To sequence or not to sequence is not a question anymore. BUT

Size: px
Start display at page:

Download "To sequence or not to sequence is not a question anymore. BUT"

Transcription

1 To sequence or not to sequence is not a question anymore. BUT Vladimír Beneš 21 June

2 More data on their way to you! High GC High GC Low GC Low GC v3 flowcell imaged area larger by 50 %! v3 sequencing chemistry Some GC-rich clusters poorly resolved/not detected at very high densities Old Cluster Amplification Larger, brighter GC-rich clusters are well resolved and detected at very high densities New Cluster Amplification

3 Increasing yield Sequence output from Illumina reads per lane Millions of reads PF Illumina Arrives 0.3 GAII GAIIx SCS 2.8, cbot, v5 kits SCS2.6, v4 kits May 08 Jun 08 Jul 08 Aug 08 Sep 08 Oct 08 Nov 08 Dec 08 Jan 09 Feb 09 Mar 09 Apr 09 May 09 Jun 09 Jul 09 Aug 09 Sept 09 Oct 09 Nov 09 Dec 09 Jan 10 Feb 10 Mar 10 Apr 10 May 10 June 10 July 10 Aug 10 Sept 10 Oct 10 Nov 10 Dec 10 Jan 11 Feb 11 Mar 11 April 11 May 11 June 11 GA HiSeq2000

4 Improving quality of called bases Average quality per cycle, RNA-Seq Quality score Cycle 36 Base mrnaseq 76 Base mrnaseq 76 Base V4 mrnaseq 105 Base V4 mrnaseq 76 Base V5 mrnaseq v5105 s_6 s7 V5 s8 v5 TruSeq 150 R1 TruSeq 150 R2

5 Challenges The only thing constant in life is change Distorted expectations of users Data ( massive amounts, formats ) Interpretation of results (suboptimal experimental design; is everything relevant?) Incomplete understanding of sources of error and bias in MPS data

6 Bias is never good

7

8 Hype/hope curve

9 MPS space PNAS (2010) Kahvejian, Nat Biotech (2008)

10 Available MPS applications transcriptome RNA-Seq, Tag-Seq mirnome smallrna-seq protein-na interactions ChIP-Seq, CLIP-Seq epigenome Methyl-Seq de novo & re-sequencing Metagenomics Genome capture, multiplexing yes yes yes yes yes yes yes

11 MPS methods used in epigenomics Rada-Iglesias & Wysocka, Genome Medicine (2011)

12 Portela & Esteller, Nature Biotechnology (2011)

13 Importance of experimental design What do I want to study? "Would you tell me, please, which way I ought to go from here?" "That depends a good deal on where you want to get to," said the Cat. "I don t much care where--" said Alice. "Then it doesn t matter which way you go," said the Cat. "--so long as I get SOMEWHERE," Alice added as an explanation. "Oh, you re sure to do that," said the Cat, "if you only walk long enough. Lewis Carroll s Alice in Wonderland

14 Which sequencing mode to use? Sequencing type Exon capture Whole genome sequencing Recommendation 50Mb Kit, human: 105b SR to get sufficient coverage Large rearrangements: Mate-pairs large insert Resequencing: SNPs/indels: Coverage is good 100+ PE. If you don t get the coverage at the start you ll regret it. Coverage is the key! RNA-Seq Chip-Seq Multiplexing Tag counting: large number of mappable tags 36-50b SR should suffice. Longer reads may need to be trimmed to match exons. Transcriptome assembly or exon usage: 75+ single or 75+ PE depending on a de novo/spliced read mapping approach or map pairs to detect also alternative splicing. Strand-specific libraries: complex insight into transcriptome 36b SR unless you have real concerns about alignability of your target (i.e. some strange looking enhancer region) Coverage is the key!

