Mechanical stimulation of Piezo1 receptors depends on extracellular matrix proteins and directionality of force. Supporting Information

Size: px
Start display at page:

Download "Mechanical stimulation of Piezo1 receptors depends on extracellular matrix proteins and directionality of force. Supporting Information"

Transcription

1 Mechanical stimulation of Piezo1 receptors depends on extracellular matrix proteins and directionality of force Benjamin M. Gaub and Daniel J. Müller Supporting Information Supporting Information Note 1. Comparison of Piezo1 force threshold values with pressure values from literature. In order to compare our Piezo1 force threshold values with published Piezo1 pressure values we calculated the pressure resulting from push stimulations using the AFM cantilever with 5 µm diameter bead. The contact area A between bead and cell is given as half sphere surface of the bead: =2 Supporting Equation 1 with r = 2.5 µm, the area A is: =2 (2.5 μm) =39.26 The pressure P is given as: = Supporting Equation 2 with F being the force. To mechanically stimulate Piezo1- cells by a pushing bead, the threshold force is nn (Figure 2d). Therefore, the threshold pressure is: 1 kpa=7.5 mm Hg, therefore: = kg m s = kg m s = kpa=41.85 mm Hg Coste et al. 1 reported Piezo1 P 50 pressure sensitivity values in cells in cell-attached patches of: P 50 = 28.1 ± 2.8 mm Hg; Lewis et al. 2 reported Piezo1 P 50 pressure sensitivity values in cell-attached patches of: P 50 = 19.3 ± 1.2 mm Hg; Cox et al. 3 reported Piezo1 P 50 pressure sensitivity values in cell-attached patches of: P 50 = 45 ± 3 mm Hg;

2 Supporting Information Note 2: Physiological pressures encountered in human tissue with native Piezo1. The mrna expression profiles for Piezo1 show the highest levels in bladder and lung. 1 Urinal bladder pressures have been determined in patients with indwelling transurinal catheters. 4 The pressure values reported in this study ranged from 1 22 cm H 2 O. 1 cm H O =0.73 mm Hg, therefore: 1 cm H O =0.73 mm Hg, and 22 cm H O =16.88 mm Hg. Thus, urinal bladder pressures range from mm Hg. In our experiments we had to mechanically push the Piezo1- cells by 220 nn to induce Piezo1 gating. This force applied via a 5 µm bead corresponds to mm Hg (Supporting Information Note 1). Maximal expiratory pressure values which can be taken as proxy for lung pressure were determined in human subjects with normal respiratory function and amounted to 143 ± 10 cm H 2 0 while standing upright. 5 1 cm H O =0.73 mm Hg, therefore: 133 cm H O =97.83 mm Hg, and 153 cm H O = mm Hg. Maximal expiratory pressure values range from mm Hg, which is 2 3 times the pressure we had to apply to mechanically gate Piezo1 by pushing the bead onto Piezo1- cells (Supporting Information Note 1).

3 Supporting Information Figures Supporting Information Figure 1. Transient Piezo1, jrcamp1a and GFP expression in HEK and cells. a-d) Piezo IRES GFP (green) and jrcamp1a (red) expression in HEK-293T cells 48 h after transfection. (b,c) Single channel and (a,d) overlaid DIC and fluorescent images. The red channel shows the baseline fluorescence of the calcium indicator before stimulation. A differential interference contrast (DIC) image was simultaneously acquired. Yellow cells are expressing both Piezo IRES GFP and jrcamp1a. e) GFP (green) expression in cells 48 h post transfection used for fluorescent assay calibration (Methods). All scale bars, 20 µm.

4 Supporting Information Figure 2. Experimental parameters for push and pull protocols. a,b) Experimental parameters for push (a) and pull (b) stimulation. The three vertical panels show parameters from one representative recording per condition. Calcium indicator fluorescence signal as measured by confocal microscopy are shown in the top panel, the mechanical force exerted via the AFM cantilever is shown in the middle panel and the position of the cantilever is shown in the bottom panel. a) For the push stimulus, 250 ms bouts of positive pressure were applied to the cell with increasing intensity (middle). The cantilever was lowered onto the cell with a speed of 10 µm s 1 until the force reached the set point and the cantilever was withdrawn with a speed of 100 µm s 1 (bottom). Calcium signals were recorded in real time and the stimulation was terminated as soon as the cell responded (top). b) For the pull stimulus, the ECM coated cantilever was lowered onto the cell up to a contact force of nn. The cantilever was held at constant contact force for 60 s to allow ligandreceptor interactions to form. Finally, the cantilever was retracted (100 µm s 1 ) to stretch the cells locally and the resulting rupture forces were readout using the deflection of the cantilever (middle).

