SUPPLEMENTARY INFORMATION
|
|
- Vernon Reed
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTARY INFORMATION Supplementary Figure S1. Efficacy of STIM1 knockdown by electroporation of STIM1 sirnas. (a) Western blot of FDB muscles from 4 mice treated with either STIM1-specific sirna (KD) or negative control sirna (Ctrl). 5 μg of protein was loaded into each lane. (b) Quantification of both upper (STIM1L) and lower (STIM1S) STIM1 bands normalized to a non-specific band as loading control. Comparable knockdown was observed for both STIM1L (80±5%) and STIM1S (62±12%). *p<0.05 by Student s t-test, n=4 mice. Error bars represent s.e.m.
2 Supplementary Figure S2. Repetitive high frequency tetanic stimulation protocol. (a) (Top) Schematic diagram of the repetitive high frequency tetanic stimulation protocol (50 Hz, 500 ms, every 2.5 seconds, 60 tetani) used to stimulate Ca 2+ transients in single FDB fibres. (Bottom) Representative raw mag-fluo-4 fluorescence trace elicited during a single tetanus (500 ms at 50 Hz). The regions used to calculate baseline, peak, and tail integral (hatched area) are indicated. (b) Representative raw mag-fluo-4 fluorescence traces (for tetani 2, 30, 60) from a FDB fibre of a WT mouse elicited during repetitive high frequency tetanic stimulation in the absence (left) and presence of 0.2 mm La 3+ plus 0.5 mm Cd 2+ (right).
3 Supplementary Figure S3. Relative expression of endogenous STIM1, endogenous Orai1, and dnorai1 protein in dnorai1 mice. (a) (Left) Western blot analysis and quantification (right) of endogenous WT Orai1 and dnorai1 in TA muscles of 3 WT and 3 dnorai1 line 5 transgenic (TG) mice. 5 μg of protein was loaded into each lane and α-actinin was used as a loading control. (b) (Left) Western blot analysis and quantification (right) of endogenous STIM1S and STIM1L from TA muscles from 3 WT and 3 dnorai1 line 5 TG mice. 5 μg of protein was loaded into each lane and GAPDH was used as a loading control. Error bars represent s.e.m.
4 Supplementary Figure S4. Relative SERCA, DHPR 1S, CSQ1 and RyR1 expression are unaltered in dnorai1 transgenic mice. (a) (Left) Western blot analysis and quantification (right) of SERCA in TA muscles from 3 WT and 3 dnorai1 line 5 transgenic (TG) mice. (b) (Left) Western blot analysis and quantification (right) of RyR1 (upper blot) and CSQ1, (lower blot) in TA muscles from 3 WT and 3 dnorai1 line 5 TG mice. (c) (Left) Western blot analysis and quantification (right) of DHPR 1S in TA muscles from 3 WT and 3 dnorai1 line 5 TG mice. 5 μg of protein was loaded into each lane and GAPDH was used as a loading control. Error bars represent s.e.m.
5 WT WT dnorai1 WT dnorai1 τ decay (ms) a WT dnorai1 0.2 ΔF/F 0 b s c 20 Peak F/F d 0.1 ΔR 10 s Ionomycin/CPA/EGTA/0Ca WT dnorai1 e Fura2FF Ratio 340/ *dnorai1 Supplementary Figure S5. Electrically-evoked Ca 2+ release and reuptake is unaltered, but SR Ca 2+ content is reduced in FDB fibres from dnorai1 transgenic mice. (a) Representative mag-fluo-4 fluorescence traces elicited by 3 consecutive electrically-evoked twitch stimuli (1Hz) in FDB fibres from WT (left) and dnorai1 line 5 TG mice (right). (b) Average (± s.e.m.) peak increase in relative mag-fluo-4 fluorescence ( F/F 0 ) amplitude during 1 Hz electrical stimulation in FDB fibres from WT (n=15) and dnorai1 line 5 TG mice (n=17). (c) Average (±s.e.m.) time constant of decay of electrically-evoked magfluo-4 twitch transients in FDB fibres from WT (n=15) and dnorai1 TG mice (n=17). (d-e) Representative fura2-ff fluorescence traces (d) and average (± s.e.m.) increase in Fura2-FF 340/380nm ratio (e) for WT and dnorai FDB fibres during application of Ca 2+ store release cocktail (10 μm ionomycin, 30 μm CPA, and 100 μm EGTA/0 Ca 2+ ). *p<0.01 by Student s-t test. n=11 for WT and n=6 for dnorai1.
