To sequence or not to sequence is not a question anymore. BUT
|
|
- Easter Blankenship
- 6 years ago
- Views:
Transcription
1 To sequence or not to sequence is not a question anymore. BUT Vladimír Beneš 21 June
2 More data on their way to you! High GC High GC Low GC Low GC v3 flowcell imaged area larger by 50 %! v3 sequencing chemistry Some GC-rich clusters poorly resolved/not detected at very high densities Old Cluster Amplification Larger, brighter GC-rich clusters are well resolved and detected at very high densities New Cluster Amplification
3 Increasing yield Sequence output from Illumina reads per lane Millions of reads PF Illumina Arrives 0.3 GAII GAIIx SCS 2.8, cbot, v5 kits SCS2.6, v4 kits May 08 Jun 08 Jul 08 Aug 08 Sep 08 Oct 08 Nov 08 Dec 08 Jan 09 Feb 09 Mar 09 Apr 09 May 09 Jun 09 Jul 09 Aug 09 Sept 09 Oct 09 Nov 09 Dec 09 Jan 10 Feb 10 Mar 10 Apr 10 May 10 June 10 July 10 Aug 10 Sept 10 Oct 10 Nov 10 Dec 10 Jan 11 Feb 11 Mar 11 April 11 May 11 June 11 GA HiSeq2000
4 Improving quality of called bases Average quality per cycle, RNA-Seq Quality score Cycle 36 Base mrnaseq 76 Base mrnaseq 76 Base V4 mrnaseq 105 Base V4 mrnaseq 76 Base V5 mrnaseq v5105 s_6 s7 V5 s8 v5 TruSeq 150 R1 TruSeq 150 R2
5 Challenges The only thing constant in life is change Distorted expectations of users Data ( massive amounts, formats ) Interpretation of results (suboptimal experimental design; is everything relevant?) Incomplete understanding of sources of error and bias in MPS data
6 Bias is never good
7
8 Hype/hope curve
9 MPS space PNAS (2010) Kahvejian, Nat Biotech (2008)
10 Available MPS applications transcriptome RNA-Seq, Tag-Seq mirnome smallrna-seq protein-na interactions ChIP-Seq, CLIP-Seq epigenome Methyl-Seq de novo & re-sequencing Metagenomics Genome capture, multiplexing yes yes yes yes yes yes yes
11 MPS methods used in epigenomics Rada-Iglesias & Wysocka, Genome Medicine (2011)
12 Portela & Esteller, Nature Biotechnology (2011)
13 Importance of experimental design What do I want to study? "Would you tell me, please, which way I ought to go from here?" "That depends a good deal on where you want to get to," said the Cat. "I don t much care where--" said Alice. "Then it doesn t matter which way you go," said the Cat. "--so long as I get SOMEWHERE," Alice added as an explanation. "Oh, you re sure to do that," said the Cat, "if you only walk long enough. Lewis Carroll s Alice in Wonderland
14 Which sequencing mode to use? Sequencing type Exon capture Whole genome sequencing Recommendation 50Mb Kit, human: 105b SR to get sufficient coverage Large rearrangements: Mate-pairs large insert Resequencing: SNPs/indels: Coverage is good 100+ PE. If you don t get the coverage at the start you ll regret it. Coverage is the key! RNA-Seq Chip-Seq Multiplexing Tag counting: large number of mappable tags 36-50b SR should suffice. Longer reads may need to be trimmed to match exons. Transcriptome assembly or exon usage: 75+ single or 75+ PE depending on a de novo/spliced read mapping approach or map pairs to detect also alternative splicing. Strand-specific libraries: complex insight into transcriptome 36b SR unless you have real concerns about alignability of your target (i.e. some strange looking enhancer region) Coverage is the key!