5 Supporting Information Figure 3. Control recordings from HEK cells without Piezo1. a-c) Representative images of HEK cells expressing jrcamp1a (red) but not Piezo1, before (a), during (b) and after (c) mechanical push by AFM. The time points in the upper right corner refer to (d). Scale bars, 10 µm. d) Fluorescence of the cell depicted in (a-c) during stimulation with pushing forces from nn. The cell does not respond to mechanical pushing in the absence of Piezo1 and cell morphology is conserved throughout the experiment. For a summary of all control HEK cells refer to Supporting Information Table 1.

6 Supporting Information Figure 4. Lifetime of fluorescently labeled ECM proteins on cantilever. a) Fluorescent signal of a bead functionalized with rhodamine conjugated laminin EHS used several times to mechanically stimulate cells. Fluorescent images of the bead were recorded after each mechanical stimulation (pulling) and the fluorescence intensity was calculated using the Zeiss ZEN blue software. The two experiments shown were done with two different beads. Data points 1 and 2 show fluorescence after calibration measurements without cell contact. The later data points (3 7) show fluorescence after stimulation of cells (20 nn contact force for 60 s). b) Representative overlay of fluorescence and DIC images showing the bead functionalized with rhodamine conjugated laminin EHS and the AFM cantilever before (left) and after (right) the experiment. The numbers refer to experiment 2 in panel (a). Scale bars, 20 µm.

7 Supporting Information Figure 5. Piezo1 receptors do not respond to mechanical pulling when adhering unspecific to substrates. a,b) Summary of calcium signals (a) and forces (b) of cells with or without Piezo1 receptor overexpression in response to mechanical pulling with various adhesive proteins attached to the cantilever. a) Normalized calcium signals from left to right: without Piezo1 overexpression, cantilever with Matrigel (0.05 ± 0.02 I/I 0 ; n = 13), without Piezo1 overexpression, cantilever with collagen IV (Col IV) ( 0.11 ± 0.02 I/I 0 ; n = 16), with Piezo1 overexpression, cantilever without functionalization (blank lever) (0.04 ± 0.03 I/I 0 ; n = 15), with Piezo1 overexpression, cantilever with concanavalin A (ConA) (0.02 ± 0.02 I/I 0 ; n = 24), without Piezo1 overexpression, cantilever with concanavalin A (0.05 ± 0.02 I/I 0 ; n = 13). Noise level in gray. b) Rupture forces from left to right: without Piezo1 overexpression, cantilever with Matrigel (40.16 ± 5.30 nn; n = 13), without Piezo1 overexpression, cantilever with collagen IV (28.44 ± 3.21 nn; n = 16), with Piezo1 overexpression, cantilever without functionalization (22.53 ± 1.96 nn; n = 15), with Piezo1 overexpression, cantilever with concanavalin A (34.1 ± 3.04 nn; n = 24), without Piezo1 overexpression, cantilever with concanavalin A (38.8 ± 3.97 nn; n = 13). Normalized calicum signals were calculated as described (Methods). Dots represent single cells. The dotted line indicates the baseline (I/I 0 = 0). Values in legend are given as mean ± SEM. Data in Figure are shown by the box (median, first and third quartiles).

8 Supporting Information Figure 6. Fluorescence artifacts from mechanical pushing and pulling single cells with the AFM cantilever. a) Summary of normalized fluorescence intensity for push (0.08 ± 0.01 I/I 0 ; n = 15) and pull (0.11 ± 0.02 I/I 0 ; n = 15) stimulation of control cells expressing GFP only. These values reflect the noise level (0.25 I/I 0 ) of the assay. Artifacts result from compression of the cells due to mechanical stimulus and thus transient increase or decrease in fluorescence of GFP. These values were used to set the cutoff for responsive vs. non-responsive cells (Methods). Dots represent single cells. Data are given as mean ± SEM. Additionally, median and first and third quartiles are shown by the box. b,c) Representative traces showing GFP fluorescence for push (b) and pull (c) stimulation of GFP expressing cells.

9 Supporting Information Table 1 Cells Cantilever Stimulus Number of Number of Success Figure cells tested responders* rate (%) Control HEK Push Supporting Information Figure 6 Piezo1- Push Figure 2c,d HEK Control Push Figure 2c,d Piezo1- Push Figure 2c,d Piezo1- Matrigel Push Figure 3c,d Piezo1- Matrigel Pull Figure 3c,d Figure 4 Piezo1- Pull Figure 3c,d Piezo1- Collagen Pull Figure 4 IV Piezo1- Laminin Pull Figure 4 EHS Piezo1- Laminin 551 Pull Figure 4 Supporting Information Table 1. Summary of the number of stimulated cells and number of responding cells for various experimental conditions. *Responding cells were classified as described in Methods. All cells analyzed overexpressed jrcamp1a.