6 Supplementary Figure S6. Reduced peak force and increased susceptibility to fatigue in EDL from dnorai1 line #86 mice. (a) Average (±s.e.m.) peak specific force during a single 500 ms tetanus at 150 Hz in EDL from WT (Black bar, n=10 muscles from 5 mice) and dnorai1 line #86 (Grey bar, n=4 muscles from 2 mice). * P<0.01 student s-t test. (b) Average (±s.e.m.) peak specific force during 60 consecutive tetanic stimuli (500 ms, at 50Hz, every 2.5 s) in EDL muscles from WT (filled circles,, n=8 muscles from 4 mice) or line 86 dnorai1 mice (open circles,, n=4 muscles from 2 mice).
7 Supplementary Figure S7. Full length images for immunoblots. Red boxes indicate the cropped images used in the figures. A single blot was cut and probed using different primary antibodies as indicated.
8 SUPPLEMENTARY TABLES Supplementary Table S1. Sequences of STIM1 sirnas and negative control sirnas. Target Sequence STIM1 Neg. Control GUGCAGUACUACAACAUCA GUGAUGAGUUCCUAAGGGA CGAAACAUCCAUAAGCUGA GCACCGAACUGUGGAAGUA UAGCGACUAAACACAUCAA UAAGGCUAUGAAGAGAUAC AUGUAUUGGCCUGUAUUAG AUGAACGUGAAUUGCUCAA
9 Supplementary Table S2. Primary antibodies for western blot and immunocytochemistry (ICC). Antigen Host Dilution Manufacturer Usage GOK/STIM1 HA-tag DHPR RyR1, 34C Mouse, Mouse, Mouse, Mouse, 1:350 BD Bioscience Western blot 1:10000/1:3000 Covance Western blot/icc 1:400 Thermo Fisher Western blot Scientific 1:40/1:30 Developmental Studies Western Hybridoma Bank, blot/icc University of Iowa 1:5000 Thermo Fisher Western blot Scientific Calsequestrin Mouse, SERCA Rabbit, poly 1:5000 Santa Cruz Western blot GAPDH Mouse, 1:50000 Applied Western blot Biosystems/Ambion α-actinin, EA-53 Mouse, 1:5000/1:200 Sigma-Aldrich Western blot/icc Orai1 N-terminus Rabbit, poly 1: 1000 Gift from Prof. V. Westernblot/ICC Flockerzi STIM1 (Cterminal) Rabbit, poly 1:100 Sigma-Aldrich ICC Anti-mouse IgG 1:2000 Bio-Rad Western-blot HRP Anti-rabbit IgG 1:2000 Bio-rad Western-bot HRP Anti-mouse IgG 1:1000 Invitrogen ICC Alexa Fluor 488 Anti-rabbit IgG 1:500 Jackson ICC Rhodmine ImmunoResearch
0.9 5 H M L E R -C tr l in T w is t1 C M
a. b. c. d. e. f. g. h. 2.5 C elltiter-g lo A ssay 1.1 5 M T S a s s a y Lum inescence (A.U.) 2.0 1.5 1.0 0.5 n s H M L E R -C tr l in C tr l C M H M L E R -C tr l in S n a il1 C M A bsorbance (@ 490nm
More informationSpironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1. Generation of a synaptobrevin2-mrfp knock-in mouse. (a) Targeting strategy of Syb2-mRFP knock-in mouse leaving the synaptobrevin2 gene locus intact except
More informationPositive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and
Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For
More informationSupplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.
