Advancements in Genome Editing, Gene Synthesis, and Engineered Cell Models

Transcription

1 Advancements in Genome Editing, Gene Synthesis, and Engineered Cell Models University of Manitoba October 5th, 2015 Synthetic Biology Technical Sales Specialist Jennifer Blake 1 The world leader in serving science

2 Gene Synthesis, Genome Editing Tools & Solutions Outline Background Gene synthesis and Strings Genome engineering Workflow overview CRISPR-Cas9 technology: DNA, mrna, Protein In depth on Cas9 protein Design grna and donor plasmids Delivery Detection and Selection Tools Genomic Cleavage Detection Assay Engineered Cell Models 2

3 About us Access to the most comprehensive and trusted molecular biology reagents and services Shaping discovery. Improving life. We believe in the power of science to transform lives. To support scientists worldwide, we offer high-quality, innovative life science solutions from everyday essentials to instruments for every lab, every application. Carlsbad, CA Regensburg, Germany Pleasanton, CA 3

4 Opportunities offered by Gene Synthesis GeneArt Gene Synthesis increases quality, reliability and success rate cost-effective, time- and resource-saving method for obtaining individual and desired DNA constructs with 100% sequence accuracy providing equivalent or better expression performance. 4

5 High Throuput Process LIMS Specialized or Large Projects Gene Synthesis: Technologies and Processes Optimization/CAD/Portal Design fragments and oligos Alignment and simulation in silico Individual anaylsis and design Project handling through PMO Nano scale synthesis High throughput/quality Deployment of HTP production for raw materials Paralleled approaches High throughput High throughput Automated Automated CE sequencing Automated alignment Complex or individualized assembly technologies Special manufacturing unit for extended process requirements Tight communication patterns Individual technical responses Product report Shipment ISO 9001 Product report Shipment ISO

6 GeneArt Gene Synthesis Production Times Faster times coming soon Gene Length Processing time (business days) Standard 1) Express 1) SuperSpeed 3) 1,200 bp 2) (SuperSPEED 1.2) 1,201 2) - 1,800 bp (SuperSPEED 1.8) 1,801-3,000 bp n/a 3,001-5,000 bp n/a > 5,000 bp Get a quote Get a quote n/a For complex sequences: Get a quote 1) Valid for standard gene synthesis (non-complex, GC content 10% - 80%). 2) In case of GC content of 10% - 20% or 75% - 80%: 1,000 bp instead of 1,200 bp. 3) Subject to sequence assessment. Order must be placed by 3:00 p.m. CET. Please note: Rarely, requested sequences are found to be toxic and/or genetically unstable. These production times are only valid for nontoxic sequences that are genetically stable in E. coli. 6

7 Vectors for Express pcdna3.1(+) pcdna3.3-topo pcdna3.4-topo pfastbac1 pet100/d-topo pet151/d-topo prset A pyes2.1v5-his TOPO pdonr221 NEW Mammalian Insect Bacterial Yeast Gateway 7

8 GeneArt Strings DNA Fragments kb synth error oligo assembly mutation Enzymatic error correction + PCR amplif. Strings 0.1-1kb Conc. Determ. QC (bulk sequencing) Dry down Shipment Enzymatic error correction Fragment assembly & amplification by Fusion PCR Strings 1-3kb 8

9 GeneArt Strings DNA Fragments Pricing Strings <1kb Length (bp) Price CAD 100 to 600 $ to 750 $ to 1000 $ Strings 1-3kb (HARPO) 1001 to 1250 $ to 1500 $ to 1750 $ to 2000 $ to 2250 $ to 2500 $ to 2750 $ to 3000 $

10 Genome editing work-flow Rapid and efficient editing with multiplexing capabilities 10 The world leader in serving science

11 What is genome editing? Genome editing is an approach whereby a genomic DNA sequence is directly changed by adding, replacing, or removing DNA bases. Adding DNA Replacing DNA Removing DNA Diseaseresistant transgenic plants Gene therapy Stem cell engineering Tissue disease models Animal disease models To study gene function To target gene mutation To target transgene addition for heritable modification To label endogenous genes Stable integration For tissue & cell engineering to produce novel functions 11

