Supplementary Information
|
|
- Miranda Todd
- 6 years ago
- Views:
Transcription
1 Supplementary Information MLL histone methylases regulate expression of HDLR- in presence of estrogen and control plasma cholesterol in vivo Khairul I. Ansari 1, Sahba Kasiri 1, Imran Hussain 1, Samara Morris Bobzean 2, Linda Perrotti 2 and Subhrangsu S. Mandal* 1 1 Department of Chemistry and Biochemistry, 2 Department of Psychology, The University of Texas at Arlington, Arlington, Texas 76019
2 E2 (nm) β-actin Figure S1. Effects of 17β-estradiol (E2) on gene expression. HEPG2 cells, grown in phenol-red free media, were treated with varying concentrations of E2 for 6 h. Cells were harvested and the protein extract of the cell was subjected to western blotting using antibodies specific to. β-actin antibody was used as loading control.
3 A Temoxifen (nm) E2 (nm) S rrna 18S rrna Expression (relative to GAPDH) GAPDH B Time (h) S rrna 18S rrna Expression (relative to GAPDH) GAPDH Figure S2. Effects of 17β-estradiol (E2) on gene expression in placenta choriocarcinoma (JAR) cells. (A) JAR cells, grown in phenol-red free media, were treated with varying concentrations of E2 for 6 h. RNA was isolated and analyzed by RT- PCR using primers specific to SRB1. GAPDH and rrnas were used as quantitative and qualitative control. The real-time-pcr quantification is shown in the bottom panel. Bars indicate standard errors (n = 3; p < 0.05). (B) Temporal effect of E2-exposure on expression. JAR cells were treated with 100 nm E2 for varying time periods. RNA was analyzed by RT-PCR. The real time PCR quantification is shown in the bottom panel (n = 3). Bars indicate standard errors (p < 0.05).
4 A β-actin T47D MCF7 HEPG2 ERα- HEPG2 ERα B HEPG2 ERα-HEPG2 E2 (10 nm) GAPDH SRB1 expression relative to GAPDH HEPG2 ERα-HEPG2 Figure S3. Expression of ERα in different cells and its effect on E2 induced SRB1 expression. The protein extract of T47D, MCF7, HEPG2 and transient ERα transfected HEPG2 cells were subjected to Western blot analysis using ERα antibody. β-actin antibody was used as loading control. (B) HEPG2 and transient ERα transfected HEPG2 cells were treated with 10 nm E2 for 6 h. The RNA was subjected to PCR analysis with primer specific to SRB1. GAPDH was used as loading control. The real time quantification of SRB1 expression relative to GAPDH is shown in the bottom panel. Each treatment was done in three replicates.
5 β-actin ERβ Figure S4. Effect of antisense treatment on expression of ERα and ERβ. HEPG2 cells were transfected with ERα and ERβ specific antisenses for 48 h. A scramble antisense was used as control. (A) The total protein extracts of control, scramble antisense and ERα antisense treated cells were subjected to western blot analysis using antibodies specific to ERα (Upstate), and β-actin (loading control). (B). The Western blot analysis of the protein extract of the cells treated with ERβ antisense with ERβ and β-actin antibodies.
6 Figure S5. Effects of MLLs knockdown on expression: HEPG2 cells were transfected with MLL1, MLL3, MLL4, and scramble antisenses separately for 48 h and then treated with 100 nm E2 for 6 h. RNA was analyzed by RT-PCR using primers specific to and respective MLLs. rrna was used as loading control., MLL1, MLL4 and MLL3 were also used as antisense-specificity control in panels A, B, C and D, respectively. Real time quantification of gene expression relative to GAPDH is shown in respective bottom panels. Bars indicate standard errors (n = 3).