15 MPS workflow 1) Library preparation 2) Cluster generation on a flow cell SE, PE reads, bases 3) Sequencing & imaging 4) Data processing & analysis
16 MPS library preparation 5 AATGATACGGCGACCACCGA-ACACTCTTTCCCTACACGACGCTCTTCCGATCT--INSERT--TCGTATGCCGTCTTCTGCTTG TTACTATGCCGCTGGTGGCT-TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA--INSERT--AGCATACGGCAGAAGACGAAC5 where 5 AATGATACGGCGACCACCGA 5 CAAGCAGAAGACGGCATACGA is the P5 attachment/amplification primer sequence is the P7 attachment/amplification primer sequence 5 ACACTCTTTCCCTACACGACGCTCTTCCGATCT is the SBS3 sequencing primer sequence INSERT is a complex mix of DNA fragments
17 Forked adapters A Insert Insert A Adapter ACACTCTTTCCCTACACGAC TCGTATGCCGTCTTCTGCTTG GCTCTTCCGAT C T P- GATCGGAAGAGC CGAGAAGGCTA G -P T CTAGCCTTCTCG GTTCGTCTTCTGCCGTATGCT CAGCACATCCCTTTCTCACA Adapter
18 Library preparation II. A conventional protocol A nextera protocol at least 500 ng of gdna <50 ng of gdna! Adey et al., Genome Biology (2010)
19 Library preparation III. Strict QC of starting material (GiGo) Qubit quantification gel images, bioanalyzer/experion traces
20 Library preparation IV. Bioruptor, probe (ChIP-Seq) Covaris vs nebulization Kits (proprietary, home-brewed, NEB!) Size selection using gel extractor, E- gel, Pippin prep, SPRIworks, Lo-bind tubes! Covaris Hydroshear
21 RNA-Seq libraries rrna depletion (oligo-dt beads, Ribo-Minus, Ribo-Zero ) BUT mitochondria-derived rrna mostly ignored!!? 18S 28S 10: RiboMinus (UHRR) prep 2 3. RiboZero (UHRR) Anu 10/12/09 #3 Both from Experiment 357;run 10/13/09 strand-specific library, Levine et al., Nat Meth (2010)
22
23
24 Library quantification & QC Qubit Bioanalyzer HS DNA Chip DNA 1000 Chip
25 Methyl-Seq Carey et al., Drug Discovery Today (2011) Zilbermann & Henikoff, Development (2007)
26 Pacific Biosciences Detection volume Modified bases By courtesy of Pacific Bioscience
27 Direct detection of methylated bases Flusberg et al. Nature Methods (2010)
28 Data integration Pepke et al., Nature Methods (2009)
29 Where are we heading?
30 Nucleic acids detection and sequencing techniques Kahvejian et al., Nat Biotech (2008)
31 Caution required available information (clues) amount state of our knowledge (answers) time We are drowning in information and starving for knowledge. Rutherford D. Roger
32 MPS features Unprecedented discovery power Hypothesis-free Almost unbiased results Sensitivity & specificity For tag-counting applications truly wholegenome, -transcriptome, -methylome view Only one source of technology noise
33 Acknowledgments Bettina Haase Dinko Pavlinic Jens Stolte Jonathon Blake Tobias Rausch Jürgen Have Zimmermann a nice day! All our users and former colleagues Science is built with facts as a house is with stones, but a collection of facts is no more a science than a heap of stones is a house. Jules Henri Poincare
Considerations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center
Considerations for Illumina library preparation Henriette O Geen June 20, 2014 UCD Genome Center Diversity of applications De novo genome Sequencing ranscriptome Expression Splice Isoform bundance Genotyping
More informationSMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationAnalysis of Differential Gene Expression in Cattle Using mrna-seq
Analysis of Differential Gene Expression in Cattle Using mrna-seq mrna-seq A rough guide for green horns Animal and Grassland Research and Innovation Centre Animal and Bioscience Research Department Teagasc,
More informationACCEL-NGS 2S DNA LIBRARY KITS
ACCEL-NGS 2S DNA LIBRARY KITS Accel-NGS 2S DNA Library Kits produce high quality libraries with an all-inclusive, easy-to-use format. The kits contain all reagents necessary to build high complexity libraries
More informationIntroduction Bioo Scientific
Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior
More informationMiSeq. system applications
MiSeq system applications Choose your application. Load, and go. Focused power. Speed and simplicity for targeted and small-genome sequencing. Optimized sample preparation kits, push-button sequencing,
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationBioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
More informationHow much sequencing do I need? Emily Crisovan Genomics Core
How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?
