Next Generation Sequencing. Simon Rasmussen Assistant Professor Center for Biological Sequence analysis Technical University of Denmark
|
|
- Cathleen Wood
- 6 years ago
- Views:
Transcription
1 Next eneration Sequencing Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark
2 DNA Sequencing DNA sequencing Reading the order of bases in DNA fragments
3 Why NS? Transforming how we are doing biological science (and bioinformatics)
4 1st generation to NS 1,000,000,000 Single molecule? Pac Bio Kilobases per day per machine 100,000,000 10,000,000 1,000, , ,000 1, el-based systems Manual slab gel Automated slab gel Massively parallel sequencing apillary sequencing irst-generation capillary Microwell pyrosequencing Second-generation capillary sequencer Short-read sequencers Ion Torrent Illumina Solid Year uture Sanger hain-termination method Stratton et al., Nature 2009
5 Important feature: Output 1st Sanger: >800nt, very low Illumina: nt, 25b/day 2nd Roche 454: nt, 1b/day ABI Solid: 35, 60, 75nt, 10-15b/day 3rd Ion Torrent: nt, 10Mb-1b/chip Pacific Biosciences: 1300nt, 45Mb/chip
6 Important feature: Output 1st Sanger: >800nt, very low 1 machine pr. day: Illumina: nt, 25b/day 1 X 10 X 2nd Roche 454: nt, 1b/day ABI Solid: 35, 60, 75nt, 10-15b/day 3rd Ion Torrent: nt, 10Mb-1b/chip Pacific Biosciences: 1300nt, 45Mb/chip
7 Important feature: Output 1st Sanger: >800nt, very low 1 machine pr. day: Illumina: nt, 25b/day 1 X 10 X 2nd Roche 454: nt, 1b/day ABI Solid: 35, 60, 75nt, 10-15b/day 3rd Ion Torrent: nt, 10Mb-1b/chip Pacific Biosciences: 1300nt, 45Mb/chip
8 Important feature: Output 1st Sanger: >800nt, very low 1 machine pr. day: Illumina: nt, 25b/day 1 X 10 X 2nd Roche 454: nt, 1b/day ABI Solid: 35, 60, 75nt, 10-15b/day 3rd Ion Torrent: nt, 10Mb-1b/chip Pacific Biosciences: 1300nt, 45Mb/chip BI, based in hina, is the world s largest genomics research institute, with 167 DNA sequencers producing the equivalent of 2,000 human genomes a day.
9 Important reason: ost Drop in costs is faster than Moore s Law (omputer power doubles every 2 years)
10 Expensive storage Highest cost is (almost) not the sequencing but storage and analysis A standard human whole-genome sequencing exp. would create 200 b of data
11 Human sequencing irst draft genome of human in 2001, final 2004 Estimated costs $3 billion, time 13 years Today: Illumina: 1 week, 4000$ Exome: 6 weeks*, $998 * Real-time, not machine-time
12 How it works
13 irst generation: Sanger (dye) ragment DNA lone into plasmid and amplify Sequence using dntp + labelled ddntps (stops reaction) Run capillary electrophoresis and read DNA code Low output, long reads (~ nt), high quality
14 Next generation (2nd) ragment DNA Add adaptors (where primers can bind) and amplify, DNA amplification (empr, bridgepr) Immobilize single strand DNA to surface Perform sequencing by polymerase of the 2nd strand Detect nucleotides incorporated using fluorescence
15 2: Amplification and immobilization Emulsion PR (454, Solid): Water, oil, beads, one DNA template/droplet Bridge PR (Illumina): One DNA template/cluster, primers on surface, grow by bridging primers Metzker, Naten Rev. 2010
