcript analysis of ipms loss-of-function mutants 65 IPMS2_C1F CTTACCACCGCCGGAAAATT For transcript analysis of ipms loss-of-function mutants 66 IPMS2_C1R AGGCAGGGACTTCGTTGG For transcript analysis of ipms loss-of-function mutants 18

19 Supplemental Table 10. ABRC stock numbers of the mutants. Mutant ABRC stock # Locus Allele symbol (polymorphism name) Inheritance Genotype omr1-11 D CS69720 At3g10050 omr1-11 D dominant homozygous omr1-12 D CS69721 At3g10050 omr1-12 D dominant homozygous omr1-13 D CS69722 At3g10050 omr1-13 D dominant homozygous omr1-14 D CS69723 At3g10050 omr1-14 D dominant homozygous tfl101 CS69724 At5g16290 ahass2-1 D dominant homozygous tfl106 CS69725 At5g16290 ahass2-1 D dominant homozygous tfl4 CS69726 At5g16290 ahass2-2 D dominant homozygous tfl103 CS69727 At5g16290 ahass2-2 D dominant homozygous tfl2 CS69728 At5g16290 ahass2-3 D dominant homozygous tfl89 CS69729 At5g16290 ahass2-3 D dominant homozygous ahass2-4 D CS69730 At5g16290 ahass2-4 D dominant homozygous ahass2-5 D CS69731 At5g16290 ahass2-5 D dominant heterozygous ahass2-6 D CS69732 At5g16290 ahass2-6 D dominant heterozygous tfl102 CS69733 At1g18500 ipms1-1 D dominant homozygous tfl111 CS69734 At1g18500 ipms1-1 D dominant homozygous ipms1-2 D CS69735 At1g18500 ipms1-2 D dominant heterozygous ipms1-3 D CS69736 At1g18500 ipms1-3 D dominant heterozygous ahass2-7 CS69737 At5g16290 WiscDsLoxHs009_02G recessive homozygous ahass2-8 CS69738 At5g16290 WiscDsLoxHs110_12G recessive homozygous ahass1-1 CS69740 At2g31810 SALK_ recessive homozygous ahass1-2 CS69739 At2g31810 SALK_ recessive homozygous ipms1-4 CS69741 At1g18500 SALK_ recessive homozygous ipms1-5 CS69742 At1g18500 WiscDsLoxHs221_05F recessive homozygous ipms2-1 CS69743 At1g74040 WiscDsLox426A07 recessive homozygous ipms2-2 CS69744 At1g74040 SALK_ recessive homozygous ahass1-2 ahass2-1 D CS69745 At2g31810/At5g16290 SALK_108628;tfl106 recessive; dominant heterozygous/heterozygous ahass1-1 ahass2-1 D CS69746 At2g31810/At5g16290 SALK_096207;tfl106 recessive; dominant heterozygous/heterozygous ipms1-1 D ipms2-1 CS69747 At1g18500/At1g74040 tfl102;wiscdslox426a07 dominant; recessive homozygous ipms1-1 D ipms2-2 CS69748 At1g18500/At1g74040 tfl102;salk_ dominant; recessive homozygous ahass2-1 D ipms1-1 D CS69749 At5g16290/At1g18500 ahass2-1 D ipms1-1 D (tfl101;tfl102) dominant; dominant heterozygous/heterozygous ahass2-1 D omr1-11 D CS69750 At5g16290/At3g10050 ahass2-1 D omr1-11 D (tfl101;omr1-11 D ) dominant; dominant heterozygous/heterozygous ahass2-1 D omr1-12 D CS69751 At5g16290/At3g10050 ahass2-1 D omr1-12 D (tfl101;omr1-12 D ) dominant; dominant heterozygous/heterozygous ipms1-1 D omr1-11 D CS69752 At1g18500/At3g10050 ipms1-1 D omr1-11 D (tfl102;omr1-11 D ) dominant; dominant heterozygous/heterozygous ipms1-1 D omr1-12 D CS69753 At1g18500/At3g10050 ipms1-1 D omr1-12 D (tfl102;omr1-12 D ) dominant; dominant heterozygous/heterozygous 19