15 MPS workflow 1) Library preparation 2) Cluster generation on a flow cell SE, PE reads, bases 3) Sequencing & imaging 4) Data processing & analysis

16 MPS library preparation 5 AATGATACGGCGACCACCGA-ACACTCTTTCCCTACACGACGCTCTTCCGATCT--INSERT--TCGTATGCCGTCTTCTGCTTG TTACTATGCCGCTGGTGGCT-TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA--INSERT--AGCATACGGCAGAAGACGAAC5 where 5 AATGATACGGCGACCACCGA 5 CAAGCAGAAGACGGCATACGA is the P5 attachment/amplification primer sequence is the P7 attachment/amplification primer sequence 5 ACACTCTTTCCCTACACGACGCTCTTCCGATCT is the SBS3 sequencing primer sequence INSERT is a complex mix of DNA fragments

17 Forked adapters A Insert Insert A Adapter ACACTCTTTCCCTACACGAC TCGTATGCCGTCTTCTGCTTG GCTCTTCCGAT C T P- GATCGGAAGAGC CGAGAAGGCTA G -P T CTAGCCTTCTCG GTTCGTCTTCTGCCGTATGCT CAGCACATCCCTTTCTCACA Adapter

18 Library preparation II. A conventional protocol A nextera protocol at least 500 ng of gdna <50 ng of gdna! Adey et al., Genome Biology (2010)

19 Library preparation III. Strict QC of starting material (GiGo) Qubit quantification gel images, bioanalyzer/experion traces

20 Library preparation IV. Bioruptor, probe (ChIP-Seq) Covaris vs nebulization Kits (proprietary, home-brewed, NEB!) Size selection using gel extractor, E- gel, Pippin prep, SPRIworks, Lo-bind tubes! Covaris Hydroshear

21 RNA-Seq libraries rrna depletion (oligo-dt beads, Ribo-Minus, Ribo-Zero ) BUT mitochondria-derived rrna mostly ignored!!? 18S 28S 10: RiboMinus (UHRR) prep 2 3. RiboZero (UHRR) Anu 10/12/09 #3 Both from Experiment 357;run 10/13/09 strand-specific library, Levine et al., Nat Meth (2010)

22

23

24 Library quantification & QC Qubit Bioanalyzer HS DNA Chip DNA 1000 Chip

25 Methyl-Seq Carey et al., Drug Discovery Today (2011) Zilbermann & Henikoff, Development (2007)

26 Pacific Biosciences Detection volume Modified bases By courtesy of Pacific Bioscience

27 Direct detection of methylated bases Flusberg et al. Nature Methods (2010)

28 Data integration Pepke et al., Nature Methods (2009)

29 Where are we heading?

30 Nucleic acids detection and sequencing techniques Kahvejian et al., Nat Biotech (2008)

31 Caution required available information (clues) amount state of our knowledge (answers) time We are drowning in information and starving for knowledge. Rutherford D. Roger

32 MPS features Unprecedented discovery power Hypothesis-free Almost unbiased results Sensitivity & specificity For tag-counting applications truly wholegenome, -transcriptome, -methylome view Only one source of technology noise

33 Acknowledgments Bettina Haase Dinko Pavlinic Jens Stolte Jonathon Blake Tobias Rausch Jürgen Have Zimmermann a nice day! All our users and former colleagues Science is built with facts as a house is with stones, but a collection of facts is no more a science than a heap of stones is a house. Jules Henri Poincare

Considerations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center

Considerations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center Considerations for Illumina library preparation Henriette O Geen June 20, 2014 UCD Genome Center Diversity of applications De novo genome Sequencing ranscriptome Expression Splice Isoform bundance Genotyping

More information

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation

More information

Introductory Next Gen Workshop

Introductory Next Gen Workshop Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview

More information

Analysis of Differential Gene Expression in Cattle Using mrna-seq

Analysis of Differential Gene Expression in Cattle Using mrna-seq Analysis of Differential Gene Expression in Cattle Using mrna-seq mrna-seq A rough guide for green horns Animal and Grassland Research and Innovation Centre Animal and Bioscience Research Department Teagasc,

More information

ACCEL-NGS 2S DNA LIBRARY KITS

ACCEL-NGS 2S DNA LIBRARY KITS ACCEL-NGS 2S DNA LIBRARY KITS Accel-NGS 2S DNA Library Kits produce high quality libraries with an all-inclusive, easy-to-use format. The kits contain all reagents necessary to build high complexity libraries

More information

Introduction Bioo Scientific

Introduction Bioo Scientific Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior

More information

MiSeq. system applications

MiSeq. system applications MiSeq system applications Choose your application. Load, and go. Focused power. Speed and simplicity for targeted and small-genome sequencing. Optimized sample preparation kits, push-button sequencing,

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

Bioinformatics Advice on Experimental Design

Bioinformatics Advice on Experimental Design Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics

More information

How much sequencing do I need? Emily Crisovan Genomics Core

How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?