More informationA Genomics (R)evolution: Harnessing the Power of Single Cells
A Genomics (R)evolution: Harnessing the Power of Single Cells Fundamental Question #1 If Transcriptional Heterogeneity ( Noise ) is so great in single cells What s the Point? Single Cells = True Biology
More informationNEBNext. for Ion Torrent LIBRARY PREPARATION KITS
NEBNext for Ion Torrent LIBRARY PREPARATION KITS NEBNEXT PRODUCTS FOR ION TORRENT Table of Contents 3 General Introduction 4 5 6 6 7 8 DNA Library Preparation Workflow Product Selection Product Details
More informationIntroduction to RNA-Seq
Introduction to RNA-Seq Monica Britton, Ph.D. Sr. Bioinformatics Analyst March 2015 Workshop Overview of RNA-Seq Activities RNA-Seq Concepts, Terminology, and Work Flows Using Single-End Reads and a Reference
More informationImplementation of Automated Sample Quality Control in Whole Exome Sequencing
Journal of Life Sciences 11 (2017) 261-268 doi: 10.17265/1934-7391/2017.06.001 D DAVID PUBLISHING Implementation of Automated Sample Quality Control in Whole Exome Sequencing Elisa Viering 1, Jana Molitor
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationIncorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits
Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing
More informationNext Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
More informationSOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit
SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow
More informationi5 Dual Indexing Add-on Kit for QuantSeq/SENSE for Illumina Instruction Manual
i5 Dual Indexing Add-on Kit for QuantSeq/SENSE for Illumina Instruction Manual Catalog Numbers: 001 (SENSE mrna-seq Library Prep Kit V2 for Illumina) 009 (SENSE Total RNA-Seq Library Prep Kit for Illumina)
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationAutomated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep
Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS LIBRARY PREP FOR NEXT GEN SEQUENCING PROTEIN EXPRESSION &
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationNext Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017
Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA
More informationLab methods: Exome / Genome. Ewart de Bruijn
Lab methods: Exome / Genome 27 06 2013 Ewart de Bruijn Library prep is only a small part of the complete DNA analysis workflow DNA isolation library prep enrichment flowchip prep sequencing bioinformatics
More informationSingle Cell Genomics
Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell
More informationTargeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales
Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology
More informationWhole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
More informationResearch school methods seminar Genomics and Transcriptomics
Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence
More informationDifferential gene expression analysis using RNA-seq
https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, August 2017 Friederike Dündar with Luce Skrabanek & Ceyda Durmaz Day 1: Introduction into high-throughput
More informationRIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)
Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information
More informationCancer Genetics Solutions
Cancer Genetics Solutions Cancer Genetics Solutions Pushing the Boundaries in Cancer Genetics Cancer is a formidable foe that presents significant challenges. The complexity of this disease can be daunting
More informationEfficiency in Next-Generation Sequencing for Public Health
Efficiency in Next-Generation Sequencing for Public Health Patrick Van Roey June 27, 2016 June 27, 2016 2 Overview Introduction Applied Genomic Technologies Core Implementing NGS for Public Health NGS
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationUser Manual. NGS Library qpcr Quantification Kit (Illumina compatible)
NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents
More informationElectric Forward Market Report
Mar-01 Mar-02 Jun-02 Sep-02 Dec-02 Mar-03 Jun-03 Sep-03 Dec-03 Mar-04 Jun-04 Sep-04 Dec-04 Mar-05 May-05 Aug-05 Nov-05 Feb-06 Jun-06 Sep-06 Dec-06 Mar-07 Jun-07 Sep-07 Dec-07 Apr-08 Jun-08 Sep-08 Dec-08
More informationWELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)
WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow
More informationNext Generation Sequencing: An Overview
Next Generation Sequencing: An Overview Cavan Reilly November 13, 2017 Table of contents Next generation sequencing NGS and microarrays Study design Quality assessment Burrows Wheeler transform Next generation