More informationSupplementary Figure Legends
Supplementary Figure Legends Figure S1 gene targeting strategy for disruption of chicken gene, related to Figure 1 (f)-(i). (a) The locus and the targeting constructs showing HpaI restriction sites. The
More informationMethods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis
Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding
More informationMannen et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB Mannen et al., http ://www.jcb.org /cgi /content /full /jcb.201601024 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Characterization of SNB components. (A) SNB localization of Venus-tagged
More informationStargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression
Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3363 Supplementary Figure 1 Several WNTs bind to the extracellular domains of PKD1. (a) HEK293T cells were co-transfected with indicated plasmids. Flag-tagged proteins were immunoprecipiated
More informationA human immunodeficiency caused by mutations in the PIK3R1 gene. Whole exome sequencing. Whole exome sequencing libraries were prepared from 3
A human immunodeficiency caused by mutations in the PIK3R1 gene. Supplementary Methods Whole exome sequencing. Whole exome sequencing libraries were prepared from 3 µg of genomic DNA extracted from total
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Monteiro et al., http://www.jcb.org/cgi/content/full/jcb.201306162/dc1 Figure S1. 3D deconvolution microscopy analysis of WASH and exocyst
More informationDCLK-immunopositive. Bars, 100 µm for B, 50 µm for C.
Supplementary Figure S1. Characterization of rabbit polyclonal anti-dclk antibody. (A) Immunoblotting of COS7 cells transfected with DCLK1-GFP and DCLK2-GFP expression plasmids probed with anti-dclk antibody
More informationSupplementary information
Supplementary information Table of Content: Supplementary Results... 2 Supplementary Figure S1: Experimental validation of AP-MS results by coimmunprecipitation Western blot analysis.... 3 Supplementary
More informationSupplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
More informationSupplementary Information
Supplementary Information Supplementary Figure S1 (a) P-cRAF colocalizes with LC3 puncta. Immunofluorescence (IF) depicting colocalization of P-cRAF (green) and LC3 puncta (red) in NIH/3T3 cells treated
More informationSupplementary Information
Supplementary Information Supplementary Figure 1: Identification of new regulators of MuSC by a proteome-based shrna screen. (a) FACS plots of GFP + and GFP - cells from Pax7 ICN -Z/EG (upper panel) and
More informationSupplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1
Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1
More informationSupplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy
Supplementary Material Levels of protein drive the reparative process in acute muscle injury and muscular dystrophy Francesca Riuzzi 1,4 *, Sara Beccafico 1,4 *, Roberta Sagheddu 1,4, Sara Chiappalupi
More informationSupplemental Table 1: Sequences of real time PCR primers. Primers were intronspanning
Symbol Accession Number Sense-primer (5-3 ) Antisense-primer (5-3 ) T a C ACTB NM_001101.3 CCAGAGGCGTACAGGGATAG CCAACCGCGAGAAGATGA 57 HSD3B2 NM_000198.3 CTTGGACAAGGCCTTCAGAC TCAAGTACAGTCAGCTTGGTCCT 60
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and
More informationCD93 and dystroglycan cooperation in human endothelial cell adhesion and migration
/, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More information15 June 2011 Supplementary material Bagriantsev et al.
Supplementary Figure S1 Characterization of K 2P 2.1 (TREK-1) GOF mutants A, Distribution of the positions of mutated nucleotides, represented by a red x, from a pool of 18 unselected K 2P 2.1 (KCNK2)
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationVERIFY Tagged Antigen. Validation Data
VERIFY Tagged Antigen Validation Data Antibody Validation Figure 1. Over-expression cell lysate for human STAT3 (NM_139276) was used to test 3 commercial antibodies. Antibody A shows strong antigen binding.