More information

A Genomics (R)evolution: Harnessing the Power of Single Cells

A Genomics (R)evolution: Harnessing the Power of Single Cells A Genomics (R)evolution: Harnessing the Power of Single Cells Fundamental Question #1 If Transcriptional Heterogeneity ( Noise ) is so great in single cells What s the Point? Single Cells = True Biology

More information

NEBNext. for Ion Torrent LIBRARY PREPARATION KITS

NEBNext. for Ion Torrent LIBRARY PREPARATION KITS NEBNext for Ion Torrent LIBRARY PREPARATION KITS NEBNEXT PRODUCTS FOR ION TORRENT Table of Contents 3 General Introduction 4 5 6 6 7 8 DNA Library Preparation Workflow Product Selection Product Details

More information

Introduction to RNA-Seq

Introduction to RNA-Seq Introduction to RNA-Seq Monica Britton, Ph.D. Sr. Bioinformatics Analyst March 2015 Workshop Overview of RNA-Seq Activities RNA-Seq Concepts, Terminology, and Work Flows Using Single-End Reads and a Reference

More information

Implementation of Automated Sample Quality Control in Whole Exome Sequencing

Implementation of Automated Sample Quality Control in Whole Exome Sequencing Journal of Life Sciences 11 (2017) 261-268 doi: 10.17265/1934-7391/2017.06.001 D DAVID PUBLISHING Implementation of Automated Sample Quality Control in Whole Exome Sequencing Elisa Viering 1, Jana Molitor

More information

Next-Generation Sequencing. Technologies

Next-Generation Sequencing. Technologies Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062

More information

Incorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits

Incorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing

More information

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality

More information

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow

More information

i5 Dual Indexing Add-on Kit for QuantSeq/SENSE for Illumina Instruction Manual

i5 Dual Indexing Add-on Kit for QuantSeq/SENSE for Illumina Instruction Manual i5 Dual Indexing Add-on Kit for QuantSeq/SENSE for Illumina Instruction Manual Catalog Numbers: 001 (SENSE mrna-seq Library Prep Kit V2 for Illumina) 009 (SENSE Total RNA-Seq Library Prep Kit for Illumina)

More information

DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)

DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,

More information

Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep

Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS LIBRARY PREP FOR NEXT GEN SEQUENCING PROTEIN EXPRESSION &

More information

DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)

DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,

More information

Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017

Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017 Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA

More information

Lab methods: Exome / Genome. Ewart de Bruijn

Lab methods: Exome / Genome. Ewart de Bruijn Lab methods: Exome / Genome 27 06 2013 Ewart de Bruijn Library prep is only a small part of the complete DNA analysis workflow DNA isolation library prep enrichment flowchip prep sequencing bioinformatics

More information

Single Cell Genomics

Single Cell Genomics Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell

More information

Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales

Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology

More information

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data

More information

Research school methods seminar Genomics and Transcriptomics

Research school methods seminar Genomics and Transcriptomics Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence

More information

Differential gene expression analysis using RNA-seq

Differential gene expression analysis using RNA-seq https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, August 2017 Friederike Dündar with Luce Skrabanek & Ceyda Durmaz Day 1: Introduction into high-throughput

More information

RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)

RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information

More information

Cancer Genetics Solutions

Cancer Genetics Solutions Cancer Genetics Solutions Cancer Genetics Solutions Pushing the Boundaries in Cancer Genetics Cancer is a formidable foe that presents significant challenges. The complexity of this disease can be daunting

More information

Efficiency in Next-Generation Sequencing for Public Health

Efficiency in Next-Generation Sequencing for Public Health Efficiency in Next-Generation Sequencing for Public Health Patrick Van Roey June 27, 2016 June 27, 2016 2 Overview Introduction Applied Genomic Technologies Core Implementing NGS for Public Health NGS

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible)

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible) NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents

More information

Electric Forward Market Report

Electric Forward Market Report Mar-01 Mar-02 Jun-02 Sep-02 Dec-02 Mar-03 Jun-03 Sep-03 Dec-03 Mar-04 Jun-04 Sep-04 Dec-04 Mar-05 May-05 Aug-05 Nov-05 Feb-06 Jun-06 Sep-06 Dec-06 Mar-07 Jun-07 Sep-07 Dec-07 Apr-08 Jun-08 Sep-08 Dec-08

More information

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow

More information

Next Generation Sequencing: An Overview

Next Generation Sequencing: An Overview Next Generation Sequencing: An Overview Cavan Reilly November 13, 2017 Table of contents Next generation sequencing NGS and microarrays Study design Quality assessment Burrows Wheeler transform Next generation

More information

HiSeqTM 2000 Sequencing System

HiSeqTM 2000 Sequencing System IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance

More information

RADSeq Data Analysis. Through STACKS on Galaxy. Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé

RADSeq Data Analysis. Through STACKS on Galaxy. Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé RADSeq Data Analysis Through STACKS on Galaxy Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé RAD sequencing: next-generation tools for an old problem INTRODUCTION source: Karim Gharbi

More information

INTRODUCCIÓ A LES TECNOLOGIES DE 'NEXT GENERATION SEQUENCING'

INTRODUCCIÓ A LES TECNOLOGIES DE 'NEXT GENERATION SEQUENCING' INTRODUCCIÓ A LES TECNOLOGIES DE 'NEXT GENERATION SEQUENCING' Bioinformàtica per a la Recerca Biomèdica Ricardo Gonzalo Sanz ricardo.gonzalo@vhir.org 14/12/2016 1. Introduction to NGS 2. First Generation

More information

Data Analysis with CASAVA v1.8 and the MiSeq Reporter

Data Analysis with CASAVA v1.8 and the MiSeq Reporter Data Analysis with CASAVA v1.8 and the MiSeq Reporter Eric Smith, PhD Bioinformatics Scientist September 15 th, 2011 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense

More information

De Novo Assembly of High-throughput Short Read Sequences

De Novo Assembly of High-throughput Short Read Sequences De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

NGS: Digital RNAseq & Library Prep Seminar. Next-Generation Sequencing Lunch & Learn

NGS: Digital RNAseq & Library Prep Seminar. Next-Generation Sequencing Lunch & Learn NGS: Digital RNAseq & Library Prep Seminar Next-Generation Sequencing Lunch & Learn Samuel Rulli, Ph. D Global Product Manager QIAseq Targeted RNA Panels 1 Targeted sequencing with UMIs QIAseq mirnaseq

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies. D. Puthier 2012

Introduction to transcriptome analysis using High Throughput Sequencing technologies. D. Puthier 2012 Introduction to transcriptome analysis using High Throughput Sequencing technologies D. Puthier 2012 A typical RNA-Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

DNA-Sequencing. Technologies & Devices

DNA-Sequencing. Technologies & Devices DNA-Sequencing Technologies & Devices Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day, 850 nt reads 2 Mb/day, 550 nt reads Roche/454 GS FLX 12/2006 800 Mb/23h, 800 nt reads

More information

"Expanded applications for NGS library prep exploring rapid workflows with Nextera and challenging RNA samples"

Expanded applications for NGS library prep exploring rapid workflows with Nextera and challenging RNA samples "Expanded applications for NGS library prep exploring rapid workflows with Nextera and challenging RNA samples" Todd Deppe Sample Prep Specialist Regional Marketing UCR Feb 11, 2014 2013 Illumina, Inc.

More information

TECHNICAL BULLETIN. SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies. Catalog Number SEQX Storage Temperature 20 C

TECHNICAL BULLETIN. SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies. Catalog Number SEQX Storage Temperature 20 C SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies Catalog Number SEQX Storage Temperature 20 C TECHNICAL BULLETIN Product Description The SeqPlex DNA Amplification Kit

More information

Genome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias

Genome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias Genome Sequencing I: Methods MMG 835, SPRING 2016 Eukaryotic Molecular Genetics George I. Mias Department of Biochemistry and Molecular Biology gmias@msu.edu Sequencing Methods Cost of Sequencing Wetterstrand