10 Supporting Information Movie 1. Representative example of Piezo1- response to push stimulus. Piezo1- cell stimulated by mechanical pushing using a non-functionalized cantilever and bead. The cell responded to 205 nn pushing force with strong influx of calcium as seen by the increasing fluorescence of the calcium reporter jrcamp1a (red) at t = 30 s. Time (s) is shown in top left. Scale bar, 10 µm. Supporting Information Movie 2. Representative example of Piezo1- response to pull stimulus with collagen IV functionalized cantilever. Piezo1- cell stimulated by pulling using a collagen IV functionalized cantilever and bead. The cell responded to 10 nn pulling force with strong influx of calcium as seen by the increasing fluorescence of the calcium reporter jrcamp1a (red) at t = 71 s. Time (s) is shown in top left. Scale bar, 10 µm. Supporting Information References (1) Coste, B.; Mathur, J.; Schmidt, M.; Earley, T. J.; Ranade, S.; Petrus, M. J.; Dubin, A. E.; Patapoutian, A. Piezo1 and Piezo2 are essential components of distinct mechanically activated cation channels. Science 2010, 330, (2) Lewis, A. H.; Grandl, J. Mechanical sensitivity of Piezo1 ion channels can be tuned by cellular membrane tension. elife 2015, 4, e (3) Cox, C. D.; Bae, C.; Ziegler, L.; Hartley, S.; Nikolova-Krstevski, V.; Rohde, P. R.; Ng, C. A.; Sachs, F.; Gottlieb, P. A.; Martinac, B. Removal of the mechanoprotective influence of the cytoskeleton reveals PIEZO1 is gated by bilayer tension. Nat. Commun. 2016, 7, (4) Chionh, J. J.; Wei, B. P.; Martin, J. A.; Opdam, H. I. Determining normal values for intraabdominal pressure. ANZ J. Surg. 2006, 76, (5) Badr, C.; Elkins, M. R.; Ellis, E. R. The effect of body position on maximal expiratory pressure and flow. Aust. J. Physiother. 2002, 48,

Supplemental Movie Legend.

Supplemental Movie Legend. Supplemental Movie Legend. Transfected T cells were dropped onto SEE superantigen-pulsed Raji B cells (approximate location indicated by circle). Maximum-intensity projections from Z-stacks (17 slices,

More information

Lab Module 7: Cell Adhesion

Lab Module 7: Cell Adhesion Lab Module 7: Cell Adhesion Tissues are made of cells and materials secreted by cells that occupy the spaces between the individual cells. This material outside of cells is called the Extracellular Matrix

More information

Corning Microplates for Microscopy and High Content Imaging. Improve results with microplates for high resolution cell imaging

Corning Microplates for Microscopy and High Content Imaging. Improve results with microplates for high resolution cell imaging Corning Microplates for Microscopy and High Content Imaging Improve results with microplates for high resolution cell imaging High Performance for Cell-based Assays Within the drug discovery process, high

More information

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating

More information

Supplementary material to Alterations in the properties of the cell membrane due to glycosphingolipid accumulation in a model of Gaucher disease

Supplementary material to Alterations in the properties of the cell membrane due to glycosphingolipid accumulation in a model of Gaucher disease Supplementary material to Alterations in the properties of the cell membrane due to glycosphingolipid accumulation in a model of Gaucher disease Gyula Batta, Lilla Soltész, Tamás Kovács, Tamás Bozó, Zoltán

More information

Contents. The Right Surface for Every Cell Extracellular Matrices and Biologically Coated Surfaces ECM Mimetic and Advanced Surfaces...

Contents. The Right Surface for Every Cell Extracellular Matrices and Biologically Coated Surfaces ECM Mimetic and Advanced Surfaces... Contents The Right Surface for Every Cell... 1 Extracellular Matrices and Biologically Coated Surfaces... 2 Corning Matrigel Matrix... 2 Corning BioCoat Cultureware... 3 ECM Mimetic and Advanced Surfaces...

More information

ab Hypoxic Response Human Flow Cytometry Kit

ab Hypoxic Response Human Flow Cytometry Kit ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting

More information

Introduction. Figure 1. Oris Cell Migration Assay Principle

Introduction. Figure 1. Oris Cell Migration Assay Principle Optimizing Performance of the Membrane-free, Oris Cell Migration Assay for High Throughput Screening using the BioTek Synergy HT Multi-Mode Microplate Reader Keren I. Hulkower, Renee L. Herber, and Scott

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

Electronic Supplementary Material (ESI) for Soft Matter This journal is The Royal Society of Chemistry Supporting Material