More informationSupporting Information
Supporting Information Stavru et al. 0.073/pnas.357840 SI Materials and Methods Immunofluorescence. For immunofluorescence, cells were fixed for 0 min in 4% (wt/vol) paraformaldehyde (Electron Microscopy
More informationThe STIM1-Orai1 pathway of store-operated Ca 2+ entry controls the checkpoint in cell cycle G1/S transition
The STIM1-Orai1 pathway of store-operated Ca 2+ entry controls the checkpoint in cell cycle G1/S transition Yun-Wen Chen 1, Yih-Fung Chen 1,5,Ying-Ting Chen 1, Wen-Tai Chiu 2, Meng-Ru Shen 1,3,4 1 Departments
More informationMeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
More informationhnrnp D/AUF1 Rabbit IgG hnrnp M
Mouse IgG Goat IgG Rabbit IgG Mouse IgG hnrnp F Goat IgG Mouse IgG Kb 6 4 3 2 15 5 Supplementary Figure S1. In vivo binding of TERRA-bound RBPs to target RNAs. Immunoprecipitation (IP) assay using 3 mg
More informationCell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More informationFigure S1. Specificity of immunofluorescence staining in STC-1 cells. STC-1 cells
Supplementary Figures and Tables Figure S1. Figure S1. Specificity of immunofluorescence staining in STC-1 cells. STC-1 cells were treated with donkey-anti rabbit antibody conjugated with Dylight488 or
More informationSupplementary Information Supplementary Figure 1
Bararia, Kwok et al, Supplementary Page 1 Supplementary Information Supplementary Figure 1 S1 Bararia, Kwok et al, Supplementary Page 2 Supplementary Figure 1 (cont.) S2 Bararia, Kwok et al, Supplementary
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune
More informationsupplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
More informationA guide to selecting control, diluent and blocking reagents
Specializing in Secondary Antibodies and Conjugates A guide to selecting control, diluent and blocking reagents Optimize your experimental protocols with Jackson ImmunoResearch Secondary antibodies and
More informationA guide to selecting control, diluent and blocking reagents
Specializing in Secondary Antibodies and Conjugates A guide to selecting control, diluent and blocking reagents Optimize your experimental protocols with Jackson ImmunoResearch Secondary antibodies and
More informationSupplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface.
Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface. (a) Human PDAC cell lines were treated as indicated in Figure 1 panel F. Cells were analyzed for FITC-rBAG3 binding
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
More informationSupplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
More informationSupplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
More informationResveratrol inhibits epithelial-mesenchymal transition of retinal. pigment epithelium and development of proliferative vitreoretinopathy
Resveratrol inhibits epithelial-mesenchymal transition of retinal pigment epithelium and development of proliferative vitreoretinopathy Keijiro Ishikawa, 1,2 Shikun He, 2, 3 Hiroto Terasaki, 1 Hossein
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/429/ra54/dc1 Supplementary Materials for Dephosphorylation of the adaptor LAT and phospholipase C by SHP-1 inhibits natural killer cell cytotoxicity Omri Matalon,
More information42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)
SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca
More informationbronchial epithelial cells (I). Bronchi are outlined with dashed line. Scale bars = 25 µm, if not
Supplemental Figure S1: ronchial epithelial cell polarity and integrity is maintained in bronchi. (A-E) Staining for selected markers of bronchial cell differentiation and intracellular compartments is
More informationGenome-wide CRISPR screen reveals novel host factors required for Staphylococcus aureus α-hemolysin-mediated toxicity
Genome-wide CRISPR screen reveals novel host factors required for Staphylococcus aureus α-hemolysin-mediated toxicity Sebastian Virreira Winter, Arturo Zychlinsky and Bart W. Bardoel Department of Cellular