12 Genome editing with designer engineered nucleases Traditional methods Modern/emerging Cell s repair mechanism is harnessed to heal DNA breaks 12

13 Genome/cell engineering workflow With engineered nucleases 13

14 Step 1: Design Genome/cell engineering workflow with engineered nucleases Design Identify target sites, design & order Deliver Transfect Detect Screen, enrich & validate Online Design Tools lifetechnologies.com/tals lifetechnologies.com/crispr Online Design Tools Genome Editing Tools GeneArt TAL nucleases GeneArt CRISPR nuclease GeneArt Cas9 mrna GeneArt Cas9 protein GeneArt TALs 14

15 Step 2: Deliver Genome/cell engineering workflow with engineered nucleases Design Identify target sites, design & order Deliver Transfect Detect Screen, enrich & validate Gibco cell culture media Transfection reagents for DNA & RNA Lipofectamine 3000 Transfection Reagent Lipofectamine 2000 Transfection Reagent Lipofectamine MessengerMAX Transfection Reagent Neon Transfection System Cell imaging reagents and tools Gibco products Lipofectamine 3000 Transfection Reagent Neon Transfection System EVOS FL Imaging System 15

16 Step 3: Detect Genome/cell engineering workflow with engineered nucleases Design Identify target sites, design & order Deliver Transfect Detect Screen, enrich & validate GeneArt Genomic Cleavage Detection Kit GeneArt Genomic Cleavage Detection Kit GeneArt Genomic Cleavage Selection Kit TaqMan SNP Genotyping Assay Ion PGM sequencing GeneArt Genomic Cleavage Selection Kit QuantStudio 7 Flex Real-Time PCR System Ion PGM System 16

17 GeneArt Genomic Detection Kit Simple, reliable, and rapid method for detection of locus-specific gene modification 17 The world leader in serving science

18 GeneArt Genomic Cleavage Detection Kit An essential tool for monitoring the efficiency of your genome editing To detect cleavage activity of engineered nucleases on endogenous target loci Easy no genomic DNA isolation, direct PCR amplification Rapid ~5hour total processing time Quantative gel band density directly correlated to target indel introduction 18

19 Efficient PCR amplification of genomic locus From cell lysates of various cell types Direct PCR amplification of target locus from cell lysates Lysis PCR Numbers of cells M M Effectively lyse 1x10 4 to 2x10 6 cells in 50 μl of lysis buffer HeLa Hepa* HepG2 HT29 A549 Numbers of cells (x10 6 ) M M *Hepa is mouse cell line used as negative control 19

20 CRISPR-Cas9 genome editing Rapid and efficient editing with multiplexing capabilities 20 The world leader in serving science

21 The CRISPR-Cas9 revolution How it works? 1. Cas9 is a bacterial nuclease 2. Small RNA ( guide RNA ) directs Cas9 to the site of cleavage 3. Cas9 can be targeted to any genomic locus of interest to introduce DNA double strand break 21

22 Available CRISPR-Cas9 delivery formats The choice is yours! Complete suite of tools & reagents NEW! IVT grna + Cas9 Protein NEW! Lentiviral grna Lentiviral CRISPR-Cas9 GeneArt CRISPR all-in-one Plasmid GeneArt CRISPR mrna GeneArt CRISPR Protein GeneArt CRISPR Lentiviral Libraries Cell transfection Multiplexing gene targeting Microinjection HTP Genome Engineering Loss-of-function screening 22

23 1) GeneArt CRISPR nuclease vectors All-in-one reporter vector system A simple ready-to-use, all-in-one expression vector system consisting of both a Cas9 nuclease expression cassette and a guide RNA cloning cassette for rapid and efficient cloning of a target-specific crrna GTTTT GTGGC Target-specific custom oligo GeneArt CRISPR Nuclease-CD4 vector 9,822 bp GeneArt CRISPR Nuclease-OFP vector 9,219 bp CD4 vector: For bead-based enrichment of Cas9+gRNA expressing cells OFP vector: For fluorescence-based enrichment of Cas9+gRNA expressing cells 23