Electronic Supplementary Material (ESI) for Soft Matter This journal is The Royal Society of Chemistry Supporting Material Supporting Material Figure S1: Discocyte shape generated by rotation of Cassini oval for (ε = 0.958), and profile (a); discocyte and experimentally determined profile (b, data from [1]); comparison of

More information

BioScope Catalyst Life Science Atomic Force Microscope

BioScope Catalyst Life Science Atomic Force Microscope BioScope Catalyst Life Science Atomic Force Microscope New Standard for AFM and Light Microscope Integration Uncompromised Performance from Both Techniques Increased Productivity and Ease of Use Simple,

More information

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,

More information

Time-resolved Measurements Using the Agilent Cary Eclipse Fluorescence Spectrophotometer A Versatile Instrument for Accurate Measurements

Time-resolved Measurements Using the Agilent Cary Eclipse Fluorescence Spectrophotometer A Versatile Instrument for Accurate Measurements Time-resolved Measurements Using the Agilent Cary Eclipse Fluorescence Spectrophotometer A Versatile Instrument for Accurate Measurements Technical Overview Authors Dr. Fabian Zieschang, Katherine MacNamara,

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and

More information

Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney

Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney 1 Supplementary text and data for: 2 3 4 5 Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney Authors: David A. D. Munro 1*, Peter Hohenstein 2, and Jamie A.

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

NEW INSIGHTS. NEW DISCOVERIES. Real-time automated measurements of cell health, movement and function inside your incubator.

NEW INSIGHTS. NEW DISCOVERIES. Real-time automated measurements of cell health, movement and function inside your incubator. THE NEXT GENERATION HAS ARRIVED IncuCyte S3 Live-Cell Analysis System Real-time automated measurements of cell health, movement and function inside your incubator. NEW INSIGHTS. NEW DISCOVERIES. See what

More information

Using xcelligence Real-Time Cell Analysis to Monitor Immune Cell-Mediated Killing of B Cells

Using xcelligence Real-Time Cell Analysis to Monitor Immune Cell-Mediated Killing of B Cells xcelligence Real-Time Cell Analysis Using xcelligence Real-Time Cell Analysis to Monitor Immune Cell-Mediated Killing of B Cells 1 Introduction ACEA s xcelligence real-time cell analysis (RTCA) instruments

More information

NEURONAL CELL CULTURE MATRIX FOR BETTER MAINTENANCE AND SURVIVAL OF NEURONAL CELL CULTURES IN TISSUE CULTURE.

NEURONAL CELL CULTURE MATRIX FOR BETTER MAINTENANCE AND SURVIVAL OF NEURONAL CELL CULTURES IN TISSUE CULTURE. NEURONAL CELL CULTURE MATRIX FOR BETTER MAINTENANCE AND SURVIVAL OF NEURONAL CELL CULTURES IN TISSUE CULTURE. D. R. Aguirre, N. DiMassa, Chrystal Johnson, H. Eran, R. Perez, C.V.R. Sharma, M.V.R. Sharma,

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

NEW INSIGHTS. NEW DISCOVERIES. Real-time automated measurements of cell health, movement and function inside your incubator.

NEW INSIGHTS. NEW DISCOVERIES. Real-time automated measurements of cell health, movement and function inside your incubator. THE NEXT GENERATION HAS ARRIVED IncuCyte S3 Live-Cell Analysis System Real-time automated measurements of cell health, movement and function inside your incubator. NEW INSIGHTS. NEW DISCOVERIES. See what

More information

Label-free, real-time live-cell assays for spheroids: IncuCyte bright-field analysis

Label-free, real-time live-cell assays for spheroids: IncuCyte bright-field analysis Introduction APPLICATION NOTE IncuCyte Live-Cell Analysis System Label-free, real-time live-cell assays for spheroids: IncuCyte bright-field analysis Susana L. Alcantara, Miniver Oliver, Kalpana Patel,

More information

Human Connective Tissue Growth Factor (CTGF) Elisa Kit

Human Connective Tissue Growth Factor (CTGF) Elisa Kit Human Connective Tissue Growth Factor (CTGF) Elisa Kit Catalog No. CSB-E07875h (96 tests) This immunoassay kit allows for the in vitro quantitative determination of human CTGF concentrations in serum,

More information

over time using live cell microscopy. The time post infection is indicated in the lower left corner.

over time using live cell microscopy. The time post infection is indicated in the lower left corner. Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected

More information

Quantification of Cell Migration and Invasion Using the IncuCyte Chemotaxis Assay

Quantification of Cell Migration and Invasion Using the IncuCyte Chemotaxis Assay APPLICATION NOTE IncuCyte ZOOM Live-Cell Imaging System Quantification of Cell Migration and Invasion Using the IncuCyte Chemotaxis Assay Lindy O Clair, Meagan Roddy, Maria Tikhonenko, Clare Syzbut, Nicola

More information

Cytomics in Action: Cytokine Network Cytometry

Cytomics in Action: Cytokine Network Cytometry Cytomics in Action: Cytokine Network Cytometry Jonni S. Moore, Ph.D. Director, Clinical and Research Flow Cytometry and PathBioResource Associate Professor of Pathology & Laboratory Medicine University

More information

In Vitro Angiogenesis Assay Kit

In Vitro Angiogenesis Assay Kit In Vitro Angiogenesis Assay Kit Catalog Number KA1323 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...