More informationAntibodies and reagents Construction and characterization of YFP-TF chimera
Antibodies and reagents Antibodies: mouse monoclonal antibodies (mab) against PDI (clone 34, BD Transduction and RL90, Affinity Bioreagents); rabbit polyclonals against bovine PDI (SPA-890, Stressgen and
More informationExperimental Protocol for Multiplex Fluorescent Blotting Using the ChemiDoc MP Imaging System
Experimental Protocol for Multiplex Fluorescent Blotting Using the ChemiDoc MP Imaging System Protocol Bulletin 6570 Stefanie L. Ritter and Donald G. Rainie, Deparment of Behavioral Neuroscience and Psychiatric
More informationaffects the development of newborn neurons Brain Mind Institute and School of Life Sciences, Ecole Polytechnique Fédérale de
Shedding of neurexin 3β ectodomain by ADAM10 releases a soluble fragment that affects the development of newborn neurons Erika Borcel* a, Magda Palczynska* a, Marine Krzisch b, Mitko Dimitrov a, Giorgio
More informationSupplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time
More informationSupplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or
More informationSupplemental Information Control of apico-basal epithelial polarity by the microtubule minus-end binding protein CAMSAP3 and spectraplakin ACF7
Supplemental Information Control of apico-basal epithelial polarity by the microtubule minus-end binding protein CAMSAP3 and spectraplakin ACF7 Ivar Noordstra, Qingyang Liu, Wilco Nijenhuis, Shasha Hua,
More informationSupporting Information
Supporting Information Cheng et al. 10.1073/pnas.1207354109 SI Materials and Methods Generation of Stim1 Stim2 Double-KO Mice and Assessment of Saliva Secretion. T-cell specific deletion of Stim1 and Stim2
More informationAttenuated Ca 2+ release in a mouse model of limb girdle muscular dystrophy 2A
DiFranco et al. Skeletal Muscle (2016) 6:11 DOI 10.1186/s13395-016-0081-y RESEARCH Attenuated Ca 2+ release in a mouse model of limb girdle muscular dystrophy 2A Marino DiFranco 2,3*, Irina Kramerova 1,3,
More informationAlpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by
Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by down-regulating PKA and CREB activation Sudha Saryu Malhotra 1, Pankaj Suman 2 and Satish Kumar Gupta 1 * 1 Reproductive
More informationSupplementary Information
Supplementary Information Supplementary Figure 1: Over-expression of CD300f in NIH3T3 cells enhances their capacity to phagocytize AC. (a) NIH3T3 cells were stably transduced by EV, CD300f WT or CD300f
More informationBmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone
Generation and culture of bone marrow-derived dendritic cells (bmdcs) BmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone marrow cells from murine tibias and femurs
More informationSupplementary Information attached to:
Supplementary Information attached to: "Involvement of TrkB- and p75 NTR -signaling pathways in two contrasting forms of long-lasting synaptic plasticity" by Sakuragi, S., Tominaga-Yoshino, K. & Ogura,
More informationF4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated
SDC MATERIALS AND METHODS Flow Cytometric Detection of A-Antigen Expression Single cell suspensions were prepared from bone marrow, lymph node and spleen. Peripheral blood was obtained and erythrocytes
More informationSupplementary Information. Title BRD3 and BRD4 BET Bromodomain Proteins Differentially Regulate Skeletal Myogenesis
Supplementary Information Title BRD3 and BRD4 BET Bromodomain Proteins Differentially Regulate Skeletal Myogenesis Authors Thomas C. Roberts 1,2, Usue Etxaniz 1, Alessandra Dall Agnese 1, Shwu-Yuan Wu
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
More informationThis Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Haberman et al., http://www.jcb.org/cgi/content/full/jcb.201108088/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Loss of neurotransmitter release in Drosophila photoreceptors
More informationSupplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