24 GeneArt CRISPR Nuclease mrna and protein GeneArt CRISPR Nuclease mrna GeneArt CRISPR U6 Strings DNA grna expression cassette with U6 Pol II promoter GeneArt CRISPR Nuclease Protein + or GeneArt CRISPR T7 Strings DNA (in vitro transcribed grnas) IVT grna generated from DNA template containing T7 promoter Advantages No promoter constraint for Cas9 expression Smaller payload size (U6 CRISPR String =500 bp & IVT grna =100 bp) Allows Cas9 to grna dosage optimization Amenable to multiplexing 24

25 Comparing CRISPR/CAS9 Delivery Formats 25

26 GeneArt CRISPR-Cas9 Protein Rapid and efficient editing with multiplexing capabilities 26 The world leader in serving science

27 Thermo Fisher s Genome Engineering Goals Allow both new and experienced scientists easy access to transformative genome editing tools by enabling: Simple methods for design of CRISPR tools Easy ways to order CRISPR tools Simple to use CRISPR tools High efficiency specific tools which minimize downstream screening 27

28 Cas9 Protein Workflow Design to Cleavage analysis in 4 days Coming Oct 15th: Lipofectamine CRISPRMax Advantages of Cas9 RNP mediated genome editing: Ready to act once delivered into the cell (no transcription or translation need to make the protein) No foot print left Controlled Dose. Efficient for both single and multiplexing Stable Fast Turnover 28

29 GeneArt Precision grna Synthesis Kit Simple, quick & robust grna synthesis Design -> delivery and cleavage efficiency data by GCD within 5 days Web tool for oligo design & purchase Worfklow: 1. Design target specific oligos with CRISPR Search & Design webtool 2. Combine tracer/oligos, target specific oligos, Phusion Master Mix & dntps 3. Perform PCR 4. Perform in vitro transcription & clean up 5. Result: grna in RNA format ready for complex with protein 29

30 Time Course of Cas9 Activity in 293FT DNA mrna Protein Time course of cleavage hrs %cut: %cut: Western Blot DNA mrna protein hrs %cut: well, DNA 1 ug, Cas9 mrna 500 ng/ivt grna 50 ng, Cas9 protein 500 ng/ivt grna 50 ng Used a normalized dosage of plasmid, mrna or protein to get the same level of cleavage for this comparison 30 Liang et al. in press

31 Comparison of Off-target effect using plasmid, mrna, and protein formats On T3 GGTGAGTGAGTGTGTGCGTGTGG OT3-T2 AGTGAGTGAGTGTGTGTGTGGGG OT3-T18 TGTGGGTGAGTGTGTGCGTGAGG The off-target sites of VEGF were identified by GUIDE-seq from Keith Joung s group (same dosages) Lipid-mediated Transfection in 293FT mrna and protein have higher on target and lower off target than plasmid possibly due to the lower maintained levels of Cas9 in the system 31 Liang et al. in press

32 Tra AlexaFluor 488 Electroporation-mediated transfection of ipsc (A) 24 optimized protocol (C) Flow cytometry Unstained Control Cas9 mrna Cas9 Protein Pulse, voltage, # of pulses, and pulse width (B) Transfection via Electroporation ug protein Neg DNA mrna mrna Cas9 32 % Cut: Liang et al. in press SSEA4-AlexaFluor % dual positive in control vs 85% after transfection

33 Zygosity Multiplex Knockout with Cas9 in Jurkat T (Male) (A) AAVS, RelA, and HPRT targets (B) Efficiency of triple knockout Neg Protein 1 AAVS 0.8 % Cut: RelA /+ -/- +/- % Cut: HPRT % Cut: AAVS RelA HPRT All 1 ug Cas9 protein, 200 ng grna, 1x10^5 cell in 24 well 3 genes (5 alleles since HPRT is on the x chromosome and the Jurkat T is male) 1 ug Cas9 protein, 200 ng grna, 1x10^5 cell in 24 well 3 genes (5 alleles since HPRT is on the x chromosome and the Jurkat T is male) 33 Liang et al. in press