More information

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,

More information

Assembly of synapses by neuronal adhesion molecules: single molecule studies

Assembly of synapses by neuronal adhesion molecules: single molecule studies Assembly of synapses by neuronal adhesion molecules: single molecule studies Olivier Thoumine Interdisciplinary Institute of Neurosciences CNRS - University of Bordeaux Connectivity in the brain 300 nm

More information

Title. CitationThe Journal of clinical investigation, 124(5): Issue Date Doc URL. Type. Additional There Information

Title. CitationThe Journal of clinical investigation, 124(5): Issue Date Doc URL. Type. Additional There Information Title Laminins affect T cell trafficking and allograft fat Author(s)Warren, Kristi J.; Iwami, Daiki; Harris, Donald G.; CitationThe Journal of clinical investigation, 124(): 224- Issue Date 214--1 Doc

More information

User s Guide MegaTran 1.0 Transfection Reagent

User s Guide MegaTran 1.0 Transfection Reagent User s Guide MegaTran 1.0 Transfection Reagent Package Contents and Storage Conditions... 2 Related products... 2 Introduction... 2 Production and Quality Assurance:... 3 Experimental Procedures... 3 Transfection

More information

Masayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies

Masayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies Molecular Cell, Volume 35 Supplemental Data Single-Molecule Analysis Reveals Differential Effect of ssdna-binding Proteins on DNA Translocation by XPD Helicase Masayoshi Honda, Jeehae Park, Robert A. Pugh,

More information

Voltage clamp and patch-clamp techniques

Voltage clamp and patch-clamp techniques Voltage clamp and patch-clamp techniques Dr. Nilofar Khan Objectives Historical background Voltage Clamp Theory Variations of voltage clamp Patch-clamp Principal Patch-clamp configurations Applications

More information

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1 Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11

More information

5 HARNESSING THE PURSE STRING FOR

5 HARNESSING THE PURSE STRING FOR 107 5 HARNESSING THE PURSE STRING FOR ACCELERATED WOUND CLOSURE Abstract Wound healing is essential in maintaining tissue integrity. Wounds can close via lamellipodial crawling, which involves the rapid

More information

Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo

Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Rampyari Raja Walia and Bakhos A. Tannous 1 2 1 Pluristem Innovations, 1453

More information

CytoPainter Golgi Staining Kit Green Fluorescence

CytoPainter Golgi Staining Kit Green Fluorescence ab139483 CytoPainter Golgi Staining Kit Green Fluorescence Instructions for Use Designed for the detection of Golgi bodies by microscopy This product is for research use only and is not intended for diagnostic

More information

Cell Migration, Chemotaxis and Invasion Assay Using Staining

Cell Migration, Chemotaxis and Invasion Assay Using Staining Cell Migration, Chemotaxis and Invasion Assay Using Staining Protocol Hillary Sherman and Mark Rothenberg Corning Life Sciences 836 North St. Bldg. 300, Suite 3401 Tewksbury, MA 01876 Introduction Cell

More information

Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer

Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Author's response to reviews Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Authors: Hannah Jörißen (hannah.joerissen@molbiotech.rwth-aachen.de)

More information

Spectral Separation of Multifluorescence Labels with the LSM 510 META

Spectral Separation of Multifluorescence Labels with the LSM 510 META Microscopy from Carl Zeiss Spectral Separation of Multifluorescence Labels with the LSM 510 META Indians living in the South American rain forest can distinguish between almost 200 hues of green in their

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX.

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX. Supplementary Figure 1 Retention of RNA with LabelX. (a) Epi-fluorescence image of single molecule FISH (smfish) against GAPDH on HeLa cells expanded without LabelX treatment. (b) Epi-fluorescence image

More information

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine

More information

One-step split GFP staining for sensitive protein detection and localization in mammalian cells

One-step split GFP staining for sensitive protein detection and localization in mammalian cells Supplementary Materials For: One-step split GFP staining for sensitive protein detection and localization in mammalian cells Lara Kaddoum 1,3, Eddy Magdeleine 1,3, Geoffrey S. Waldo 4, Etienne Joly 1,3,

More information

Calcium Assay Kit. Technical Data Sheet. Product Information. Description. Storage. Materials not included