16 2: luorescence detection REVIEWS Illumina - yclic reversible termination Pyrosequencing a Illumina/Solexa Reversible terminators A T A T c Helicos BioSciences Reversible terminators Add all dntps Incorporate all four nucleotides, each label with a different dye labelled w. diff dye T A A T Incorporate single, dye-labelled nucleotides Load template beads into wells reate fourcolor image Wash, fourcolour imaging T A T Wash, onecolour imaging low one dntp across wells Polymerase incorporates nucleotide leave dye and repeat next cycle leave dye and terminating groups, wash T A T leave dye and inhibiting groups, cap, wash Release of PPi leads to light b Repeat cycles d Imaging, next Repeat cycles dntp Metzker, Naten Rev T A
17 groups, wash groups, cap, wash 2: Imaging handout Repeat cycles Repeat b d Illumina 1: T A Illumina 2: T A T A Top: ATT Bottom: Top: Bottom: TAT ATA One-base-encoded probe An oligonucleotide sequence in which one interrogation base is associated with a particular igure 2 our-colour and one-colour cyclic reversible termination methods. a The four-colour cyclic termination (RT) method uses Illumina/Solexa s 3 -O-azidomethyl reversible terminator chemistry 23,101 (B solid-phase-amplified template clusters (I. 1b, shown as single templates for illustrative purposes). ollo imaging, a cleavage step removes the fluorescent dyes and regenerates the 3 -OH group using the reduci tris(2-carboxyethyl)phosphine (TEP) 23. b The four-colour images highlight the sequencing data from tw amplified templates. c Unlike Illumina/Solexa s terminators, 454: the Helicos Virtual Terminators 33 are labelled same dye and dispensed individually in a predetermined order, analogous to a single-nucleotide addition ollowing total internal reflection fluorescence imaging, a cleavage step removes the fluorescent dye and groups using TEP to permit the addition of the next y5-2 -deoxyribonucleoside triphosphate (dntp) an free sulphhydryl groups are then capped with iodoacetamide before the next nucleotide addition 33 (step d The one-colour images highlight the sequencing data from two single-molecule templates. Metzker, Naten Rev. 2010
18 groups, wash groups, cap, wash 2: Imaging handout - answers Repeat cycles Repeat b d T A T A T A Top: ATT Bottom: Top: Bottom: TAT ATA One-base-encoded probe An oligonucleotide sequence in which one interrogation base is associated with a particular igure 2 our-colour and one-colour cyclic reversible termination methods. a The four-colour cyclic termination (RT) method uses Illumina/Solexa s 3 -O-azidomethyl reversible terminator chemistry 23,101 (B solid-phase-amplified template clusters (I. 1b, shown as single templates for illustrative purposes). ollo imaging, a cleavage step removes the fluorescent dyes and regenerates the 3 -OH group using the reduci tris(2-carboxyethyl)phosphine (TEP) 23. b The four-colour images highlight the sequencing data from tw amplified templates. c Unlike Illumina/Solexa s terminators, the Helicos Virtual Terminators 33 are labelled same dye and dispensed individually in a predetermined order, analogous to a single-nucleotide addition ollowing total internal reflection fluorescence imaging, a cleavage step removes the fluorescent dye and groups using TEP to permit the addition of the next y5-2 -deoxyribonucleoside triphosphate (dntp) an free sulphhydryl groups are then capped with iodoacetamide before the next nucleotide addition 33 (step d The one-colour images highlight the sequencing data from two single-molecule templates. Metzker, Naten Rev. 2010
