The structure of DNA.
|
|
|
- Kristina Ford
- 6 years ago
- Views:
Transcription
1 The structure of DNA
2 ATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGATC TACTGACTGCATCGTACTGACTGCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTTTA CATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGC CATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCC ACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATAC TCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTT ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACA GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGC TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATA CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGCATCGTACTGACTGTCTAGTCTAAACACATCCCACA ATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTCTAGTCTAAACAC GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGC TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATA CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACA TATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATACATATCGTCATCGTACTGACTGTCTAGTCTAAACAC GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGC TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATA CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACA TATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATAGCCGATCGTACGACACATATCGTCATCGTACTGCCC CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGCCGATCGTACGACACATATCGTCATCGTACTGCCC CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACA CGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTA ATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGCA ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCC CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGACTGCATCGTACTGACTGCACATATCGTCATACAT GTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTAC ATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACACTGTCTAGTCTAAACACATCCATCGTACTGACTGCAT CGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCAT
3 DNA Fingerprinting (aka Genotyping)
4 The structure of DNA 5! 3! A! T! G! C! C! G! C! G! G! C! A! T! C! G! G! C! 3! 5!
5 Humans can differ from each other by Single Nucleotide Polymorphisms (SNPs) 5! 3! A! T! G! C! C! G! C! G! G! C! A! T! C! G! 3! 5! Human #1 5 -ATGCCGATCGTT-3! 3 -TACGGCTAGCAA-5!
6 Humans can differ from each other by Single Nucleotide Polymorphisms (SNPs) 5! 3! A! T! G! C! C! G! C! G! G! C! A! T! C! G! 3! 5! Human #1 Human #2 5 -ATGCCGATCGTT-3! 3 -TACGGCTAGCAA-5! 5 -ATGCCAATCGTT-3! 3 -TACGGTTAGCAA-5!
7 What is DNA Fingerprinting (Genotyping) used for?
8 What is DNA Fingerprinting (Genotyping) used for? -- Paternity Testing -- Forensics -- Discovering the gene that, when mutated, leads to a disease!
9 Humans can differ from each other by Single Nucleotide Polymorphisms (SNPs) 5! 3! A! T! G! C! C! G! C! G! G! C! A! T! C! G! 3! 5! Human #1 Human #2 5 -ATGCCGATCGTT-3! 3 -TACGGCTAGCAA-5! 5 -ATGCCAATCGTT-3! 3 -TACGGTTAGCAA-5!
10 Humans can differ from each other by Simple Sequence Repeats (SSRs) Human #1 Human #2 5 -ATGCCGTGTGTGATCGTT-3! 3 -TACGGCACACACTAGCAA-5! 5 -ATGCCGTGTGTGTGTGATCGTT-3! 3 -TACGGCACACACACACTAGCAA-5!
11 Humans can differ from each other by Simple Sequence Repeats (SSRs) Human #1 Human #2 5 -ATGCCGTGTGTGATCGTT-3! 3 -TACGGCACACACTAGCAA-5! 5 -ATGCCGTGTGTGTGTGATCGTT-3! 3 -TACGGCACACACACACTAGCAA-5! one DNA that is 18 nucleotides long one DNA that is 22 nucleotides long
12 Gel Electrophoresis -- A technique that allows pieces of DNA to be separated by size -- A gel is a matrix that molecules can move through -- DNA is negatively charged
13 PCR - a way to copy one area of the DNA
14 PCR - a way to copy one area of the DNA
15 Using Gel Electrophoresis for Fingerprinting 1) Isolate the DNA from a person 2) Make copies of just the one region of DNA you want to study 3) Run the DNA through a gel