Calcium Assay Kit. Technical Data Sheet. Product Information. Description. Storage. Materials not included BD Technical Data Sheet Calcium Assay Kit Product Information Catalog Number: 640176 Size Reagents for 10 plates Components: Calcium Indicator, 1 vial, lyophilized 10X Signal Enhancer, 10 ml 1X Calcium

More information

Imaging of in Vitro Collagen Fibers by Atomic Force Microscopy

Imaging of in Vitro Collagen Fibers by Atomic Force Microscopy Imaging of in Vitro Collagen Fibers by Atomic Force Microscopy Undergraduate Researcher Isabel Nocedal, Northwestern University Faculty Mentors Horacio Espinosa Department of Mechanical Engineering, Northwestern

More information

TransIT-TKO Transfection Reagent

TransIT-TKO Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery

More information

Platypus Technologies, LLC 5520 Nobel Drive, Suite 100 Madison, WI Toll Free: (866) Phone: (608) Fax: (608)

Platypus Technologies, LLC 5520 Nobel Drive, Suite 100 Madison, WI Toll Free: (866) Phone: (608) Fax: (608) Universal Cell Migration Assembly Kit Product No.: CMAU101 & CMAU505 96-well Assay for Investigating Cell Migration, Cell Invasion and 2-D Closure of Adherent Cell Lines Protocol & Instructions Patent

More information

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein

More information

amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3

amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3 Contents amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3 Background Information 4 Cell culture 4 Supporting Data 5-8 Equipment

More information

Genetically targeted all-optical electrophysiology with a transgenic Credependent

Genetically targeted all-optical electrophysiology with a transgenic Credependent Genetically targeted all-optical electrophysiology with a transgenic Credependent Optopatch mouse Short title: Transgenic Optopatch mouse Shan Lou 1, Yoav Adam 1, Eli N. Weinstein 1,4, Erika Williams 2,

More information

Reading for lecture 11

Reading for lecture 11 Reading for lecture 11 1. Optical Tweezers, Myosin 2. Atomic Force Microscopy (AFM) 3. Single-Molecule Fluorescence Microscopy 4. Patch-Clamp 5. Genetic Techniques Key references are included in italics

More information

A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana

A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang

More information

Un biochip per elettrostimolazione cellulare

Un biochip per elettrostimolazione cellulare Un biochip per elettrostimolazione cellulare A. Paccagnella, G. Cellere, L. Bandiera Dipartimento di Ingegneria dell Informazione Università di Padova Outline Introduction & background A biochip for genetic

More information

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics

More information

Xfect Protein Transfection Reagent

Xfect Protein Transfection Reagent Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection

More information

7.17: Writing Up Results and Creating Illustrations

7.17: Writing Up Results and Creating Illustrations 7.17: Writing Up Results and Creating Illustrations A Results Exercise: Kansas and Pancakes Write a 5-sentence paragraph describing the results illustrated in this figure: - Describe the figure: highlights?

More information

jetcrispr RNP transfection reagent PROTOCOL

jetcrispr RNP transfection reagent PROTOCOL jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been

More information

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),

More information

Seeding, culturing and assaying upcyte and vericyte cells in the Mimetix 3D scaffold

Seeding, culturing and assaying upcyte and vericyte cells in the Mimetix 3D scaffold Seeding, culturing and assaying upcyte and vericyte cells in the Mimetix 3D scaffold Description This note describes how to seed and culture upcyte Hepatocytes as 3D cultures in the Mimetix electrospun

More information

INVESTIGATION OF MSC DIFFERENTIATION ON ELECTROSPUN NANOFIBROUS SCAFFOLDS

INVESTIGATION OF MSC DIFFERENTIATION ON ELECTROSPUN NANOFIBROUS SCAFFOLDS With support of NSF Award no. EEC-0754741 INVESTIGATION OF MSC DIFFERENTIATION ON ELECTROSPUN NANOFIBROUS SCAFFOLDS NSF Summer Undergraduate Fellowship in Sensor Technologies Emily Wible (Bioengineering)

More information

Introduction to N-STORM

Introduction to N-STORM Introduction to N-STORM Dan Metcalf Advanced Imaging Manager Outline Introduction Principles of STORM Applications N-STORM overview Biological Scale Mitochondrion Microtubule Amino Acid 1Å Kinesin 1nm

More information

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact

More information

Human immunoglobulin G(IgG) ELISA Kit

Human immunoglobulin G(IgG) ELISA Kit Human immunoglobulin G(IgG) ELISA Kit Catalog Number. CSB-E07979h For the quantitative determination of human immunoglobulin G (IgG) concentrations in serum, plasma, cell culture supernates, urine, tissue