7 A B C D Figure S6. Effect of antisense treatment on expression of MLLs. HEPG2 cells were transfected with MLL1,, MLL3 and MLL4 specific antisenses for 48 h. A scramble antisense was used as control. (A) The total protein extracts of control, scramble antisense and specific antisense treated cells were subjected to western blot analysis using antibodies specific to MLL1 (lifespan bioscience), (lifespan bioscience), MLL3 (Abgent), MLL4 (Sigma) and β-actin (loading control). (B-D). The Western blot analysis of the protein extract of the cells treated with MLL1, MLL3, and MLL4 antisense with corresponding antibodies.
8 Gene expression relative to GAPDH 0 Control Scramble antisense antisense MLL1 MLL3 MLL4 Genes Control Sramble antisense Figure S7. Effect of -knockdown on expression of MLL1,, MLL3 and MLL4. HEPG2 cells were transfected with, and scramble antisenses separately for 48 h. RNA was analyzed by real time PCR (qpcr) using primers specific to MLL1,, MLL3, MLL4 and GAPDH (loading control). Relative numbers of amplicons at different PCR cycles are plotted. Each reaction is done with at least three replicates each time and repeated twice.
9 A Antisense E2 (100nM) 18s rrna 28s rrna + + Expression relative to GAPDH MLL MLL B Antisense E2 (100nM) s rrna 28s rrna Expression relative to GAPDH MLL MLL Figure S8 (A-B). Effects of knockdown on expression: HEPG2 cells were transfected with -1 and -2 and scramble antisenses separately for 48 h and then treated with 100 nm E2 for 6 h. RNA was analyzed by RT-PCR using primers specific to and. rrna was used as loading control. MLL1 was used as antisense-specificity control. Real time quantification of gene expression relative to GAPDH is shown in respective bottom panels. Bars indicate standard errors (n = 3; p < 0.05).
10 A (Human) ERE1:TCCTACTCACAGTGACCAACCATGATGAT ERE2:GTTGGAGCACATGGTCAGAATGCAAGGAC ERE3:TTTCGCCATGTTGGTCAGGCTGGTCTCCA B (Mouse) SP1 rich region (SP1RR SP1 binding sites ERE1: GAGCTAACTCTGGGTCATATTGCTGAAGG ERE2: GGTATACTCAGAGGTCAGAGGAGGGGCAT SP1 rich region (SP1RR SP1 binding sites Figure S9. Schematic diagram showing estrogen responsive elements (ERE) and SP1 binding sites in the promoters of (A) human (B) mice gene (up to nt).
11 Antisense None Input ERα ERβ H3K4- tri-met RNAPII Recruitment relative to input None H3K4 tri-met RNAPII Figure S10. Effect of -knockdown on level of H3K4 tri-methylation and recruitment of RNAPII on ERE3 region of promoter. Athymic nude (nu/nu) mice were intraperitoneally administrated with 300 µg of -antisense for three times at 24 h interval. Mice were sequentially perfused with 4% formaldehyde at 96 h after final administration. Control mice were administrated with PBS. The liver tissue of the control and antisense-treated mice were collected and subjected to chromatin immunoprecipitation assay using antibodies specific to, ERα, ERβ, H3K4 tri-methyl and RNAPII. Real time quantification of recruitment level is shown in the right panel.
supplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1.
Supplementary Figure 1. Characterization and high expression of Lnc-β-Catm in liver CSCs. (a) Heatmap of differently expressed lncrnas in Liver CSCs (CD13 + CD133 + ) and non-cscs (CD13 - CD133 - ) according
More informationGFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationSupplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1
Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11
More informationCell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on
Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin
More informationFigure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.
Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out
More informationSupplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationThyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation
1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura
More informationSupplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationCorrection: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis
CORRECTION Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis Tokameh Mahmoudi, Sylvia F. Boj, Pantelis Hatzis, Vivian S. W. Li,
More informationComparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More informationSupplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
More informationHCT116 SW48 Nutlin: p53
Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates
More informationIsolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
More informationQuantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationTumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Nicholas Love 11/28/01 A. What is p21? Introduction - p21 is a gene found on chromosome 6 at 6p21.2 - this gene
More informationConstruction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationSupplementary Figure and Table Legends
1 Supplementary Figure and Table Legends Figure S1: Whole-animal metabolic analysis. 12 week old WT and Dvl1 / were singly housed in CLAMS cages (Comprehensive Laboratory Animals Monitoring System) for
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationSupplemental Information. HEXIM1 and NEAT1 Long Non-coding RNA Form. a Multi-subunit Complex that Regulates. DNA-Mediated Innate Immune Response
Molecular Cell, Volume 67 Supplemental Information HEXIM1 and NEAT1 Long Non-coding RNA Form a Multi-subunit Complex that Regulates DNA-Mediated Innate Immune Response Mehdi Morchikh, Alexandra Cribier,
More informationReal-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation
Real-Time PCR Workshop Gene Expression Applications Absolute and Relative Quantitation Absolute Quantitation Easy to understand the data, difficult to develop/qualify the standards Relative Quantitation
More informationApplications and Uses. (adapted from Roche RealTime PCR Application Manual)
What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it
More informationsirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationEPIGENTEK. EpiQuik In Situ Histone H3-K27 Tri-Methylation Assay Kit. Base Catalog # P-3014T PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik In Situ Histone H3-K27 Tri-Methylation Assay Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik In Situ Histone H3-K27 Tri-Methylation Assay Kit is suitable for specifically
More informationSupporting Information
Supporting Information Horie et al. 10.1073/pnas.1008499107 SI Materials and Methods ell ulture and Reagents. THP-1 cells were obtained from the American Type ell ollection. THP-1 cells were transformed
More informationAlternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationA) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical
A) B) Ladder C) r4 r4 Nt- -Ct 78 kda Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical calpains is shown. The protease core consists of
More informationSupplementary Materials
Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran
More informationSensitivity vs Specificity
Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome
More informationSupplementary Figure 1. Representative results of MEF cultures of the different CBX7
SUPPLEMENTARY DATA Supplementary Figure 1. Representative results of MEF cultures of the different CBX7 genotypes. Growth curve is the average of two independent primary MEF isolates of the indicated genotype.
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationSupplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
More informationDeliverX and DeliverX Plus sirna Transfection Kits
DeliverX and DeliverX Plus sirna Transfection Kits User Manual P/N 10586.060504 Rev. A DRAFT May 4, 2006 4:41 pm DeliverXTtile.fm Panomics, Inc. DeliverX and DeliverX Plus sirna Transfection Kit User Manual
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/323/5910/124/dc1 Supporting Online Material for Regulation of Neuronal Survival Factor MEF2D by Chaperone-Mediated Autophagy Qian Yang, Hua She, Marla Gearing, Emanuela
More informationChemically defined conditions for human ipsc derivation and culture
Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationGalina Gabriely, Ph.D. BWH/HMS
Galina Gabriely, Ph.D. BWH/HMS Email: ggabriely@rics.bwh.harvard.edu Outline: microrna overview microrna expression analysis microrna functional analysis microrna (mirna) Characteristics mirnas discovered
More informationGalea GL et al, J Biol Chem Supplementary Figure 1
Galea GL et al, J Biol Chem Supplementary Figure 1 Supplementary Figure 1: Characterisation of long bone osteoblastic cells derived from mouse long bone diaphyses. A) clbobs treated with or without differentiation
More informationIMMUNOPRECIPITATION (IP)
1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us
More informationSupplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock
Molecular Cell, Volume 49 Supplemental Information PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock Dafne Campigli Di Giammartino, Yongsheng Shi, and James L. Manley Supplemental Information
More informationNTM486-04, NTM174-04,
Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.
More informationSupplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge
Supplement Figure 1 Plin5 Plin2 Plin1 KDEL-DSRed Plin-YFP Merge Supplement Figure 2 A. Plin5-Ab MitoTracker Merge AML12 B. Plin5-YFP Cytochrome c-cfp merge Supplement Figure 3 Ad.GFP Ad.Plin5 Supplement
More informationConvoy TM Transfection Reagent
Convoy TM Transfection Reagent Catalog No.11103 0.25ml (40-80 transfections in 35mm dishes) Catalog No.11105 0.5 ml (80-165 transfections in 35mm dishes) Catalog No.11110 1.0 ml (165-330 transfections
More informationPTH Effects Bone Healing and Vasculogenesis in Calvaria Bone Allograft Model
PTH Effects Bone Healing and Vasculogenesis in Calvaria Bone Allograft Model Dmitriy Sheyn, PhD 1, Doron Cohn-Yakubovich, BSc 2, Ilan Kallai, MSc 2, Susan Su, MD 1, Xiaoyu Da, MSc 1, Gadi Pelled, DMD,
More informationX2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP
FRET efficiency.7.6..4.3.2 X2-C/X1-Y X2-C/VCAM-Y.1 1 2 3 Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently
More informationTOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
More informationBronchial epithelium and its associated tissues act as a
The Journal of Immunology A JNK-Independent Signaling Pathway Regulates TNF -Stimulated, c-jun-driven FRA-1 Protooncogene Transcription in Pulmonary Epithelial Cells 1 Pavan Adiseshaiah,* Dhananjaya V.
More informationSupplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching
More informationTrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by
Supplemental Information Cell Culture TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by transducing BBM1 or 361 cells with a lentivirus encoding shrna for TrkB. Transduction was
More informationNature Structural and Molecular Biology: doi: /nsmb.2959
Supplementary Figure 1 EIciNAs were pulled down with an antibody to Pol II. (a) Western blot showing that pol II was efficiently pulled down with a pol II antibody in HeLa cell lysates. (b) The enrichment
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationSupplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina
More informationSupplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
More informationsirna Transfection Reagent
Description RiboJuice 0.3 ml 71115-3 1.0 ml 71115-4 Description RiboJuice efficiently delivers small interfering RNA (sirna) into a wide range of mammalian cell lines for targeted gene suppression (1).
More information#9005. SimpleChIP Plus Enzymatic Chromatin IP Kit (Magnetic Beads) n 1 Kit. (30 Immunoprecipitations) Store at RT, 4 C, and 20 C
Store at RT, 4 C, and 20 C #9005 SimpleChIP Plus Enzymatic Chromatin IP Kit (Magnetic Beads) 3 n 1 Kit (30 Immunoprecipitations) rev. 09/05/17 Orders n 877-616-CELL (2355) orders@cellsignal.com Support
More informationSupplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationInt. J. Mol. Sci. 2016, 17, 1259; doi: /ijms
S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,
More informationTechnical Note. Housekeeping Protein Validation Protocol
Technical Note Housekeeping Protein Validation Protocol Published March 2017. The most recent version of this Technical Note is posted at licor.com/bio/support. Visit us on protocols.io! Explore an interactive
More informationSupplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo
YMTHE, Volume 25 Supplemental Information Loss of MicroRNA-7 Regulation Leads to a-synuclein Accumulation and Dopaminergic Neuronal Loss In Vivo Kirsty J. McMillan, Tracey K. Murray, Nora Bengoa-Vergniory,
More informationSupplementary Figure 1. Lnc-β-Catm characterization. (A, B) LncBRM silenced
Supplementary Figure 1. Lnc-β-Catm characterization. (A, B) LncBRM silenced Hep3B (A) and Huh7 (B) cells were established using psicor lentivirus, followed by sphere formation assays. (C, D) LncBRM deleted
More informationRNA Polymerase III Subunit POLR3G Regulates Specific Subsets of
Stem Cell Reports, Volume 8 Supplemental Information RNA Polymerase III Subunit POLR3G Regulates Specific Subsets of PolyA + and SmallRNA Transcriptomes and Splicing in Human Pluripotent Stem Cells Riikka
More informationSupplemental Data. Regulating Gene Expression. through RNA Nuclear Retention
Supplemental Data Regulating Gene Expression through RNA Nuclear Retention Kannanganattu V. Prasanth, Supriya G. Prasanth, Zhenyu Xuan, Stephen Hearn, Susan M. Freier, C. Frank Bennett, Michael Q. Zhang,
More informationNature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
More informationSupplementary Figure 1.