34 Transfection efficiency in variety of cell line Overall best results with Cas9 RNPs Comparison of plasmid DNA, Cas9 mrna/grna, and Platinum Cas9 RNP transfection and editing efficiencies in variety of cell lines Plasmid mrna Protein Cell Lines Lipid Electro Lipid Electro Lipid Electro To be updated with new mrna data, Lipofectamine CRISPRMAX Cas9 Transfection Kit & more cell types for marketing image HEK293FT U2OS Mouse ESCs Human ESCs (H9) Human ipscs N2A Jurkat K562 A549 Human Keratinocytes (NHEK) Human Cord Blood Cells CD # * * n/a 0 n/a 0 n/a HPRT for human cell lines and Rosa 26 for mouse cell lines * Confirmed by sequencing

35 GeneArt CRISPR Nuclease mrna: new sku Improved manufacturing process for improved performance A) Gel picture on Bioanalyzer B) Electropherogram on Bioanalyzer Cas9 mrna Cat# A29378 Cas9 mrna Cat# A29378 Cas9 mrna Cat# A29378 Cat# A ) 500ng Cas9 mrna was cotransfected with 100ng HPRT T1 grna IVT to each well cells in 24-well plate format. 2) Cells were harvested after 72 hours post-transfection. 3) GCD assay for HPRT locus were performed and function of Cas9 mrna was determined by cleavage efficiency based on band intensity. 35

36 GeneArt CRISPR Search and Design Tool 36 The world leader in serving science

37 Enter Search Parameters 37

38 Search Results 38

39 Predicting binding sites 39

40 Donor DNA design and synthesis included Genomic locus Donor DNA Left homology Region intended for change Right homology Length: Optimal length of homology: kb Position: Place region to change in the middle of the donor, at least 500 bases of homologous sequences flanking Stability: Strategies may be adopted to make donor DNA resistant to the cut by the engineered nuclease (eg. silent mutations in CRISPR/TALN binding site) Formats: Plasmid Linearized plasmid Excised from plasmid PCR product (from genome or plasmid) ssdna Intended changes: Single nucleotide polymorphism (introduce or revert a SNP) Knock-in of an exogenous gene into a safe harbor (eg. AAVS1, HPRT, mrosa26) Gene disruption using an antibiotic marker Introduction of reporter (eg. fluorescent fusion protein, promoter trap) 40

41 Confirmation of gene editing by Sanger sequencing Target HPRT in Jurkat cells Target HPRT in ips cells grna Cas9 Cleavage efficiency% 94 Ctrl DNA mrna Protein Cleavage efficiency detected by GCD assay correlated with results by Sanger sequencing Clone amplified PCR product into TOPO TA vector Transform into One Shot TOP10 chemically competent E. coli cells Isolate DNA using PureLink Pro 96 Purification Kit Sanger sequencing using 3500xL Genetic Analyzer Gene modification efficiency: 94.1% Gene modification efficiency: 87.8% Sequence analysis using Vector NTI Software 41

42 GeneArt Engineered Cell Models 42 The world leader in serving science

43 What is it? GeneArt Engineered Cell Models The world s largest collection of ready-to-go CRISPR engineered cell lines Engineered cell lines starting at less than $1,000 1,000s of off-the-shelf knockout and knock-in cell models (5-7 bd for off the shelf) Affordable, rapid production of made to order cell lines (10 weeks) All models ship with the matched isogenic parental cell line 43

44 GeneArt Engineered Cell Models Knockout cell lines Knock-in cell lines Complete gene knockouts Knockout cell lines can be haploid or diploid Custom knockout cell line generation is available on demand Over 1,500 cell lines and growing Have more complex genomic modifications (e.g. deletions, single base pair changes, insertions) Knockin cell lines are diploid Custom knockin cell line generation is available on demand 500 cell lines covering >350 genotypes 44

45 Available gene sets Gene sets coming soon: Phosphoinositide Metabolism Protein phosphatases Glycosylation disorders TRIM E3 ligases Suggestions?? Which genes are available? Knockouts for more than 1,400 human genes in stock Various gene sets: Kinases, Epigenetics, Ubiquitination, Signaling Customer can either purchase individual knockout cell lines or entire sets 45

