Supplementary Information

Transcription

1 Supplementary Information MLL histone methylases regulate expression of HDLR- in presence of estrogen and control plasma cholesterol in vivo Khairul I. Ansari 1, Sahba Kasiri 1, Imran Hussain 1, Samara Morris Bobzean 2, Linda Perrotti 2 and Subhrangsu S. Mandal* 1 1 Department of Chemistry and Biochemistry, 2 Department of Psychology, The University of Texas at Arlington, Arlington, Texas 76019

2 E2 (nm) β-actin Figure S1. Effects of 17β-estradiol (E2) on gene expression. HEPG2 cells, grown in phenol-red free media, were treated with varying concentrations of E2 for 6 h. Cells were harvested and the protein extract of the cell was subjected to western blotting using antibodies specific to. β-actin antibody was used as loading control.

3 A Temoxifen (nm) E2 (nm) S rrna 18S rrna Expression (relative to GAPDH) GAPDH B Time (h) S rrna 18S rrna Expression (relative to GAPDH) GAPDH Figure S2. Effects of 17β-estradiol (E2) on gene expression in placenta choriocarcinoma (JAR) cells. (A) JAR cells, grown in phenol-red free media, were treated with varying concentrations of E2 for 6 h. RNA was isolated and analyzed by RT- PCR using primers specific to SRB1. GAPDH and rrnas were used as quantitative and qualitative control. The real-time-pcr quantification is shown in the bottom panel. Bars indicate standard errors (n = 3; p < 0.05). (B) Temporal effect of E2-exposure on expression. JAR cells were treated with 100 nm E2 for varying time periods. RNA was analyzed by RT-PCR. The real time PCR quantification is shown in the bottom panel (n = 3). Bars indicate standard errors (p < 0.05).

4 A β-actin T47D MCF7 HEPG2 ERα- HEPG2 ERα B HEPG2 ERα-HEPG2 E2 (10 nm) GAPDH SRB1 expression relative to GAPDH HEPG2 ERα-HEPG2 Figure S3. Expression of ERα in different cells and its effect on E2 induced SRB1 expression. The protein extract of T47D, MCF7, HEPG2 and transient ERα transfected HEPG2 cells were subjected to Western blot analysis using ERα antibody. β-actin antibody was used as loading control. (B) HEPG2 and transient ERα transfected HEPG2 cells were treated with 10 nm E2 for 6 h. The RNA was subjected to PCR analysis with primer specific to SRB1. GAPDH was used as loading control. The real time quantification of SRB1 expression relative to GAPDH is shown in the bottom panel. Each treatment was done in three replicates.

5 β-actin ERβ Figure S4. Effect of antisense treatment on expression of ERα and ERβ. HEPG2 cells were transfected with ERα and ERβ specific antisenses for 48 h. A scramble antisense was used as control. (A) The total protein extracts of control, scramble antisense and ERα antisense treated cells were subjected to western blot analysis using antibodies specific to ERα (Upstate), and β-actin (loading control). (B). The Western blot analysis of the protein extract of the cells treated with ERβ antisense with ERβ and β-actin antibodies.

6 Figure S5. Effects of MLLs knockdown on expression: HEPG2 cells were transfected with MLL1, MLL3, MLL4, and scramble antisenses separately for 48 h and then treated with 100 nm E2 for 6 h. RNA was analyzed by RT-PCR using primers specific to and respective MLLs. rrna was used as loading control., MLL1, MLL4 and MLL3 were also used as antisense-specificity control in panels A, B, C and D, respectively. Real time quantification of gene expression relative to GAPDH is shown in respective bottom panels. Bars indicate standard errors (n = 3).

7 A B C D Figure S6. Effect of antisense treatment on expression of MLLs. HEPG2 cells were transfected with MLL1,, MLL3 and MLL4 specific antisenses for 48 h. A scramble antisense was used as control. (A) The total protein extracts of control, scramble antisense and specific antisense treated cells were subjected to western blot analysis using antibodies specific to MLL1 (lifespan bioscience), (lifespan bioscience), MLL3 (Abgent), MLL4 (Sigma) and β-actin (loading control). (B-D). The Western blot analysis of the protein extract of the cells treated with MLL1, MLL3, and MLL4 antisense with corresponding antibodies.

8 Gene expression relative to GAPDH 0 Control Scramble antisense antisense MLL1 MLL3 MLL4 Genes Control Sramble antisense Figure S7. Effect of -knockdown on expression of MLL1,, MLL3 and MLL4. HEPG2 cells were transfected with, and scramble antisenses separately for 48 h. RNA was analyzed by real time PCR (qpcr) using primers specific to MLL1,, MLL3, MLL4 and GAPDH (loading control). Relative numbers of amplicons at different PCR cycles are plotted. Each reaction is done with at least three replicates each time and repeated twice.

9 A Antisense E2 (100nM) 18s rrna 28s rrna + + Expression relative to GAPDH MLL MLL B Antisense E2 (100nM) s rrna 28s rrna Expression relative to GAPDH MLL MLL Figure S8 (A-B). Effects of knockdown on expression: HEPG2 cells were transfected with -1 and -2 and scramble antisenses separately for 48 h and then treated with 100 nm E2 for 6 h. RNA was analyzed by RT-PCR using primers specific to and. rrna was used as loading control. MLL1 was used as antisense-specificity control. Real time quantification of gene expression relative to GAPDH is shown in respective bottom panels. Bars indicate standard errors (n = 3; p < 0.05).

10 A (Human) ERE1:TCCTACTCACAGTGACCAACCATGATGAT ERE2:GTTGGAGCACATGGTCAGAATGCAAGGAC ERE3:TTTCGCCATGTTGGTCAGGCTGGTCTCCA B (Mouse) SP1 rich region (SP1RR SP1 binding sites ERE1: GAGCTAACTCTGGGTCATATTGCTGAAGG ERE2: GGTATACTCAGAGGTCAGAGGAGGGGCAT SP1 rich region (SP1RR SP1 binding sites Figure S9. Schematic diagram showing estrogen responsive elements (ERE) and SP1 binding sites in the promoters of (A) human (B) mice gene (up to nt).

11 Antisense None Input ERα ERβ H3K4- tri-met RNAPII Recruitment relative to input None H3K4 tri-met RNAPII Figure S10. Effect of -knockdown on level of H3K4 tri-methylation and recruitment of RNAPII on ERE3 region of promoter. Athymic nude (nu/nu) mice were intraperitoneally administrated with 300 µg of -antisense for three times at 24 h interval. Mice were sequentially perfused with 4% formaldehyde at 96 h after final administration. Control mice were administrated with PBS. The liver tissue of the control and antisense-treated mice were collected and subjected to chromatin immunoprecipitation assay using antibodies specific to, ERα, ERβ, H3K4 tri-methyl and RNAPII. Real time quantification of recruitment level is shown in the right panel.