More informationControl of cortex development by ULK4, a rare risk gene for mental disorders including schizophrenia
Control of cortex development by ULK4, a rare risk gene for mental disorders including schizophrenia Bing Lang, Lei Zhang, Guanyu Jiang, Ling Hu, Wei Lan, Lei Zhao, Irene Hunter, Michal Pruski, Ning-Ning
More informationB Vehicle 1V270 (35 μg) 1V270 (100 μg) Days post tumor implantation. Vehicle 100μg 1V270 biweekly 100μg 1V270 daily
Supplemental Figure 1 A 1 1V7 (8 μg) 1 1V7 (16 μg) 8 6 4 B 1 1 8 6 4 1V7 (35 μg) 1V7 (1 μg) 5 1 15 5 1 15 C Biweekly 8 11 14 17 Days Implant SCC7 cells Daily 8 9 1 11 1 Implant SCC7 cells 1V7 i.t. treatment
More informationMultiple layers of B cell memory with different effector functions. Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos,
Multiple layers of B cell memory with different effector functions Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos, Jérome Mégret, Sébastien Storck, Claude-Agnès Reynaud & Jean-Claude
More informationSupplemental Figure 1
Supplemental Fig. 1. Kinetics of,,, AKT and ERK activation in BMMCs following SCF stimulation. Starved BMMCs were stimulated with 250ng/mL of SCF for the indicated time. Soluble Cell Lysates (SCLs) were
More informationSupplementary Materials and Methods
Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK
More informationPE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence
PE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence Parul Singh 1,2, Rameshwaram Nagender Rao 1, Jala Ram Chandra Reddy 3, R.B.N. Prasad 3, Sandeep
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationSupplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM
Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM of Cx3cr1 GFP/+ mice related to Fig. 1a. MDP was defined
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Moutin et al., http://www.jcb.org/cgi/content/full/jcb.201110101/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Tagged Homer1a and Homer are functional and display different
More informationSUPPLEMENTARY INFORMATION
The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were
More informationDLD1 * cl OD 570nm. OD 570nm NEAA
Figure S A. ATF4 mrna levels.2.8.6.4.2 HT8 shatf4- cl3 shatf4- cl4 ATF4 mrna levels.2.8.6.4.2 DLD shatf4-cl3 B. C. OD 57nm.7.6.5.4.3 shatf4 cl3 shatf4 cl4 OD 57nm.6.5.4.3.2.2. 2 4 6 day.. NEAA - + - +
More informationSupplementary Figure 1
Supplementary Figure 1 Virus infection induces RNF128 expression. (a,b) RT-PCR analysis of Rnf128 (RNF128) mrna expression in mouse peritoneal macrophages (a) and THP-1 cells (b) upon stimulation with
More informationSingle cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor
SUPPLEMENTARY INFORMATION Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor Anna Turetsky 1,a, Eunha Kim 1,a, Rainer H. Kohler 1, Miles A. Miller 1, Ralph Weissleder 1,2,
More informationmcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details
More informationSupplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of
More informationAntibodies used in this study Figure S1. Akt expression in neutrophils from WT and individual Akt isoform knockout mice
ntibodies used in this study The anti β-actin monoclonal antibody (Sigma-ldrich, St. Louis, MO) was generated against a slightly modified human β-actin N-terminal peptide, c-sp-sp-sp-ile-la-la-leu-val-ile-
More informationTRIM31 is recruited to mitochondria after infection with SeV.
Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker
More informationSupplementary Figure 1 a. d 0.8 CON LPS PAN. 2nd ab nephrin podocin CON LPS PAN. upar. -tubulin. upar. upar / -tubulin CON LPS PAN
Supplementary Figure 1 a Efferent arteriole Podocytes Afferent arteriole FP Endothelium GBM Glomerular filtration barrier b 188kD HEK + GFP HEK + GFP-Nphs1 Differentiated Podocytes HEK + GFP HEK + GFP-Nphs2
More informationTable S1. List of antibodies used including isotype controls, biotinylated. secondaries, and fluorophore conjugated tertiary antibodies.