19 groups, wash groups, cap, wash 2: Imaging handout - answers Repeat cycles Repeat b d T A Quality of base call deteriorates after many T A cycles (eg. 75 cycles) T A Top: ATT Bottom: Top: Bottom: TAT ATA One-base-encoded probe An oligonucleotide sequence in which one interrogation base is associated with a particular igure 2 our-colour and one-colour cyclic reversible termination methods. a The four-colour cyclic termination (RT) method uses Illumina/Solexa s 3 -O-azidomethyl reversible terminator chemistry 23,101 (B solid-phase-amplified template clusters (I. 1b, shown as single templates for illustrative purposes). ollo imaging, a cleavage step removes the fluorescent dyes and regenerates the 3 -OH group using the reduci tris(2-carboxyethyl)phosphine (TEP) 23. b The four-colour images highlight the sequencing data from tw amplified templates. c Unlike Illumina/Solexa s terminators, the Helicos Virtual Terminators 33 are labelled same dye and dispensed individually in a predetermined order, analogous to a single-nucleotide addition ollowing total internal reflection fluorescence imaging, a cleavage step removes the fluorescent dye and groups using TEP to permit the addition of the next y5-2 -deoxyribonucleoside triphosphate (dntp) an free sulphhydryl groups are then capped with iodoacetamide before the next nucleotide addition 33 (step d The one-colour images highlight the sequencing data from two single-molecule templates. Metzker, Naten Rev. 2010
20 groups, wash groups, cap, wash 2: Imaging handout - answers Repeat cycles Repeat b d T A Quality of base call deteriorates after many T A cycles (eg. 75 cycles) T A Top: ATT Bottom: Top: Bottom: TAT ATA One-base-encoded probe An oligonucleotide sequence in which one interrogation base is associated with a particular igure 2 our-colour and one-colour cyclic reversible termination methods. a The four-colour cyclic termination (RT) method uses Illumina/Solexa s 3 -O-azidomethyl reversible terminator chemistry 23,101 (B solid-phase-amplified template clusters (I. 1b, shown as single templates for illustrative purposes). ollo imaging, a cleavage step removes the fluorescent dyes and regenerates the 3 -OH group using the reduci tris(2-carboxyethyl)phosphine (TEP) 23. b The four-colour images highlight the sequencing data from tw Homopolymer runs are amplified templates. c Unlike Illumina/Solexa s terminators, the Helicos Virtual Terminators 33 labelled same dye and dispensed individually in a predetermined problematic, order, analogous to a gives single-nucleotide rise to addition ollowing total internal reflection fluorescence imaging, a cleavage step removes the fluorescent dye and groups using TEP to permit the addition of the next y5-2 -deoxyribonucleoside indels triphosphate (dntp) an free sulphhydryl groups are then capped with iodoacetamide before the next nucleotide addition 33 (step d The one-colour images highlight the sequencing data from two single-molecule templates. Metzker, Naten Rev. 2010
21 3rd eneration Single molecule - no initial PR amplification This is nice because the PR step can/will introduce errors No underrepresentation of AT/-rich templates urrently: Pacific Biosciences, Ion Torrent (still pcr), Helicos(?) uture: Oxford Nanopore,...
22 Target enrichment Use DNA microarrays to enrich for wanted DNA/RNA Eg Human exome is ~50Mb compared to 3b
23 Ion Torrent The chip is the machine Based on semiconductors, ie. no fluorescence Release of hydrogen when a nucl. is incorporated is measured by ph-meter Small machine, low price pr. run
24 Applications of NS
25 Some applications of NS Whole genome re-sequencing Ancient genomes Metagenomics ancer genomics Exome sequencing (targeted) RNA sequencing hip-seq Epidemiology...