More information

TruSeq Nano DNA Library Prep Protocol Guide

TruSeq Nano DNA Library Prep Protocol Guide TruSeq Nano DNA Library Prep Protocol Guide For Research Use Only. Not for use in diagnostic procedures. Fragment DNA 3 Repair Ends and Select Library Size 5 Adenylate 3ʹ Ends 7 Ligate Adapters 8 Enrich

More information

RNA-Seq Software, Tools, and Workflows

RNA-Seq Software, Tools, and Workflows RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:

More information

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

More information

Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform

Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 2 Sample Prep Workflow, 3 Best Practices, 4 DNA Input Recommendations, 6

More information

Hybridization capture of DNA libraries using xgen Lockdown Probes and Reagents

Hybridization capture of DNA libraries using xgen Lockdown Probes and Reagents Hybridization capture of DNA libraries using xgen Lockdown Probes and Reagents For use with: llumina TruSeq adapter ligated libraries xgen Universal Blockers TS Mix (Catalog # 1075474, 1075475, 1075476)

More information

Mate-pair library data improves genome assembly

Mate-pair library data improves genome assembly De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate

More information

Targeted Sequencing in the NBS Laboratory

Targeted Sequencing in the NBS Laboratory Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

MHC Region. MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells

MHC Region. MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells DNA based HLA typing methods By: Yadollah Shakiba, MD, PhD MHC Region MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells Nomenclature of HLA Alleles Assigned

More information

Product selection guide Ion S5 and Ion S5 XL Systems

Product selection guide Ion S5 and Ion S5 XL Systems Product selection guide Ion S5 and s Cancer genomics research Molecular profiling Ion AmpliSeq Ready-to-Use Panels Ion AmpliSeq Comprehensive Cancer Panel Cat. No. 4477685 Ion AmpliSeq Made-to-Order Panels

More information

DNA-Sequenzierung. Technologien & Geräte

DNA-Sequenzierung. Technologien & Geräte DNA-Sequenzierung Technologien & Geräte Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day, 850 nt reads 2 Mb/day, 550 nt reads Roche/454 GS FLX 12/2006 400 Mb/7h, 350 nt reads

More information

Regulation of eukaryotic transcription:

Regulation of eukaryotic transcription: Promoter definition by mass genome annotation data: in silico primer extension EMBNET course Bioinformatics of transcriptional regulation Jan 28 2008 Christoph Schmid Regulation of eukaryotic transcription:

More information

Suggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1]

Suggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1] 1 Molecular evidence E Ulmus procera, form a genetically isolated clone. English Elms developed from a variety of elm brought to Britain from Rome in the first century A.D. Although English Elm trees make

More information

KAPA HiFi Real-Time PCR Library Amplification Kit

KAPA HiFi Real-Time PCR Library Amplification Kit Technical Data Sheet KAPA HiFi Real-Time PCR Library Amplification Kit 1. Product Description High fidelity PCR is used to selectively enrich library fragments carrying appropriate adaptor sequences and

More information

Next Generation Sequencing Technologies

Next Generation Sequencing Technologies Next Generation Sequencing Technologies What is first generation? Sanger Sequencing DNA Polymerase Base-adding reaction +H + http://chemwiki.ucdavis.edu/organic_chemistry/organic_chemistry_with_a_biological_emphasis/chapter_10%3a_phosphoryl_transfer_reactions/section_10.4%3a_phosphate_diesters

More information

Globin Block Modules for QuantSeq Instruction Manual

Globin Block Modules for QuantSeq Instruction Manual Globin Block Modules for QuantSeq Instruction Manual Catalog Numbers: 070 (RS-Globin Block, Homo sapiens, 96 rxn) 071 (RS-Globin Block, Sus scrofa, 96 rxn) 015 (QuantSeq 3 mrna-seq Library Prep Kit for

More information

RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia

RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior

More information

Genome Reagent Kits v2 Quick Reference Cards

Genome Reagent Kits v2 Quick Reference Cards Chromium Genome Reagent Kits v2 Quick Reference Cards FOR USE WITH Chromium Genome Library Kit & Gel Bead Kit v2, 16 rxns PN-120258 Chromium Genome Chip Kit v2, 48 rxns PN-120257 Chromium i7 Multiplex