Table S1. List of antibodies used including isotype controls, biotinylated secondaries, and fluorophore conjugated tertiary antibodies. Antibody Description Distributor Catalogue number Working Concentration
More informationManuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated
Supplementary informations Manuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated receptor gamma coactivator 1 α1 expression Rosario
More informationSupplementary Figure 1 Muscle dystrophic phenotype is absent at P6 in PKO mice. (a) Size
Supplementary Figure 1 Muscle dystrophic phenotype is absent at P6 in PKO mice. (a) Size comparison of the P6 control and PKO mice. (b) H&E staining of hind-limb muscles from control and PKO mice at P6.
More informationDescription of Supplementary Files. File name: Supplementary Information Description: Supplementary figures and supplementary tables.
Description of Supplementary Files File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Supplementary Data 1 Description: Differential expression
More informationSupplementary Figure 1. Diagram showing software and hardware used for head fixation and water delivery, as well as picam-based imaging.
Supplementary Figure 1. Diagram showing software and hardware used for head fixation and water delivery, as well as picam-based imaging. 1 Supplementary Figure 2. Layout of training cage for self-head-fixation.
More informationSupplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides
Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides targeting RCP (SMARTPool (RCP) or two individual oligos (RCP#1
More informationSupplementary Figures and Legends.
Supplementary Figures and Legends. Supplementary Figure 1: Impact of injury on Rb1 and PPARϒ expression. Following ipsilateral axotomy injury, adult DRG expression of Rb1 mrna declined (*p
More informationHPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
More informationSupplementary Figure 1 a
3 min PMA 45 min PMA AnnexinV-FITC Supplementary Figure 1 5 min PMA 15 min PMA a 9 min PMA 12 min PMA 5 min FGF7 15 min FGF7 3 min FGF7 6 min FGF7 9 min FGF7 12 min FGF7 5 min control 3 min control 6 min
More informationSupplementary Information for Transient and Local Expression of Chemokine and Immune Checkpoint Traps to Treat Pancreatic Cancer
Supplementary Information for Transient and Local Expression of Chemokine and Immune Checkpoint Traps to Treat Pancreatic Cancer Lei Miao 1, Jingjing Li 2, Qi Liu 1,4, Richard Feng 2, Manisit Das 1, C.
More informationWB: AB1786P. 75kDa. 63kDa. 48kDa
in vitro electroporation The cell suspension (1X1 6 cells) was mixed with plasmid 1 μg pcdn3.1 intact vector or pcdn3.1 human drd3 in Opti-MEM Media (GICO). The expression plasmid of pcdn3.1 was obtained
More informationisolated from ctr and pictreated mice. Activation of effector CD4 +
Supplementary Figure 1 Bystander inflammation conditioned T reg cells have normal functional suppressive activity and ex vivo phenotype. WT Balb/c mice were treated with polyi:c (pic) or PBS (ctr) via
More informationSUPPLEMENTARY INFORMATION. Heterozygous mutations in PALB2 cause DNA replication and damage response defects
SUPPLEMENTARY INFORMATION Heterozygous mutations in PALB2 cause DNA replication and damage response defects Jenni Nikkilä # 1,, Ann Christin Parplys # 2, Katri Pylkäs # 1, Muthiah Bose 1,Yanying Huo 3,
More informationIsolation of human ips cells using EOS lentiviral vectors to select for pluripotency
nature methods Isolation of human ips cells using EOS lentiviral vectors to select for pluripotency Akitsu Hotta, Aaron Y L Cheung, Natalie Farra, Kausalia Vijayaragavan, Cheryle A Séguin, Jonathan S Draper,
More informationAmersham ECL Western blotting detection reagents
Amersham ECL Western blotting detection reagents Selection guide gelifesciences.com Choose the ECL Western blotting detection reagent that best suits your needs Enhanced chemiluminescent (ECL) detection
More informationSupplementary Information. A novel human endogenous retroviral protein inhibits cell-cell fusion. Supplementary Figures:
Supplementary Information A novel human endogenous retroviral protein inhibits cell-cell fusion Jun Sugimoto, Makiko Sugimoto, Helene Bernstein, Yoshihiro Jinno and Danny J. Schust Supplementary Figures:
More information