26 Anything with DNA
Introduction to Next Generation Sequencing (NGS)
Introduction to Next eneration Sequencing (NS) Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark 2012 Today 9.00-9.45: Introduction to NS, How it
More informationChIP-seq data analysis
hip-seq data analysis Harri Lähdesmäki Department of omputer Science Aalto University January 8, 2015 Motivation: transcription factor binding site (TBS) prediction Last time we studied computational methods
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationNext Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
More informationHuman genome sequence
NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion
More informationNext Generation Sequencing Technologies
Next Generation Sequencing Technologies What is first generation? Sanger Sequencing DNA Polymerase Base-adding reaction +H + http://chemwiki.ucdavis.edu/organic_chemistry/organic_chemistry_with_a_biological_emphasis/chapter_10%3a_phosphoryl_transfer_reactions/section_10.4%3a_phosphate_diesters
More informationGenome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias
Genome Sequencing I: Methods MMG 835, SPRING 2016 Eukaryotic Molecular Genetics George I. Mias Department of Biochemistry and Molecular Biology gmias@msu.edu Sequencing Methods Cost of Sequencing Wetterstrand
More informationDNA-Sequenzierung. Technologien & Geräte
DNA-Sequenzierung Technologien & Geräte Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day, 850 nt reads 2 Mb/day, 550 nt reads Roche/454 GS FLX 12/2006 400 Mb/7h, 350 nt reads
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationThird Generation Sequencing
Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence
More informationResearch school methods seminar Genomics and Transcriptomics
Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence
More informationCSC Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx By Anonymous. Similarity Index
Page 1 of 6 Document Viewer TurnitinUK Originality Report Processed on: 05-Dec-20 10:49 AM GMT ID: 13 Word Count: 1587 Submitted: 1 CSC8313-201 - Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx
More informationHigh Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015
High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-03 GENOMICS AND TRANSCRIPTOMICS: WHY PROTEOMICS? TRANSCRIPT Welcome to the proteomics course. Today, we will talk about Genomics and Transcriptomics and then we will talk about why to study proteomics?
More informationBiochemistry 412. New Strategies, Technologies, & Applications For DNA Sequencing. 12 February 2008
Biochemistry 412 New Strategies, Technologies, & Applications For DNA Sequencing 12 February 2008 Note: Scale is wrong!! (at least for sequences) 10 6 In 1980, the sequencing cost per finished bp $1.00
More informationNEXT-GENERATION SEQUENCING AND BIOINFORMATICS
NEXT-GENERATION SEQUENCING AND BIOINFORMATICS Moore's law: the number of transistors in a dense integrated circuit doubles every two years Moore's law calculates and predicts the pace of improvement of
More informationNext Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017
Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA
More informationBIOINFORMATICS 1 SEQUENCING TECHNOLOGY. DNA story. DNA story. Sequencing: infancy. Sequencing: beginnings 26/10/16. bioinformatic challenges
BIOINFORMATICS 1 or why biologists need computers SEQUENCING TECHNOLOGY bioinformatic challenges http://www.bioinformatics.uni-muenster.de/teaching/courses-2012/bioinf1/index.hbi Prof. Dr. Wojciech Makałowski"
More informationUltrasequencing: Methods and Applications of the New Generation Sequencing Platforms
Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms Laura Moya Andérico Master in Advanced Genetics Genomics Class December 16 th, 2015 Brief Overview First-generation
More informationSequencing techniques and applications
I519 Introduction to Bioinformatics Sequencing techniques and applications Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Sequencing techniques Sanger sequencing Next generation
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationGenome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall
Genome Sequencing Technologies Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Sciences start with Observation Sciences start with Observation and flourish with
More informationBioanalytical chemistry. 6. DNA sequencing
123 Bioanalytical chemistry 6. DNA sequencing Some objectives for this section You will know how DNA was traditionally sequenced by 1 color, 4 lane methods You will know how DNA was traditionally sequenced
More informationIntroductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology
Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as
More informationOpportunities offered by new sequencing technologies
Opportunities offered by new sequencing technologies Pierre Taberlet Laboratoire d'ecologie Alpine CNRS UMR 5553 Université Joseph Fourier, Grenoble, France Nature Biotechnology, October 2008: special
More informationNEXT GENERATION SEQUENCING: A REVOLUTION IN GENE SEQUENCING
NEXT GENERATION SEQUENCING: A REVOLUTION IN GENE SEQUENCING Ritesh Kaur and *Chander Parkash Malik School of Life Sciences, Jaipur National University, Jaipur, Rajasthan 302017, India *Author for Correspondence
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationMHC Region. MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells
DNA based HLA typing methods By: Yadollah Shakiba, MD, PhD MHC Region MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells Nomenclature of HLA Alleles Assigned
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationNext Generation Sequencing. Dylan Young Biomedical Engineering
Next Generation Sequencing Dylan Young Biomedical Engineering What is DNA? Molecule composed of Adenine (A) Guanine (G) Cytosine (C) Thymine (T) Paired as either AT or CG Provides genetic instructions
More informationGenetic Fingerprinting
Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.