16 Gel Electrophoresis ladder nt 20 nt 10 nt
17 Half my DNA is from mom and half is from dad CCAGTACCTCCTCCTACGGA CCAGTACCTACGGA
18 Can these people be my parents? ladder Me Mom Dad 24 nt 20 nt 10 nt Are these my parents?
19 A mix up between 3 babies and 3 sets of parents -- 3 babies in a maternity ward: A, B, C -- 3 couples: Mom #1 & Dad #1 Mom #2 & Dad #2 Mom #3 & Dad #3
20 A specific region of chromosome #15 5 GCTAAGTATTGCTCAAGA (TTAGGAT) n GATAAATAACTGGCTAGTA 3 3 CGATTCATAACGAGTTCT (AATCCTA) n CTATTTATTGACCGATCAT 5
21 Examining a region of chromosome #15 Ladder dad#1 mom#1 dad#2 mom#2 dad#3 mom#3 BabyA BabyB BabyC n = 50 n = 45 n = 40 n = 35 n = 30 n = 25 n = 20
22 Questions to Answer -- Given the data so far, which of the three babies can you already conclusively connect to a set of parents? -- How did you conclude this? -- Why can you not determine the parents of all of the babies at this point? -- How do you think you would go about conclusively determining the parents of the remaining babies using DNA fingerprinting analysis?
23 Examining a region of chromosome #15 Ladder dad#1 mom#1 dad#2 mom#2 dad#3 mom#3 BabyA BabyB BabyC n = 50 n = 45 n = 40 n = 35 n = 30 n = 25 n = 20
24 A specific region of chromosome #4 5 ACTGTAAACGCTAGCTGGTTCACTG (CAG) n CCTATAGCTAGCTTTACGGA 3 3 TGACATTTGCGATCGACCAAGTGAC (GTC) n GGATATCGATCGAAATGCCT 5
25 Examining a region of chromosome #4 Ladder dad#1 mom#1 dad#2 mom#2 dad#3 mom#3 BabyA BabyB BabyC n = 90 n = 80 n = 70 n = 60 n = 50 n = 40 n = 30
26 Questions to Answer -- Given all the data in this problem, match the three sets of parents to the three babies. -- Explain how this site on chromosome #4 allowed you to match parents #1 and parents #2 to the correct baby (B or C).
27 Examining a region of chromosome #4 Ladder dad#1 mom#1 dad#2 mom#2 dad#3 mom#3 BabyA BabyB BabyC n = 90 n = 80 n = 70 n = 60 n = 50 n = 40 n = 30
28 Whose DNA was found at the crime scene?
Chapter 7 DNA Fingerprinting By the end of this chapter you will be able to:
Chapter 7 DNA Fingerprinting By the end of this chapter you will be able to: explain how crime scene evidence is collected and processed to obtain DNA describe how radioactive probes are used in DNA fingerprinting
UNIT 3: GENETICS Chapter 9: Frontiers of Biotechnology
CORNELL NOTES Directions: You must create a minimum of 5 questions in this column per page (average). Use these to study your notes and prepare for tests and quizzes. Notes will be stamped after each assigned
Basic Steps of the DNA process
As time pasted technology has improve the methods of analyzing DNA. One of the first methods for the analysis of DNA is known as Restriction Fragment Length Polymorphism (RFLP). This technique analyzed
Heredity and DNA Assignment 1
Heredity and DNA Assignment 1 Name 1. Which sequence best represents the relationship between DNA and the traits of an organism? A B C D 2. In some people, the lack of a particular causes a disease. Scientists
Unit 2- DNA Analysis
Unit 2- DNA Analysis Discovery of DNA structure 1950 s Rosalind Franklin & Maurice Wilkins photograph DNA using x-ray diffraction 1 Discovery of DNA structure 1953 James Watson & Francis Crick develop
DNA analysis. Anja Bye Post doktor. K.G. Jebsen Senter for Hjertetrening. Institutt for Sirkulasjon og Bildediagnostikk Det Medisinske Fakultet NTNU
DNA analysis Anja Bye Post doktor K.G. Jebsen Senter for Hjertetrening Institutt for Sirkulasjon og Bildediagnostikk Det Medisinske Fakultet NTNU Focus of this lecture What is DNA? Comparing DNA from different
Name Date Class CHAPTER 13. DNA Fingerprinting
Real-World Biology: Analysis DNA Fingerprinting Genetic Prints Help Solve Mystery of Girls Switched at Birth. Murder Conviction Overturned by DNA Testing: Prisoner Released. Headlines such as these have
Further Reading - DNA
Further Reading - DNA DNA BACKGROUND What is DNA? DNA (short for deoxyribonucleic acid ) is a complex molecule found in the cells of all living things. The blueprint for life, DNA contains all the information
DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling
Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between
Genetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping
Genetics module Lectures DNA Structure, Replication The Genetic Code; Transcription and Translation Principles of Heredity; Gene Mapping Controlling Gene Expression Mutation and Cancer Textbook: Introduction
AGENDA for 10/11/13 AGENDA: HOMEWORK: Due end of the period OBJECTIVES:
AGENDA for 10/11/13 AGENDA: 1. Finish 1.2.3 DNA Analysis Analyzing DNA Samples Using Current Forensic Methods OBJECTIVES: 1. Demonstrate the steps of gel electrophoresis 2. Analyze restriction fragment
Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
AGENDA for 10/10/13 AGENDA: HOMEWORK: Due end of the period OBJECTIVES: Due Fri, 10-11
AGENDA for 10/10/13 AGENDA: 1. 1.2.3 DNA Analysis Analyzing DNA Samples Using Current Forensic Methods OBJECTIVES: 1. Demonstrate the steps of gel electrophoresis 2. Analyze restriction fragment length
DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
FORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence
FORENSIC GENETICS FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS Establishing human corpse identity Crime cases matching suspect with evidence Paternity testing, even after
Population Genetics (Learning Objectives)
Population Genetics (Learning Objectives) Define the terms population, species, allelic and genotypic frequencies, gene pool, and fixed allele, genetic drift, bottle-neck effect, founder effect. Explain
Chapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
4.1. Genetics as a Tool in Anthropology
4.1. Genetics as a Tool in Anthropology Each biological system and every human being is defined by its genetic material. The genetic material is stored in the cells of the body, mainly in the nucleus of
3. Replication of DNA a. When a cell divides, the DNA must be doubled so that each daughter cell gets a complete copy. It is important for this
DNA 1. Evidence for DNA as the genetic material. a. Until the 1940s, proteins were believed to be the genetic material. b. In 1944, Oswald Avery, Maclyn McCarty, and Colin MacLeod announced that the transforming
Using Single Nucleotide Polymorphism (SNP) to Predict Bitter Tasting Ability
Using Single Nucleotide Polymorphism (SNP) to Predict Bitter Tasting Ability Part II:! Digestion and Analysis of an Amplified Region of the Bitter Taste Receptor TAS2R38 Gene In The Last Lab:! You sampled
Theory and Application of Multiple Sequence Alignments
Theory and Application of Multiple Sequence Alignments a.k.a What is a Multiple Sequence Alignment, How to Make One, and What to Do With It Brett Pickett, PhD History Structure of DNA discovered (1953)
Concepts: What are RFLPs and how do they act like genetic marker loci?
Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th
KEY CONCEPTS AND PROCESS SKILLS. 1. Blood types can be used as evidence about identity and about family relationships.
Evidence from DNA 40- to 1 2 50-minute sessions 69 M O D E L I N G ACTIVITY OVERVIEW SUMMARY Students learn how DNA fingerprinting is done by performing a simulation of the process used to generate different
2 Gene Technologies in Our Lives
CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?
Bio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
NOTES - CH 15 (and 14.3): DNA Technology ( Biotech )
NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?
Title: CSI - Fleming Island High School DNA Investigative Laboratory Techniques and Mission Biotech Gaming
Title: CSI - Fleming Island High School DNA Investigative Laboratory Techniques and Mission Biotech Gaming Mr. John Walters Fleming Island High School Clay County Abstract: Students have seen many television
Genetics and Biotechnology Chapter 13
1 Genetics and Biotechnology Chapter 13 Selective breeding is used to produce organisms with desired traits. I. Applied Genetics A. Selective Breeding 1. Definedthe process by which desired traits of certain
This is a typical chromatogram generated by automated sequencing.