More information

RNA-Seq with the Tuxedo Suite

RNA-Seq with the Tuxedo Suite RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop The Basic Tuxedo Suite References Trapnell C, et al. 2009 TopHat: discovering splice junctions with

More information

Next Generation Sequencing. Target Enrichment

Next Generation Sequencing. Target Enrichment Next Generation Sequencing Target Enrichment Next Generation Sequencing Your Partner in Every Step from Sample to Data NGS: Revolutionizing Genetic Analysis with Single-Molecule Resolution Next generation

More information

Sequence Assembly and Alignment. Jim Noonan Department of Genetics

Sequence Assembly and Alignment. Jim Noonan Department of Genetics Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome

More information

High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014

High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion

More information

SPRIworks Systems. Push button. Walk away. Fully automated library construction systems with built-in size selection and cleanup BR-15981B

SPRIworks Systems. Push button. Walk away. Fully automated library construction systems with built-in size selection and cleanup BR-15981B SPRIworks Systems Fully automated library construction systems with built-in size selection and cleanup Push button. Walk away. BR-15981B SPRIworks Technology Fully automated fragment library construction

More information

Evaluating the Agilent 4200 TapeStation System for High Throughput Sequencing Quality Control

Evaluating the Agilent 4200 TapeStation System for High Throughput Sequencing Quality Control Evaluating the Agilent TapeStation System for High Throughput Sequencing Quality Control Application Note Nucleic Acid Analysis Authors Elisa Viering, Laura-Jane Behl, Stefan Pinkert, and Stephan Wolf

More information

2100 Bioanalyzer. Overview & News. Ralph Beneke Dec 2010

2100 Bioanalyzer. Overview & News. Ralph Beneke Dec 2010 2100 Bioanalyzer Overview & News Ralph Beneke Dec 2010 RNA QC in Gene Expression Workflows Cited in over 10,000 peer-reviewed papers RIN is the industry standard for RNA QC For any size and at low sample

More information

KAPA Library Amplification Kit Illumina Platforms

KAPA Library Amplification Kit Illumina Platforms KAPA Library Amplification Kit KR0408 v7.17 This provides product information and a detailed protocol for the KAPA Library Amplification Kits. This documents applies to KAPA Library Amplification Kits

More information

IMGM Laboratories GmbH. Sales Manager

IMGM Laboratories GmbH. Sales Manager IMGM Laboratories GmbH Dr. Jennifer K. Kuhn Sales Manager About IMGM Laboratories IMGM Laboratories was founded in 2001 IMGM operates as professional provider of advanced genomic services from research

More information

Lecture 3 Empirical Methods for Pricing. Jacob LaRiviere & Justin Rao

Lecture 3 Empirical Methods for Pricing. Jacob LaRiviere & Justin Rao Lecture 3 Empirical Methods for Pricing Jacob LaRiviere & Justin Rao rich and precise competitors will respond Tools to measure demand often hold competitor behavior fixed. Price 1000 1500 2000

More information

TruSeq Enrichment Guide FOR RESEARCH USE ONLY

TruSeq Enrichment Guide FOR RESEARCH USE ONLY TruSeq Enrichment Guide FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY Catalog # FC-930-1012 Part # 15013230 Rev. E June 2011 TruSeq Enrichment Guide ii Notice Notice This document and its contents are proprietary

More information

Introduction to Next Generation Sequencing (NGS)

Introduction to Next Generation Sequencing (NGS) Introduction to Next eneration Sequencing (NS) Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark 2012 Today 9.00-9.45: Introduction to NS, How it

More information

Administration Division Public Works Department Anchorage: Performance. Value. Results.

Administration Division Public Works Department Anchorage: Performance. Value. Results. Administration Division Anchorage: Performance. Value. Results. Mission Provide administrative, budgetary, fiscal, and personnel support to ensure departmental compliance with Municipal policies and procedures,

More information

RNA-Sequencing analysis

RNA-Sequencing analysis RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges

More information

Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler

Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler Introduction David Horvath, M.S., Senior Applications Scientist, Beckman Coulter, Inc.; Tim Hill, Scientist,

More information

SUPPLEMENTARY MATERIAL AND METHODS

SUPPLEMENTARY MATERIAL AND METHODS SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,

