Effects of heat stress on the transcriptomic profile of blood cells in lactating dairy goats
|
|
|
- Paul Wilkerson
- 6 years ago
- Views:
Transcription
1 Effects of heat stress on the transcriptomic profile of blood cells in lactating dairy goats A. Contreras-Jodar* 1, A.A.K. Salama 1, S. Hamzaoui 1, G. Caja 1, M. Vailati 2, J.J. Loor 2 G2R Grup Recerca Remugants 1 Group of Ruminant Research (G2R), Universitat Autònoma de Barcelona, Spain 2 Mammalian NutriPhisioGenomics, University of Illinois, Urbana, USA
2 Change in average surface temperature Change in average surface temperature IPCC (2013)
3 Heat Stress effects in ruminants Literature based mostly on phenotypic records
4 Responses of dairy goats to heat stress (HS) Respiratory Rate (+300%) Rectal Temperature (+0.58ºC) Water consumption (+202%) Dry matter intake (-21%) Body weight (-125 g/d) Milk yield (-4 to -10%) Milk quality ( 12.5% CP) Slower Immune response when the udder is challenged with LPS Hamzaoui et al. (2012, 2013) Love (2015)
5 Objectives Evaluate the transcriptomic response and the metabolic pathways affected on immune system of heat stressed lactating dairy goats.
6 Experimental design Murciano-Granadina dairy goats in mid-lactation (n = 8) Climatic chamber: - TN: 15 to 20 C - HS: 37 C-12h and 30 C-12h TMR diet ad libitum (17% CP; 1.3 Mcal ENL) according to requirements (INRA, 2007)
7 Blood samples and Microarrays Blood samples: d 35 (n=8) RNA extraction: RiboPure-Blood Kit RNA integrity: Agilent Bioanalyzer K Affymetrix GeneChip Bovine Genome Array GeneChip 3 IVT Express Kit
8 Gene expression Data Analysis Image files DATA PREPARATION: Affy package (Bioconductor) Raw Data Gene expressed Array Differentially expressed Gene List Background correction Normalization (log 2 ) Remove absent probe sets STATISTICS: Student s t-test Benjamini and Hochberg corrected (FDR=0.05) Fold Change threshold >/1/ PATHWAY ENRICHMENT ANALYSIS:
9 Pathway enrichment analysis DINAMIC IMPACT APPROACH (DIA): DEG List + Fold Change + adj p-value DIA + KEGG >= 4 genes/pathway >20% coverage Bionaz et al. (2012)
10 Results 24,128 transcripts 24K Affymetrix GeneChip Bovine Genome Filtering 14,316 transcripts 143 DE genes Statistical analysis 55 Up-Regulated 88 Down-Regulated 31 Metabolic Pathways (immune system)
11 Top 15 Pathways affected by HS
12 1) Down-regulated pathways in HS goats RNA TRANSPORT Reviewed by Strambio-De-Castillia et al. (2010)
13 2) Down-regulated pathways in HS goats HEMATOPOIETIC CELL LINEAGE Immune cells have life time. Have to be constantly replaced IMMUNE RESPONSE IS IN DISADVANTAGE!!! Slower creation and differenciation Seita and Weissman (2011)
14 3) Down-regulated pathways in HS goats LEUKOCYTE TRANSENDOTHELIAL MIGRATION By interaction among Cell Adhesion Molecules and Extracellular Matrix Step 1 Rolling Step 2 Adhesion Ca 2+ SIGNALING Selectins Integrins and Ig family Step 3 Extravasation Reviewed by Etzioni (1996); Muller et al. (2011)
15 3) Down-regulated pathways in HS goats LEUKOCYTE TRANSENDOTHELIAL MIGRATION By interaction among Cell Adhesion Molecules and Extracellular Matrix Step 1 Rolling Step 2 Adhesion Selectins Integrins and Ig family INNATE AND ADAPTIVE RESPONSE!!! Ca 2+ SIGNALING Step 3 Extravasation Reviewed by Etzioni (1996); Muller et al. (2011)
16 4) Down-regulated pathways in HS goats 1. PPARɣ SIGNALING 3. ARGININE AND PROLINE METABOLISM F(x): Modulates gene expression of lipid-related genes F(x): Decrease inflammatory response Promote wound healing (Széles et al., 2007; O Donell et al., 2014) (Gallardo-Soler et al., 2008; Munder et al., 2009) 2. Ca 2+ SIGNALING F(x): Platelet activation and aggregation (Razell et al., 2013; O Donell et al., 2014) COMPROMISE WOUND HEALING
17 Up-regulated pathways in HS goats PYRIMIDINE METABOLISM PURINE METABOLISM CYTOCHROME p pg of cytosolic protein/leukocyte (humans) RH + O 2 + NADPH + H + ROH + H 2 O + NADP + Immune cell fate for extra fuel and wound healing Hibbs et al. (2016)
18 Conclusions Differentially expressed genes were found in healthy lactating dairy goats after 5 wk of heat stress exposure. 55 of them were up-regulated in heat stress goats involved in nucleotide catabolism and oxidation. 88 genes were down-regulated in heat stress goats mainly related with RNA transport, leukocyte transendothelial migration and wound healing. 2. Heat stress hinders both innate and adaptive immune responses.