More informationMethods, Models & Techniques. High-throughput DNA sequencing concepts and limitations
High-throughput DNA sequencing concepts and limitations Martin Kircher and Janet Kelso Recent advances in DNA sequencing have revolutionized the field of genomics, making it possible for even single research
More informationOutline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture
The use of new sequencing technologies for genome analysis Chris Mattocks National Genetics Reference Laboratory (Wessex) NGRL (Wessex) 2008 Outline General principles of clonal sequencing Analysis principles
More informationManipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
More informationNext Generation Sequencing Technologies. Some slides are modified from Robi Mitra s lecture notes
Next Generation Sequencing Technologies Some slides are modified from Robi Mitra s lecture notes What will you do to understand a disease? What will you do to understand a disease? Genotype Phenotype Hypothesis
More informationINTRODUCCIÓ A LES TECNOLOGIES DE 'NEXT GENERATION SEQUENCING'
INTRODUCCIÓ A LES TECNOLOGIES DE 'NEXT GENERATION SEQUENCING' Bioinformàtica per a la Recerca Biomèdica Ricardo Gonzalo Sanz ricardo.gonzalo@vhir.org 14/12/2016 1. Introduction to NGS 2. First Generation
More informationThema Gentechnologie. Erwin R. Schmidt Institut für Molekulargenetik Vorlesung #
Thema Gentechnologie Erwin R. Schmidt Institut für Molekulargenetik Vorlesung #10 01. 07. 2014 Pyrosequenzierung The Pyrosequencing technology is a relatively new DNA sequencing method originally
More informationLecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationNext-Generation Sequencing for Biomedical Applications
University of New Mexico UNM Digital Repository Biomedical Sciences ETDs Electronic Theses and Dissertations 7-1-2013 Next-Generation Sequencing for Biomedical Applications Mingyan Xu Follow this and additional
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationComparative genomics on gene and single nucleotide level
Technische Fakultät Center for Biotechnology (CeBiTec) Computational Genomics Comparative genomics on gene and single nucleotide level Zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationTargeted Sequencing in the NBS Laboratory
Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February
More informationChapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi
Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated
More informationSome types of Mutagenesis
Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine
More informationAdditional Activity: Sanger Dideoxy Sequencing: A Simulation Activity
Student Worksheet Additional Activity: Sanger Dideoxy Sequencing: A Simulation Activity LSM 6.3-7 In 1977, Frederick Sanger developed a method by which the nucleotide sequence of a DNA fragment could be
More informationMolecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD
Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Department of Biopharmacy, Faculty of Pharmacy, Silpakorn University Example of critical checkpoints
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationPureSpin DNA Clean Up Kit
PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage
More informationRIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)
Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationSANGER SEQUENCING WHITE PAPER
AAAT T C SANGER SEQUENCING WHITE PAPER FACTORS AFFECTING SANGER SEQUENCING ROBUSTNESS AND DATA QUALITY PATRICK WARNER, SHEA ANDERSON, ARCHANA DESHPANDE, DARYL M. GOHL, KENNETH B. BECKMAN UNIVERSITY OF
More informationSession 3 Cloning Overview & Polymerase Chain Reaction
Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationAmerican Society of Cytopathology Core Curriculum in Molecular Biology
American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Alternatives to PCR, Part I
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationSanger sequencing troubleshooting guide. GATC Biotech AG
Sanger sequencing troubleshooting guide GATC Biotech AG April, 2017 Introduction All sequencing data generated at GATC Biotech is carefully analysed before it is delivered to the customer. In cases where
More informationPolymerase Chain Reaction (PCR)
Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an
More informationPyrosequencing. Alix Groom
Pyrosequencing Alix Groom Pyrosequencing high-throughput CpG methylation analysis platform real-time, sequence-based detection and quantification % methylation at multiple adjacent CpG sites 80-100 bases