More information

NEW! CHOgro Expression System

NEW! CHOgro Expression System NEW! CHOgro Expression System At Mirus Bio, we know it s all about expression. Introducing the new CHOgro Expression System, a transient transfection platform that finally gets high protein titers with

More information

Application Information Bulletin: Set-Up of the CytoFLEX Set-Up of the CytoFLEX* for Extracellular Vesicle Measurement

Application Information Bulletin: Set-Up of the CytoFLEX Set-Up of the CytoFLEX* for Extracellular Vesicle Measurement Application Information Bulletin: Set-Up of the CytoFLEX Set-Up of the CytoFLEX* for Extracellular Vesicle Measurement Andreas Spittler, MD, Associate Professor for Pathophysiology, Medical University

More information

Final exam. Please write your name on the exam and keep an ID card ready.

Final exam. Please write your name on the exam and keep an ID card ready. Biophysics of Macromolecules Prof. R. Jungmann and Prof. J. Lipfert SS 2017 Final exam Final exam First name: Last name: Student number ( Matrikelnummer ): Please write your name on the exam and keep an

More information

HBeAg and HBeAg Ab ELISA Kit

HBeAg and HBeAg Ab ELISA Kit HBeAg and HBeAg Ab ELISA Kit Catalog Number KA0290 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay... 3 General

More information

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

More information

NEXT GENERATION ECM-BASED ALLOGRAFT TECHNOLOGY:

NEXT GENERATION ECM-BASED ALLOGRAFT TECHNOLOGY: NEXT GENERATION ECM-BASED ALLOGRAFT TECHNOLOGY: Potent biological scaffolds strategically control stem cell fate and function, allowing our allografts to harness the regenerative potential of patient s

More information

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,

More information

3D Cell Culturing with the Bio-Assembler from Nano3D Biosciences, Inc.

3D Cell Culturing with the Bio-Assembler from Nano3D Biosciences, Inc. A Nano3D Biosciences White Paper 7000 Fannin St., suite 2140 Houston, TX 77030 713-790-1833 www.n3dbio.com 3D Cell Culturing with the Bio-Assembler from January 2012 By Glauco R. Souza, Ph.D. (CSO) and

More information

Supporting Material 3D Traction stresses activate protease-dependent invasion of cancer cells Aung et al.,

Supporting Material 3D Traction stresses activate protease-dependent invasion of cancer cells Aung et al., Supporting Material 3D Traction stresses activate protease-dependent invasion of cancer cells Aung et al., Effect Of Cell Dissolving Solution On Matrigel Network The effect of the cell removal process

More information

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor Calcium Signals in Biological Systems Lecture 3 (2/9/0) Measuring intracellular Ca 2+ signals II: Genetically encoded Ca 2+ sensors Henry M. Colecraft, Ph.D. Challenges to measuring intracellular Ca 2+

More information

DEPArray Technology. Sorting and Recovery of Rare Cells

DEPArray Technology. Sorting and Recovery of Rare Cells DEPArray Technology Sorting and Recovery of Rare Cells Delivering pure, single, viable cells The DEPArray system from Silicon Biosystems is the only automated instrument that can identify, quantify, and

More information

Convoy TM Transfection Reagent

Convoy TM Transfection Reagent Convoy TM Transfection Reagent Catalog No.11103 0.25ml (40-80 transfections in 35mm dishes) Catalog No.11105 0.5 ml (80-165 transfections in 35mm dishes) Catalog No.11110 1.0 ml (165-330 transfections

More information

Oris TM Cell Invasion & Detection Assay Product No.: CIA101DE & CIA200DE

Oris TM Cell Invasion & Detection Assay Product No.: CIA101DE & CIA200DE Bringing Science to the Surface TM Oris TM Cell Invasion & Detection Assay Product No.: CIA101DE & CIA200DE 96-well, 3-D Assay for Investigating Cell Invasion of Adherent Cell Lines PROTOCOL & INSTRUCTIONS

More information

Human Collagen Type III (COL3) ELISA

Human Collagen Type III (COL3) ELISA Human Collagen Type III (COL3) ELISA For the quantitative determination of human COL3 in serum, plasma, cell culture fluid and other biological fluids Cat. No. KT-61018 For Research Use Only. Not for use

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

ab Fluo-8 No Wash Calcium Assay Kit

ab Fluo-8 No Wash Calcium Assay Kit ab112129 Fluo-8 No Wash Calcium Assay Kit Instructions for Use For detecting calcium in cells by using our proprietary fluorescence probe. This product is for research use only and is not intended for

More information

Repetition: Adhesion Mechanisms

Repetition: Adhesion Mechanisms Repetition: Adhesion Mechanisms a) Mechanical interlocking b) Monolayer/monolayer c) Chemical bonding d) Diffusion e) Psedo diffusion due to augmented energy input (hyperthermal particles) Repetition:

More information

Cationic Vector Intercalation into the Lipid Membrane Enables Intact Polyplex DNA Escape from Endosomes for Gene Delivery

Cationic Vector Intercalation into the Lipid Membrane Enables Intact Polyplex DNA Escape from Endosomes for Gene Delivery Cationic Vector Intercalation into the Lipid Membrane Enables Intact Polyplex DNA Escape from Endosomes for Gene Delivery Sriram Vaidyanathan, 1 Junjie Chen, 2 Bradford G. Orr, 3 Mark M. Banaszak Holl

More information

Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing

Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina

More information

Measuring Wound Healing and Cell Migration using Celigo Imaging Cytometer

Measuring Wound Healing and Cell Migration using Celigo Imaging Cytometer Measuring Wound Healing and Cell Migration using Celigo Imaging Cytometer Nexcelom Bioscience LLC. 360 Merrimack Street, Building 9 Lawrence, MA 01843 T: 978.327.5340 F: 978.327.5341 E: info@nexcelom.com

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL Materials and Methods Circular dichroism (CD) spectroscopy. Far ultraviolet (UV) CD spectra of apo- and holo- CaM and the CaM mutants were recorded on a Jasco J-715 spectropolarimeter

More information

Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation 5

Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation 5 Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation Application Note Authors Yoonseok Kam 1, Ned Jastromb 1, Joe Clayton, Paul Held, and Brian P. Dranka 1 1 Agilent

More information

Human immunoglobulin G(IgG) ELISA Kit

Human immunoglobulin G(IgG) ELISA Kit Human immunoglobulin G(IgG) ELISA Kit For the quantitative determination of human immunoglobulin G (IgG) concentrations in serum, plasma, cell culture supernates, urine, tissue homogenates, cell lysates.

More information

TransIT -293 Transfection Reagent

TransIT -293 Transfection Reagent TransIT -293 Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2700 INTRODUCTION TransIT -293 Transfection Reagent is specifically optimized to provide

More information

QImaging Camera Application Notes Multicolor Immunofluorescence Imaging

QImaging Camera Application Notes Multicolor Immunofluorescence Imaging QImaging Camera Application Notes Multicolor Immunofluorescence Imaging In order to image localization of intracellular proteins with high specificity, it is frequently necessary to multiplex antibody

More information

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC. MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput

More information

Stem cell transfection guide

Stem cell transfection guide APPLICATION NOTE Stem cell transfection guide Gene delivery solutions Introduction Stem cells continue to show immense promise for the future of regenerative medicine and personalized therapeutic treatments.

More information

Cellular adhesion and neuronal excitability on functionalised diamond surfaces

Cellular adhesion and neuronal excitability on functionalised diamond surfaces Cellular adhesion and neuronal excitability on functionalised diamond surfaces P. Ariano 1,2, P. Baldelli 1,3, E. Carbone1,3, A. Gilardino1,2, A. Lo Giudice1,4, D. Lovisolo1,2, C. Manfredotti1,4, M. Novara1,3,

More information

TAMU: PROTEOMICS SPECTRA 1 What Are Proteomics Spectra? DNA makes RNA makes Protein

TAMU: PROTEOMICS SPECTRA 1 What Are Proteomics Spectra? DNA makes RNA makes Protein The Analysis of Proteomics Spectra from Serum Samples Jeffrey S. Morris Department of Biostatistics MD Anderson Cancer Center TAMU: PROTEOMICS SPECTRA 1 What Are Proteomics Spectra? DNA makes RNA makes

More information

Fluo-8 Medium Removal Calcium Assay Kit

Fluo-8 Medium Removal Calcium Assay Kit ab112128 Fluo-8 Medium Removal Calcium Assay Kit Instructions for Use For detecting calcium in cells by using our proprietary fluorescence probe This product is for research use only and is not intended

More information

Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132

Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Neuron, Volume 65 Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Dieter Edbauer, Joel R. Neilson, Kelly A. Foster, Chi-Fong Wang, Daniel P. Seeburg, Matthew

More information

Human Cancer Antigen 15-3 (CA 15-3) ELISA Kit

Human Cancer Antigen 15-3 (CA 15-3) ELISA Kit Product Manual Human Cancer Antigen 15-3 (CA 15-3) ELISA Kit Catalog Numbers PRB- 5069 PRB- 5069-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Breast

More information

QS S Assist KINASE_MSA Kit

QS S Assist KINASE_MSA Kit QS S Assist KINASE_MSA Kit Description KINASE MSA Kit is designed for use in pharmacological assays for KINASE based on Off-chip mobility shift assay (MSA). This kit includes Assay Buffer, Termination

More information