19 Thank you for your attention
Using 2-way ANOVA to dissect gene expression following myocardial infarction in mice
Using 2-way ANOVA to dissect gene expression following myocardial infarction in mice Thank you for waiting. The presentation will be starting in a few minutes at 9AM Pacific Daylight Time. During this
Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison. CodeLink compatible
Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison CodeLink compatible Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood
Gut microbial colonization in day old chicks. Henri Woelders DirkJan Schokker Mari A. Smits
Gut microbial colonization in day old chicks Henri Woelders DirkJan Schokker Mari A. Smits Trends Robustness; Resilience. Ability to keep healthy, or recover from disease (with minimal human intervention).
DNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa
Introduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison
Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison Thank you for waiting. The presentation will be starting in a few minutes at 9AM Pacific Daylight
Affymetrix GeneChip Arrays. Lecture 3 (continued) Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy
Affymetrix GeneChip Arrays Lecture 3 (continued) Computational and Statistical Aspects of Microarray Analysis June 21, 2005 Bressanone, Italy Affymetrix GeneChip Design 5 3 Reference sequence TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT
Analysis of Differential Gene Expression in Cattle Using mrna-seq
Analysis of Differential Gene Expression in Cattle Using mrna-seq mrna-seq A rough guide for green horns Animal and Grassland Research and Innovation Centre Animal and Bioscience Research Department Teagasc,
Microarray Technique. Some background. M. Nath
Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique
Comparison of 3 labeling and amplification protocols: for total RNA labeling, amplification, and Affymetrix GeneChip expression (last updated 9/26/05)
Comparison of 3 labeling and amplification protocols: for total RNA labeling, amplification, and Affymetrix GeneChip expression (last updated 9/26/05) Purpose: to compare 3 of the commercially available
Exploration, Normalization, Summaries, and Software for Affymetrix Probe Level Data
Exploration, Normalization, Summaries, and Software for Affymetrix Probe Level Data Rafael A. Irizarry Department of Biostatistics, JHU March 12, 2003 Outline Review of technology Why study probe level
Probe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies.
Probe-Level Data Normalisation: RMA and GC-RMA Sam Robson Images courtesy of Neil Ward, European Application Engineer, Agilent Technologies. References Summaries of Affymetrix Genechip Probe Level Data,
STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays. Materials are from
STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays Materials are from http://www.ohsu.edu/gmsr/amc/amc_technology.html The GeneChip high-density oligonucleotide arrays are fabricated
EECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
Preprocessing Affymetrix GeneChip Data. Affymetrix GeneChip Design. Terminology TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT
Preprocessing Affymetrix GeneChip Data Credit for some of today s materials: Ben Bolstad, Leslie Cope, Laurent Gautier, Terry Speed and Zhijin Wu Affymetrix GeneChip Design 5 3 Reference sequence TGTGATGGTGGGGAATGGGTCAGAAGGCCTCCGATGCGCCGATTGAGAAT
MulCom: a Multiple Comparison statistical test for microarray data in Bioconductor.