DNA TECHNOLOGY AND FORENSICS Introduction: DNA (Deoxyribonucleic Acid) is a molecule that is the main part of your chromosomes, which carry your hereditary material. The molecule is shaped like a twisted
Gene mutation and DNA polymorphism
Gene mutation and DNA polymorphism Outline of this chapter Gene Mutation DNA Polymorphism Gene Mutation Definition Major Types Definition A gene mutation is a change in the nucleotide sequence that composes
Molecular Markers CRITFC Genetics Workshop December 9, 2014
Molecular Markers CRITFC Genetics Workshop December 9, 2014 Molecular Markers Tools that allow us to collect information about an individual, a population, or a species Application in fisheries mating
Chapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
Chapter 15 DNA and RNA
Chapter 15 DNA and RNA www.mrcbiology.com 1 Variation Variation means that individuals in a species have different characteristics to one another. Acquired Variation are not inherited. e.g learnt during
DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
Introduction to Pharmacogenetics Competency
Introduction to Pharmacogenetics Competency Updated on 6/2015 Pre-test Question # 1 Pharmacogenetics is the study of how genetic variations affect drug response a) True b) False Pre-test Question # 2 Pharmacogenetic
Practice Test #3. Multiple Choice Identify the choice that best completes the statement or answers the question.
Practice Test #3 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists would be _. a.
DNA sequencing. Course Info
DNA sequencing EECS 458 CWRU Fall 2004 Readings: Pevzner Ch1-4 Adams, Fields & Venter (ISBN:0127170103) Serafim Batzoglou s slides Course Info Instructor: Jing Li 509 Olin Bldg Phone: X0356 Email: jingli@eecs.cwru.edu
Some types of Mutagenesis
Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine
Biotech Term 3 Test. True/False Indicate whether the statement is true or false.
Biotech Term 3 Test True/False Indicate whether the statement is true or false. 1. When you are using a gel to perform electrophoresis, the gel is covered with TAE buffer after you put the DNA in the wells.
Genetic Fingerprinting
Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.
Bio Rad PCR Song Lyrics
Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.
Name: Date: 10/12/17 Section: Broughton High School of Wake County
Name: Date: 10/12/17 Section: 1 Deoxyribonucleic acid (DNA) is found in the cells of all organisms. It can be detected in blood, saliva, semen, tissues, hair, and bones. With the exception of identical
Introduction to PCR. Kristen Wolslegel Manager, Education Programs BABEC
Introduction to PCR Kristen Wolslegel Manager, Education Programs BABEC What is DNA? It encodes within its structure the hereditary information that determines the form and function of all known living
Mutations during meiosis and germ line division lead to genetic variation between individuals
Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements
Genetics Lecture 16 Forensics
Genetics Lecture 16 Forensics DNA Forensics Genetics is arguably the most influential science today dramatically affecting technologies in fields as diverse as agriculture, archaeology, medical diagnosis,
Regents Biology REVIEW 5: GENETICS
Period Date REVIEW 5: GENETICS 1. Chromosomes: a. Humans have chromosomes, or homologous pairs. Homologous: b. Chromosome pairs carry genes for the same traits. Most organisms have two copies of the gene
PCR Laboratory Exercise
PCR Laboratory Exercise Advance Protocol (updated 1/2018) Introduction Detection of TPA-25 Alu by PCR A Human DNA Fingerprinting Lab Protocol 1994 Cold Spring Harbor Laboratory DNA Learning Center In this
PV92 PCR Bio Informatics
Purpose of PCR Chromosome 16 PV92 PV92 PCR Bio Informatics Alu insert, PV92 locus, chromosome 16 Introduce the polymerase chain reaction (PCR) technique Apply PCR to population genetics Directly measure
Bio 311 Learning Objectives
Bio 311 Learning Objectives This document outlines the learning objectives for Biol 311 (Principles of Genetics). Biol 311 is part of the BioCore within the Department of Biological Sciences; therefore,
Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis
Name: Date: Period: Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis ***Completing this study guide in its entirety will result in extra credit on the exam. You must show me the DAY OF the
Chapter 10 Analytical Biotechnology and the Human Genome
Chapter 10 Analytical Biotechnology and the Human Genome Chapter Outline Enzyme tests and biosensors DNA-based tests DNA analysis technologies Human genome and genome-based analytical methods 1 Enzyme-based
Lecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
GENETICS: BIOLOGY HSA REVIEW
GENETICS: BIOLOGY HSA REVIEW HSA Review A. Matching: On the lines provided, write the letter of the definition of each term. a. genetics f. gamete b. trait g. probability c. hybrid h. Punnett square d.