Supplementary Figure 1. Assessment of quaternary structure of soluble RSV F proteins. Soluble variants of F proteins from A2 and B1 RSV strains were expressed in HEK293 cells. The cell culture supernatants
More informationStudent Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
More informationFigure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining.
Supplementary information Supplementary figures Figure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining. Figure S2. Induction of Nur77 in
More informationGene Expression on the Fluidigm BioMark HD
Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental
More information64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl
Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)
More informationSupplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy
Supplementary Material Levels of protein drive the reparative process in acute muscle injury and muscular dystrophy Francesca Riuzzi 1,4 *, Sara Beccafico 1,4 *, Roberta Sagheddu 1,4, Sara Chiappalupi
More informationAssay Design Considerations, Optimization and Validation
Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment
More informationBLOCK-iT Transfection Optimization Kit
BLOCK-iT Transfection Optimization Kit Catalog no. 13750-047 Version B 27 June 2007 25-0718 User Manual ii Table of Contents Table of Contents...iii Kit Contents and Storage... v Accessory Products...vi
More informationChapter 24: Promoters and Enhancers
Chapter 24: Promoters and Enhancers A typical gene transcribed by RNA polymerase II has a promoter that usually extends upstream from the site where transcription is initiated the (#1) of transcription
More informationTransIT-TKO Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery
More informationNature Methods: doi: /nmeth Supplementary Figure 1. Validation of RaPID with EDEN15
Supplementary Figure 1 Validation of RaPID with EDEN15 (a) Full Western Blot of conventional biotinylated RNA pulldown with EDEN15 and scrambled control (n=3 biologically independent experiments, representative
More informationLe proteine regolative variano nei vari tipi cellulari e in funzione degli stimoli ambientali
Le proteine regolative variano nei vari tipi cellulari e in funzione degli stimoli ambientali Tipo cellulare 1 Tipo cellulare 2 Tipo cellulare 3 DNA-protein Crosslink Lisi Frammentazione Immunopurificazione
More informationImpact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis
Impact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis The mammalian system undergoes ~24 hour cycles known as circadian rhythms that temporally orchestrate metabolism, behavior,
More informationThe microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and
SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen
More informationmir-24-mediated down-regulation of H2AX suppresses DNA repair
Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn
More informationSupporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
More informationThe preparation of native chromatin from cultured human cells.
Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the
More informationGTTCGGGTTCC TTTTGAGCAG
Supplementary Figures Splice variants of the SIP1 transcripts play a role in nodule organogenesis in Lotus japonicus. Wang C, Zhu H, Jin L, Chen T, Wang L, Kang H, Hong Z, Zhang Z. 5 UTR CDS 3 UTR TCTCAACCATCCTTTGTCTGCTTCCGCCGCATGGGTGAGGTCATTTTGTCTAGATGACGTGCAATTTACAATGA
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2774 Figure S1 TRF2 dosage modulates the tumorigenicity of mouse and human tumor cells. (a) Left: immunoblotting with antibodies directed against the Myc tag of the transduced TRF2 forms
More informationscgem Workflow Experimental Design Single cell DNA methylation primer design
scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease
More informationNucleic Acid Research Group Study: A Follow Up on the Comparison of Different Priming Strategies for cdna synthesis by Reverse Transcriptase
Nucleic Acid Research Group 2008-2009 Study: A Follow Up on the Comparison of Different Priming Strategies for cdna synthesis by Reverse Transcriptase NARG Survey Results for Types of Primers Used for
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationEpigenetics in. Saccharomyces cerevisiae. Chapter 4 2/4/14
Epigenetics in Saccharomyces cerevisiae Chapter 4 2/4/14 The budding yeast - Saccharomyces cerevisiae The fission yeast - Schizosaccharomyces pombe The budding yeast, Saccharomyces cerevisiae and the fission
More informationSupplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
More information