MulCom: a Multiple Comparison statistical test for microarray data in Bioconductor. Claudio Isella, Tommaso Renzulli, Davide Corà and Enzo Medico May 3, 2016 Abstract Many microarray experiments compare
Analysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
Introduction to microarrays. Overview The analysis process Limitations Extensions (NGS)
Introduction to microarrays Overview The analysis process Limitations Extensions (NGS) Outline An overview (a review) of microarrays Experiments with microarrays The data analysis process Microarray limitations
Bayesian Decomposition
Bayesian Decomposition Michael Ochs Making Proteins A Closer Look at Translation Post-Translational Modification RNA Splicing mirna Identifying Pathways A 1 2 3 B C D A B C D Bioinformatics www.promega.com
BABELOMICS: Microarray Data Analysis
BABELOMICS: Microarray Data Analysis Madrid, 21 June 2010 Martina Marbà mmarba@cipf.es Bioinformatics and Genomics Department Centro de Investigación Príncipe Felipe (CIPF) (Valencia, Spain) DNA Microarrays
Humboldt Universität zu Berlin. Grundlagen der Bioinformatik SS Microarrays. Lecture
Humboldt Universität zu Berlin Microarrays Grundlagen der Bioinformatik SS 2017 Lecture 6 09.06.2017 Agenda 1.mRNA: Genomic background 2.Overview: Microarray 3.Data-analysis: Quality control & normalization
DNA Microarray Data Oligonucleotide Arrays
DNA Microarray Data Oligonucleotide Arrays Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course 2003 Copyright 2002, all rights reserved Biological question Experimental
Data Sheet. GeneChip Human Genome U133 Arrays
GeneChip Human Genome Arrays AFFYMETRIX PRODUCT FAMILY > ARRAYS > Data Sheet GeneChip Human Genome U133 Arrays The Most Comprehensive Coverage of the Human Genome in Two Flexible Formats: Single-array
Introduction to ChIP Seq data analyses. Acknowledgement: slides taken from Dr. H
Introduction to ChIP Seq data analyses Acknowledgement: slides taken from Dr. H Wu @Emory ChIP seq: Chromatin ImmunoPrecipitation it ti + sequencing Same biological motivation as ChIP chip: measure specific
The StellARray qpcr Array System: Integrated Solution for Expression Profiling
The StellARray qpcr Array System: Integrated Solution for Expression Profiling Go to www.array.lonza.com/stellarrays Bioinformatics tool for gene selection Go to www.array.lonza.com/genesieve Collection
The hidden transcriptome: discovery of novel, stress-responsive transcription in Daphnia pulex
University of Iowa Iowa Research Online Theses and Dissertations Spring 2011 The hidden transcriptome: discovery of novel, stress-responsive transcription in Daphnia pulex Stephen Butcher University of
Outline. Analysis of Microarray Data. Most important design question. General experimental issues
Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,
PCR Arrays. An Advanced Real-time PCR Technology to Empower Your Pathway Analysis
PCR Arrays An Advanced Real-time PCR Technology to Empower Your Pathway Analysis 1 Table of Contents 1. Introduction to the PCR Arrays 2. How PCR Arrays Work 3. Performance Data from PCR Arrays 4. Research
Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
Lecture 9 Controlling gene expression
Lecture 9 Controlling gene expression BIOLOGY Campbell, Reece and Mitchell Chapter 18 334- (352-356) Every cell in your body contains the same number of genes approximately 35, 000 DNA is wound around
The Laboratory-based Physician Scientist
The Laboratory-based Physician Scientist Michael Carrithers, MD, PhD Director, Program in Neuroimmunology and Neurological Infections Associate Professor Departments of Neurology and Microbiology & Immunology
Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
RNA spike-in controls & analysis methods for trustworthy genome-scale measurements
RNA spike-in controls & analysis methods for trustworthy genome-scale measurements Sarah A. Munro, Ph.D. Genome-Scale Measurements Group ABRF Meeting March 29, 2015 Overview External RNA Controls Consortium
Introduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
Goals of pharmacogenomics
Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion
Package disco. March 3, 2017
Package disco March 3, 2017 Title Discordance and Concordance of Transcriptomic Responses Version 0.5 Concordance and discordance of homologous gene regulation allows comparing reaction to stimuli in different
Gene Expression Data Analysis (I)
Gene Expression Data Analysis (I) Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Bioinformatics tasks Biological question Experiment design Microarray experiment
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
CHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
Compendium of Immune Signatures Identifies Conserved and Species-Specific Biology in Response to Inflammation
Immunity Supplemental Information Compendium of Immune Signatures Identifies Conserved and Species-Specific Biology in Response to Inflammation Jernej Godec, Yan Tan, Arthur Liberzon, Pablo Tamayo, Sanchita
Cancer Genetics Solutions
Cancer Genetics Solutions Cancer Genetics Solutions Pushing the Boundaries in Cancer Genetics Cancer is a formidable foe that presents significant challenges. The complexity of this disease can be daunting
Introduction to gene expression microarray data analysis
Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful
Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX
Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)
Bioinformatics and Genomics: A New SP Frontier?