More informationHiSeqTM 2000 Sequencing System
IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance
More informationRADSeq Data Analysis. Through STACKS on Galaxy. Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé
RADSeq Data Analysis Through STACKS on Galaxy Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé RAD sequencing: next-generation tools for an old problem INTRODUCTION source: Karim Gharbi
More informationINTRODUCCIÓ A LES TECNOLOGIES DE 'NEXT GENERATION SEQUENCING'
INTRODUCCIÓ A LES TECNOLOGIES DE 'NEXT GENERATION SEQUENCING' Bioinformàtica per a la Recerca Biomèdica Ricardo Gonzalo Sanz ricardo.gonzalo@vhir.org 14/12/2016 1. Introduction to NGS 2. First Generation
More informationData Analysis with CASAVA v1.8 and the MiSeq Reporter
Data Analysis with CASAVA v1.8 and the MiSeq Reporter Eric Smith, PhD Bioinformatics Scientist September 15 th, 2011 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense
More informationDe Novo Assembly of High-throughput Short Read Sequences
De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationNGS: Digital RNAseq & Library Prep Seminar. Next-Generation Sequencing Lunch & Learn
NGS: Digital RNAseq & Library Prep Seminar Next-Generation Sequencing Lunch & Learn Samuel Rulli, Ph. D Global Product Manager QIAseq Targeted RNA Panels 1 Targeted sequencing with UMIs QIAseq mirnaseq
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies. D. Puthier 2012
Introduction to transcriptome analysis using High Throughput Sequencing technologies D. Puthier 2012 A typical RNA-Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationDNA-Sequencing. Technologies & Devices
DNA-Sequencing Technologies & Devices Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day, 850 nt reads 2 Mb/day, 550 nt reads Roche/454 GS FLX 12/2006 800 Mb/23h, 800 nt reads
More information"Expanded applications for NGS library prep exploring rapid workflows with Nextera and challenging RNA samples"
"Expanded applications for NGS library prep exploring rapid workflows with Nextera and challenging RNA samples" Todd Deppe Sample Prep Specialist Regional Marketing UCR Feb 11, 2014 2013 Illumina, Inc.
More informationTECHNICAL BULLETIN. SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies. Catalog Number SEQX Storage Temperature 20 C
SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies Catalog Number SEQX Storage Temperature 20 C TECHNICAL BULLETIN Product Description The SeqPlex DNA Amplification Kit
More informationGenome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias
Genome Sequencing I: Methods MMG 835, SPRING 2016 Eukaryotic Molecular Genetics George I. Mias Department of Biochemistry and Molecular Biology gmias@msu.edu Sequencing Methods Cost of Sequencing Wetterstrand
More informationTruSeq Nano DNA Library Prep Protocol Guide
TruSeq Nano DNA Library Prep Protocol Guide For Research Use Only. Not for use in diagnostic procedures. Fragment DNA 3 Repair Ends and Select Library Size 5 Adenylate 3ʹ Ends 7 Ligate Adapters 8 Enrich
More informationRNA-Seq Software, Tools, and Workflows
RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationWhole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 2 Sample Prep Workflow, 3 Best Practices, 4 DNA Input Recommendations, 6
More informationHybridization capture of DNA libraries using xgen Lockdown Probes and Reagents
Hybridization capture of DNA libraries using xgen Lockdown Probes and Reagents For use with: llumina TruSeq adapter ligated libraries xgen Universal Blockers TS Mix (Catalog # 1075474, 1075475, 1075476)
More informationMate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
More informationTargeted Sequencing in the NBS Laboratory
Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February
More informationQIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
More informationMHC Region. MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells
DNA based HLA typing methods By: Yadollah Shakiba, MD, PhD MHC Region MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells Nomenclature of HLA Alleles Assigned
More informationProduct selection guide Ion S5 and Ion S5 XL Systems
Product selection guide Ion S5 and s Cancer genomics research Molecular profiling Ion AmpliSeq Ready-to-Use Panels Ion AmpliSeq Comprehensive Cancer Panel Cat. No. 4477685 Ion AmpliSeq Made-to-Order Panels
More informationDNA-Sequenzierung. Technologien & Geräte
DNA-Sequenzierung Technologien & Geräte Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day, 850 nt reads 2 Mb/day, 550 nt reads Roche/454 GS FLX 12/2006 400 Mb/7h, 350 nt reads
More informationRegulation of eukaryotic transcription:
Promoter definition by mass genome annotation data: in silico primer extension EMBNET course Bioinformatics of transcriptional regulation Jan 28 2008 Christoph Schmid Regulation of eukaryotic transcription:
More informationSuggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1]
1 Molecular evidence E Ulmus procera, form a genetically isolated clone. English Elms developed from a variety of elm brought to Britain from Rome in the first century A.D. Although English Elm trees make
More informationKAPA HiFi Real-Time PCR Library Amplification Kit
Technical Data Sheet KAPA HiFi Real-Time PCR Library Amplification Kit 1. Product Description High fidelity PCR is used to selectively enrich library fragments carrying appropriate adaptor sequences and
More informationNext Generation Sequencing Technologies
Next Generation Sequencing Technologies What is first generation? Sanger Sequencing DNA Polymerase Base-adding reaction +H + http://chemwiki.ucdavis.edu/organic_chemistry/organic_chemistry_with_a_biological_emphasis/chapter_10%3a_phosphoryl_transfer_reactions/section_10.4%3a_phosphate_diesters
More informationGlobin Block Modules for QuantSeq Instruction Manual
Globin Block Modules for QuantSeq Instruction Manual Catalog Numbers: 070 (RS-Globin Block, Homo sapiens, 96 rxn) 071 (RS-Globin Block, Sus scrofa, 96 rxn) 015 (QuantSeq 3 mrna-seq Library Prep Kit for
More informationRNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia
RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior
More informationGenome Reagent Kits v2 Quick Reference Cards
Chromium Genome Reagent Kits v2 Quick Reference Cards FOR USE WITH Chromium Genome Library Kit & Gel Bead Kit v2, 16 rxns PN-120258 Chromium Genome Chip Kit v2, 48 rxns PN-120257 Chromium i7 Multiplex
More informationRNA-Seq with the Tuxedo Suite
RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop The Basic Tuxedo Suite References Trapnell C, et al. 2009 TopHat: discovering splice junctions with
More informationNext Generation Sequencing. Target Enrichment
Next Generation Sequencing Target Enrichment Next Generation Sequencing Your Partner in Every Step from Sample to Data NGS: Revolutionizing Genetic Analysis with Single-Molecule Resolution Next generation
More informationSequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationSPRIworks Systems. Push button. Walk away. Fully automated library construction systems with built-in size selection and cleanup BR-15981B
SPRIworks Systems Fully automated library construction systems with built-in size selection and cleanup Push button. Walk away. BR-15981B SPRIworks Technology Fully automated fragment library construction
More informationEvaluating the Agilent 4200 TapeStation System for High Throughput Sequencing Quality Control
Evaluating the Agilent TapeStation System for High Throughput Sequencing Quality Control Application Note Nucleic Acid Analysis Authors Elisa Viering, Laura-Jane Behl, Stefan Pinkert, and Stephan Wolf
More information2100 Bioanalyzer. Overview & News. Ralph Beneke Dec 2010
2100 Bioanalyzer Overview & News Ralph Beneke Dec 2010 RNA QC in Gene Expression Workflows Cited in over 10,000 peer-reviewed papers RIN is the industry standard for RNA QC For any size and at low sample
More informationKAPA Library Amplification Kit Illumina Platforms
KAPA Library Amplification Kit KR0408 v7.17 This provides product information and a detailed protocol for the KAPA Library Amplification Kits. This documents applies to KAPA Library Amplification Kits
More informationIMGM Laboratories GmbH. Sales Manager
IMGM Laboratories GmbH Dr. Jennifer K. Kuhn Sales Manager About IMGM Laboratories IMGM Laboratories was founded in 2001 IMGM operates as professional provider of advanced genomic services from research
More informationLecture 3 Empirical Methods for Pricing. Jacob LaRiviere & Justin Rao
Lecture 3 Empirical Methods for Pricing Jacob LaRiviere & Justin Rao rich and precise competitors will respond Tools to measure demand often hold competitor behavior fixed. Price 1000 1500 2000
More informationTruSeq Enrichment Guide FOR RESEARCH USE ONLY
TruSeq Enrichment Guide FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY Catalog # FC-930-1012 Part # 15013230 Rev. E June 2011 TruSeq Enrichment Guide ii Notice Notice This document and its contents are proprietary
More informationIntroduction to Next Generation Sequencing (NGS)
Introduction to Next eneration Sequencing (NS) Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark 2012 Today 9.00-9.45: Introduction to NS, How it
More informationAdministration Division Public Works Department Anchorage: Performance. Value. Results.