Mutations and Disease
Mutations and Disease Objectives and lecture plan Describe what are mutations Explain how do we identify mutations Explain how and why mutant proteins lead to disease Describe what kinds of DNA mutations
Laboratory Exercise 4. Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis.
Laboratory Exercise 4 4 Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis B A C K G R O U N D The human genome contains over 3000 million base pairs, which are distributed
DNA Structure & the Genome. Bio160 General Biology
DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:
Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications
Ranajit Chakraborty, Ph.D. Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications Overview Some brief remarks about SNPs Haploblock structure of SNPs in the human genome Criteria
Biotechnology. Chapter 13
Biotechnology Chapter 13 Genetic Changes Humans have been changing the genetics of other species for thousands of years Artificial selection of plants and animals Tomato plants look nothing like their
Tracing Your Matrilineal Ancestry: Mitochondrial DNA PCR and Sequencing
Tracing Your Matrilineal Ancestry: Mitochondrial DNA PCR and Sequencing BABEC s Curriculum Rewrite Curriculum to Align with NGSS Standards NGSS work group Your ideas for incorporating NGSS Feedback from
POPULATION GENETICS: The study of the rules governing the maintenance and transmission of genetic variation in natural populations.
POPULATION GENETICS: The study of the rules governing the maintenance and transmission of genetic variation in natural populations. DARWINIAN EVOLUTION BY NATURAL SELECTION Many more individuals are born
STUDY OF VNTR HUMAN POLYMORPHISMS BY PCR
STUDY OF VNTR HUMAN POLYMORPHISMS BY PCR Ref. PCR1 1. OBJECTIVE OF THE EXPERIMENT The objective of this experiment is to introduce students to the principles and practice of Polymerase Chain Reaction (PCR)
Student Sheet 1.1: KWL Chart
Student s Name Date Class Student Sheet 1.1: KWL Chart Topic: K W L What do you Know? What do you Want to know? What did you Learn? Lesson 1 / Pre-Assessment: Genes and Molecular Machines Student s Name
Lecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
COLLEGE OF THE CANYONS INTRODUCTION TO BIOTECHNOLOGY: CUSTOM LAB
COLLEGE OF THE CANYONS INTRODUCTION TO BIOTECHNOLOGY: CUSTOM LAB GEL ELECTROPHORESIS AND DNA ANALYSIS LAB Version 7-5-12 One of the most basic and frequently used tools of the molecular biologist is electrophoresis.
Lesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels
Lesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels What Are You Looking At? Before you analyze your PCR products, let s take a look at the target sequence being explored.
Genetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
Molecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
Answers to additional linkage problems.
Spring 2013 Biology 321 Answers to Assignment Set 8 Chapter 4 http://fire.biol.wwu.edu/trent/trent/iga_10e_sm_chapter_04.pdf Answers to additional linkage problems. Problem -1 In this cell, there two copies
John M. Butler and Peter M. Vallone National Institute of Standards and Technology
DNA Biometrics: i Standards and Technology John M. Butler and Peter M. Vallone National Institute of Standards and Technology NDIA Biometrics Conference (Arlington VA) NDIA Biometrics Conference (Arlington,
How about the genes? Biology or Genes? DNA Structure. DNA Structure DNA. Proteins. Life functions are regulated by proteins:
Biology or Genes? Biological variation Genetics This is what we think of when we say biological differences Race implies genetics Physiology Not all physiological variation is genetically mediated Tanning,
AP Biology. Investigation 9: Biotechnology:Restriction Enzyme Analysis of DNA. Investigation 9: Restriction Enzyme Analysis
AP Biology Investigation 9: Biotechnology:Restriction Enzyme Analysis of DNA In this investigation, you will learn how to use restriction Learning Objectives enzymes and gel electrophoresis to create genetic
Multiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
Genome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
HISTORY OF FORENSIC SEROLOGY
FORENSIC SEROLOGY SAM SHEPPARD CASE Dr. Sam Sheppard was accused of beating his wife to death. - The show The Fugitive was based on his life. He said he was asleep in the living room when his wife was
Review Instructions:
How is DNA used to solve crimes? Review Instructions: Get out a separate sheet of notebook paper Put your name on it Write your partner s name under yours Title the paper- DNA Lecture Review Both people
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of
DNA & DNA Replication
DNA & DNA Replication DNA Structure How did Watson and Crick contribute to our understanding of genetics? Watson and Crick developed the double helix model for DNA DNA Structure What is a double helix?