46 Gene family collections Gene Collections Knockouts for entire gene families Comprehensive: Coverage of all non-essential genes that are expressed in HAP1 Several clones per gene available Kinases, Bromodomain genes, Deubiquitinases, Ubiquitin E2 ligases, HDACs, Caspases, Rab GTPases 46

47 Fluorescein SNA Lectin Brightfield Pathway collections HAP1 wt CMAS SLC35A1 Pathway Collections Knockouts for entire biological pathways Allows comprehensive study of processes Several clones per gene available Sialylation, mtor signaling, TNF- signaling, Autophagy, Epigenetics, DNA damage responses 47

48 Ordering Information Fast, simple web ordering tool with a built-in search & add to cart functionality How to order 1 Select institution type Enter in either Gene name or Gene ID Select cell line Add to cart Check out 48

49 Production pipeline Shipment Customer Packagin g Custom knockouts for any human gene in 10 weeks Design Quality Control Production 49

50 Pricing CAD Customer Segment Off-the-shelf cell lines Made-to-order knockout HAP1 cell lines Made-to-order knockin cell lines Academic $1,287 $2,574 $4,420 - Bulk discounts are available - Gibco media can be bundled - Knock out is guaranteed - 14,000 non-essential knock outs available in Hap1 Made to order knockout and knock-in models available Q

51 Recommended reagents for Hap1 cell lines 51

52 Workflow needs and solutions A collection of optimized and validated end-to-end solutions Thermo Fisher Scientific, a leading innovator in genome engineering, provides tools and solutions for the complete gene engineering workflow. Visit for more information 52

53 Questions & Answers 53 The world leader in serving science

54 For Research Use Only. Not for use in diagnostic procedures Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified. TaqMan is a registered trademark of Roche Molecular Systems, Inc., used under permission and license. TALEN is a trademark of Cellectis. 54

55 Appendix Additional information 55 The world leader in serving science

56 Choosing the right designer nuclease for your research RNAi CRISPR Programmable RNA-guided DNA endonuclease TALs DNA-binding domain to recognize virtually any sequence Key capabilities Gene knock-down Gene knock-out Gene knock-down Gene knock-in Gene knock-out Gene knock-down Gene knock-in Gene activation Target customers High-content imaging groups System biology Disease-focused labs RNA-Seq groups High-content imaging groups System biology Disease-focused labs RNA-Seq groups Metabolic engineering Protein production Genome engineering cores High-content imaging groups System biology Disease-focused labs RNA-Seq groups Metabolic engineering Protein production Genome engineering cores Price/rxn $200/rxn $50/rxn $2000/rxn Off-target effects Why choose this option? Unpredictable Possible Few Transient knock-down of RNA transcript(s) for multiple targets Great for screening, provides rapid editing with multiplexing capabilities Precise editing when you want to target a single gene, activate a gene of interest, or working with nonmammalian cell types Discovery to validation 56

57 When to choose TALs vs. CRISPRs TALs TAL mrna Will use edited cells for commercial applications (need clear IP landscape) Multiplexing (edit multiple sites at once) Screen multiple sequences at once for optimal sequence ID CRISPR vector CRISPR mrna Microinjection (in vivo applications) Minimal off-target editing Larger footprint Larger footprint Need to remove promoter constraints and express in a broad range of cell types No sequence constraint (for example, no NGG PAM restriction) Gene repression (knock-down) Gene knock-out Gene knock-in Service Service Service Service Gene activation Need to edit non-mammalian cell types * * Custom design included Cell engineering services 57 *These are mammalian-optimized systems; however, they have been shown to work in nonmammalian cells. For hostspecific optimization, please contact GeneArtSupport@lifetech.com

58 Arrayed and pooled library screening Screening of arrayed library Screening of pooled ;ibrary 4 grnas per gene > 10 6 TU/mL 10 grnas per gene 10 8 TU/mL One gene per well Much more controlled delivery of grna per well Eliminate time-consuming deconvolution step Require some level of automation Multiple genes in parallel Much less expensive than arrayed format Do not require special infrastructure Focused gene; libraries: Kinases, Phosphatases, GPCR 58