More informationBio Rad PCR Song Lyrics
Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationMolekulargenetische Reagenzien. Raumtemperaturstabile PCR und qpcr Reagenzien
Molekulargenetische Reagenzien Raumtemperaturstabile PCR und qpcr Reagenzien Polypeptide Stabilization Technology: Stability TAG Ice-free reaction set-up Our temperature stable enzymes allow you to change
More informationPerformance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer
Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer Technical Note 10 Measured conc. [ng/µl] 1 Y intercept = 0.09 r 2 = 0.993 0.1 0.1 1 10 Reference concentration
More informationPolymerase Chain Reaction (PCR) and Its Applications
Polymerase Chain Reaction (PCR) and Its Applications What is PCR? PCR is an exponentially progressing synthesis of the defined target DNA sequences in vitro. It was invented in 1983 by Dr. Kary Mullis,
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More information1. A brief overview of sequencing biochemistry
Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationBauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04
Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Author(s): Claire Reardon Reviewers: Christian Daly Contact: claire@cgr.harvard.edu
More informationBasic Steps of the DNA process
As time pasted technology has improve the methods of analyzing DNA. One of the first methods for the analysis of DNA is known as Restriction Fragment Length Polymorphism (RFLP). This technique analyzed
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationmmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not
More informationHiSeqTM 2000 Sequencing System
IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance
More informationBST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data
BST227 Introduction to Statistical Genetics Lecture 8: Variant calling from high-throughput sequencing data 1 PC recap typical genome Differs from the reference genome at 4-5 million sites ~85% SNPs ~15%
More informationPRODUCT INFORMATION Long PCR Enzyme Mix #K0182 500 u Lot Exp. 00.0000 Store at -20 C. CERTIFICATE OF ANALYSIS Long PCR Enzyme Mix is functionally tested in PCR amplification of 47.4 kb fragment from lambda
More informationLECTURE TOPICS 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS 5) RECOMBINANT DNA CONSTRUCTION AND GENE CLONING
Page 1 of 25 Chapter 5 Notes Biochemistry 461 Fall 2010 CHAPTER 5, EXPLORING GENES: LECTURE TOPICS 1) RESTRICTION ENZYMES 2) GEL ELECTROPHORESIS OF DNA 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS
More informationIntroduction Bioo Scientific
Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior
More informationDNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
More informationUser Manual. NGS Library qpcr Quantification Kit (Illumina compatible)
NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents
More informationHiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationHybridization capture of DNA libraries using xgen Lockdown Probes and Reagents
Hybridization capture of DNA libraries using xgen Lockdown Probes and Reagents For use with: llumina TruSeq adapter ligated libraries xgen Universal Blockers TS Mix (Catalog # 1075474, 1075475, 1075476)
More informationMICRO$EC: Cost Effective, Whole-Genome Sequencing
University of Pennsylvania ScholarlyCommons Senior Design Reports (CBE) Department of Chemical & Biomolecular Engineering 4-2011 MICRO$EC: Cost Effective, Whole-Genome Sequencing Kulika Chomvong University
More informationNAME TA SEC Problem Set 3 FRIDAY March 5, Problem sets will NOT be accepted late.
MIT Department of Biology 7.013: Introductory Biology - Spring 2004 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. laudette ardel NME T SE 7.013 Problem Set 3 FRIDY March 5, 2004 Problem
More informationAMPURE PCR PURIFICATION PAGE 1 OF 7
PCR PURIFICATION PAGE 1 OF 7 Please refer to http://www.agencourt.com/technical/reagent_information/ for updated protocols. AMPure is a registered trademark of Agencourt Bioscience and is for laboratory
More informationSMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
More informationCAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan
CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs15.html Gene Expression q Process of transcription
More information