Administration Division Anchorage: Performance. Value. Results. Mission Provide administrative, budgetary, fiscal, and personnel support to ensure departmental compliance with Municipal policies and procedures,
More informationRNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
More informationIllumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler
Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler Introduction David Horvath, M.S., Senior Applications Scientist, Beckman Coulter, Inc.; Tim Hill, Scientist,
More informationSUPPLEMENTARY MATERIAL AND METHODS
SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,
More informationAxygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand
Axygen AxyPrep Magnetic Bead Purification Kits A Corning Brand D Sample Prep Solutions for Genomics Obtaining Pure Nucleic Acids from Your Sample is Precious The purification of high quality DNA is the
More informationThe Agilent Technologies SureSelect Platform for Target Enrichment
The Agilent Technologies SureSelect Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Emily M. Leproust, Ph.D. Director Applications and Chemistry R&D Genomics Agenda: Introduction
More informationmeasuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
More informationHigh Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015
High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio
More informationA shotgun introduction to sequence assembly (with Velvet) MCB Brem, Eisen and Pachter
A shotgun introduction to sequence assembly (with Velvet) MCB 247 - Brem, Eisen and Pachter Hot off the press January 27, 2009 06:00 AM Eastern Time llumina Launches Suite of Next-Generation Sequencing
More informationJenny Gu, PhD Strategic Business Development Manager, PacBio
IDT and PacBio joint presentation Characterizing Alzheimer s Disease candidate genes and transcripts with targeted, long-read, single-molecule sequencing Jenny Gu, PhD Strategic Business Development Manager,
More informationSingle Cell 3 Reagent Kits v2 Quick Reference Cards
Chromium Single Cell 3 Reagent Kits v2 Quick Reference Cards FOR USE WITH Chromium Single Cell 3' Library & Gel Bead Kit v2, 16 rxns PN-120237 Chromium Single Cell 3' Library & Gel Bead Kit, 4 rxns PN-120267
More informationTruSeq Sample Preparation Best Practices and Troubleshooting Guide
TruSeq Sample Preparation Best Practices and Troubleshooting Guide FOR RESEARCH USE ONLY Introduction 3 Liquid Handling 4 RNA Handling 5 Master Mix Reagent Handling 6 AMPure XP Handling 7 Avoid Cross-Contamination
More informationMONITORING HEIFER PROGRAMS
MONITORING HEIFER PROGRAMS Greg Bethard, Ph.D. G&R Dairy Consulting, Inc. Wytheville, Virginia USA Introduction Dairy producers, nutritionists, veterinarians, and consultants have utilized dairy records
More informationFigure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.
Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out
More informationExeter s experience of trying to keep up with demand for NGS. Anna Bussell
Exeter s experience of trying to keep up with demand for NGS Anna Bussell Overview Sample received and DNA extracted Admin & test review NGS wet lab work Sequencing Report authorisation & distribution
More informationProcedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing
Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Before You Begin This document describes methods for generating barcoded PCR products
More informationRNAseq Differential Gene Expression Analysis Report
RNAseq Differential Gene Expression Analysis Report Customer Name: Institute/Company: Project: NGS Data: Bioinformatics Service: IlluminaHiSeq2500 2x126bp PE Differential gene expression analysis Sample
More informationKAPA Library Preparation Kits
Technical Data Sheet KAPA Library Preparation Kits Illumina series Product Description The KAPA Library Preparation Kit provides all of the enzymes and reaction buffers required for constructing libraries
More informationFull-length single-cell RNA-seq applied to a viral human. cancer: Applications to HPV expression and splicing analysis. Supplementary Information
Full-length single-cell RNA-seq applied to a viral human cancer: Applications to HPV expression and splicing analysis in HeLa S3 cells Liang Wu 1, Xiaolong Zhang 1,2, Zhikun Zhao 1,3,4, Ling Wang 5, Bo
More informationHuman genome sequence
NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion
More information