More information

Axygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand

Axygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand Axygen AxyPrep Magnetic Bead Purification Kits A Corning Brand D Sample Prep Solutions for Genomics Obtaining Pure Nucleic Acids from Your Sample is Precious The purification of high quality DNA is the

More information

The Agilent Technologies SureSelect Platform for Target Enrichment

The Agilent Technologies SureSelect Platform for Target Enrichment The Agilent Technologies SureSelect Platform for Target Enrichment Focus your next-gen sequencing on DNA that matters Emily M. Leproust, Ph.D. Director Applications and Chemistry R&D Genomics Agenda: Introduction

More information

measuring gene expression December 5, 2017

measuring gene expression December 5, 2017 measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA

More information

High Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015

High Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015 High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio

More information

A shotgun introduction to sequence assembly (with Velvet) MCB Brem, Eisen and Pachter

A shotgun introduction to sequence assembly (with Velvet) MCB Brem, Eisen and Pachter A shotgun introduction to sequence assembly (with Velvet) MCB 247 - Brem, Eisen and Pachter Hot off the press January 27, 2009 06:00 AM Eastern Time llumina Launches Suite of Next-Generation Sequencing

More information

Jenny Gu, PhD Strategic Business Development Manager, PacBio

Jenny Gu, PhD Strategic Business Development Manager, PacBio IDT and PacBio joint presentation Characterizing Alzheimer s Disease candidate genes and transcripts with targeted, long-read, single-molecule sequencing Jenny Gu, PhD Strategic Business Development Manager,

More information

Single Cell 3 Reagent Kits v2 Quick Reference Cards

Single Cell 3 Reagent Kits v2 Quick Reference Cards Chromium Single Cell 3 Reagent Kits v2 Quick Reference Cards FOR USE WITH Chromium Single Cell 3' Library & Gel Bead Kit v2, 16 rxns PN-120237 Chromium Single Cell 3' Library & Gel Bead Kit, 4 rxns PN-120267

More information

TruSeq Sample Preparation Best Practices and Troubleshooting Guide

TruSeq Sample Preparation Best Practices and Troubleshooting Guide TruSeq Sample Preparation Best Practices and Troubleshooting Guide FOR RESEARCH USE ONLY Introduction 3 Liquid Handling 4 RNA Handling 5 Master Mix Reagent Handling 6 AMPure XP Handling 7 Avoid Cross-Contamination

More information

MONITORING HEIFER PROGRAMS

MONITORING HEIFER PROGRAMS MONITORING HEIFER PROGRAMS Greg Bethard, Ph.D. G&R Dairy Consulting, Inc. Wytheville, Virginia USA Introduction Dairy producers, nutritionists, veterinarians, and consultants have utilized dairy records

More information

Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.

Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out

More information

Exeter s experience of trying to keep up with demand for NGS. Anna Bussell

Exeter s experience of trying to keep up with demand for NGS. Anna Bussell Exeter s experience of trying to keep up with demand for NGS Anna Bussell Overview Sample received and DNA extracted Admin & test review NGS wet lab work Sequencing Report authorisation & distribution

More information

Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing

Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Before You Begin This document describes methods for generating barcoded PCR products

More information

RNAseq Differential Gene Expression Analysis Report

RNAseq Differential Gene Expression Analysis Report RNAseq Differential Gene Expression Analysis Report Customer Name: Institute/Company: Project: NGS Data: Bioinformatics Service: IlluminaHiSeq2500 2x126bp PE Differential gene expression analysis Sample

More information

KAPA Library Preparation Kits

KAPA Library Preparation Kits Technical Data Sheet KAPA Library Preparation Kits Illumina series Product Description The KAPA Library Preparation Kit provides all of the enzymes and reaction buffers required for constructing libraries

More information

Full-length single-cell RNA-seq applied to a viral human. cancer: Applications to HPV expression and splicing analysis. Supplementary Information

Full-length single-cell RNA-seq applied to a viral human. cancer: Applications to HPV expression and splicing analysis. Supplementary Information Full-length single-cell RNA-seq applied to a viral human cancer: Applications to HPV expression and splicing analysis in HeLa S3 cells Liang Wu 1, Xiaolong Zhang 1,2, Zhikun Zhao 1,3,4, Ling Wang 5, Bo

More information

Human genome sequence

Human genome sequence NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion

More information