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
11/30/11. Lb output/beef cow. Corn Yields. Corn and Wheat
Dr. Jack Whittier Extension Beef Specialist, Colorado State University XXII Range Beef Cow Symposium, Mitchell, Nebraska November 29, 30 and December 1, 2011 Genomics the basics What it means Is it something
Applications of DNA Markers in BC Tree Improvement Programs. April 2004
Applications of DNA Markers in BC Tree Improvement Programs April 2004 Applications of DNA Markers in BC Tree Improvement Programs Author: Craig Newton, PhD Director, Molecular Diagnostics Vizonscitec
MICROSATELLITE MARKER AND ITS UTILITY
Your full article ( between 500 to 5000 words) - - Do check for grammatical errors or spelling mistakes MICROSATELLITE MARKER AND ITS UTILITY 1 Prasenjit, D., 2 Anirudha, S. K. and 3 Mallar, N.K. 1,2 M.Sc.(Agri.),
What is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function
Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen
BS 50 Genetics and Genomics Week of Nov 29
BS 50 Genetics and Genomics Week of Nov 29 Additional Practice Problems for Section Problem 1. A linear piece of DNA is digested with restriction enzymes EcoRI and HinDIII, and the products are separated
DNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
The Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
UNIT 7: BIOTECH, PROTEIN SYNTHESIS, MUTATIONS. DNA/ RNA Review
UNIT 7: BIOTECH, PROTEIN SYNTHESIS, MUTATIONS DNA/ RNA Review Genetic Engineering Genetic engineering is technology that involves manipulating the DNA of one organism in order to insert the DNA of another
Using Genetics for Species Identification
Using Genetics for Species Identification John Hyde NOAA Southwest Fisheries Science Center La Jolla, California USA December 6, 2013 2 Important Point to Consider Not all specimens need to be genetically
Q1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution.
Short questions 1 point per question. Q1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution. Answer: Water is sucked out of the cells by osmosis (this reduces
Uniparental disomy (UPD) analysis of chromosome 15
YOUR INNOVATIVE RESEARCH Analysis of UPD by STR-PCR Uniparental disomy (UPD) analysis of chromosome 15 Applied Biosystems 3500xL Genetic Analyzer Introduction Researchers at the Laboratory of Medical Genetics
Short Tandem Repeat (STR) Analysis
Maj Gen (R) Suhaib Ahmed, HI (M) Short tandem repeats (STR) are randomly distributed DNA sequences in which 2-6bp are tandemly repeated. These are scattered on all chromosomes including the autosomes as
Applications of Biotechnology Electrophoresis lab: (without the DNA) Introduction to micropipetters and electrophoresis equipment
Applications of Biotechnology Electrophoresis lab: (without the DNA) Introduction to micropipetters and electrophoresis equipment Materials- Gather the following items at your table: Eight samples for
Linkage & Genetic Mapping in Eukaryotes. Ch. 6
Linkage & Genetic Mapping in Eukaryotes Ch. 6 1 LINKAGE AND CROSSING OVER! In eukaryotic species, each linear chromosome contains a long piece of DNA A typical chromosome contains many hundred or even
Synthetic Biology for
Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids
PTC PCR II: Restriction Enzymes & Gel Electrophoresis
PTC PCR II: Restriction Enzymes & Gel Electrophoresis Objective To apply what we ve learned about genetics, molecular biology, and recombinant DNA to a specific human genetic trait. Background Mammals
The Case of the Missing Necklace
The Case of the Missing Necklace Ania Wieczorek PhD Biotechnology Outreach Program College of Tropical Agriculture and Human Resources University of Hawaii Illustrated by Gayle Hori Adapted from Case of
DNA Technology. B. Using Bacteria to Clone Genes: Overview:
DNA Technology A. Basic Vocabulary: is DNA from 2 different sources that is combined. is the direct manipulation of genes for practical purposes. literally means or in a test tube or flask. is the manipulation