Bioinformatics and Genomics: A New SP Frontier? A. O. Hero University of Michigan - Ann Arbor http://www.eecs.umich.edu/ hero Collaborators: G. Fleury, ESE - Paris S. Yoshida, A. Swaroop UM - Ann Arbor
Biochemistry study of the molecular basis of life
Biochemistry : An Introduction Biochemistry study of the molecular basis of life n Study of the chemistry of living organisms Studies organic molecules & organic reactions in living organisms n Living
Outline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
Mixed effects model for assessing RNA degradation in Affymetrix GeneChip experiments
Mixed effects model for assessing RNA degradation in Affymetrix GeneChip experiments Kellie J. Archer, Ph.D. Suresh E. Joel Viswanathan Ramakrishnan,, Ph.D. Department of Biostatistics Virginia Commonwealth
Ion S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5
Read and take notes on pages
Protein Synthesis Read and take notes on pages 336-340 What is protein? Proteins Polypeptide chains of amino acids Are enzymes that catalyze biochemical reactions and are vital to metabolism. They have
Identifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer
Identifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer Nagwan M. Abdel Samee 1, Nahed H. Solouma 2, Mahmoud Elhefnawy 3, Abdalla S. Ahmed 4, Yasser M. Kadah 5 1 Computer Engineering
Probe-Level Analysis of Affymetrix GeneChip Microarray Data
Probe-Level Analysis of Affymetrix GeneChip Microarray Data Ben Bolstad http://www.stat.berkeley.edu/~bolstad Michigan State University February 15, 2005 Outline for Today's Talk A brief introduction to
Pennsylvania 15260, USA and 6 Department of Bioinformatics and Biosystems Technology, Technical University of Applied Sciences Wildau, Hochschulring
Robust gene expression and mutation analyses of RNA-sequencing of formalin-fixed diagnostic tumor samples Stefan Graw 1,6, Richard Meier 1,6, Kay Minn 1, Clark Bloomer 2, Andrew K Godwin 3, Brooke Fridley
The Glue Grant: Inflammation and the Host Response to Injury
The Glue Grant: Inflammation and the Host Response to Injury Methods in Bioengineering Ronald G. Tompkins, M.D., Sc.D. John F. Burke Professor of Surgery Harvard Medical School Chief of Staff Shriners
NEXT GENERATION ECM-BASED ALLOGRAFT TECHNOLOGY:
NEXT GENERATION ECM-BASED ALLOGRAFT TECHNOLOGY: Potent biological scaffolds strategically control stem cell fate and function, allowing our allografts to harness the regenerative potential of patient s
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
The Road to Functional Bioanalysis: Development and Validation of a Cell-Based Assay for Neutralizing Anti-Drug Antibody Analysis
The Road to Functional Bioanalysis: Development and Validation of a Cell-Based Assay for Neutralizing Anti-Drug Antibody Analysis Christelle Pythoud, PhD 2 nd EBF YSS, Barcelona Spain Celerion Switzerland
Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information
From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class
DNA Microarray Data Analysis and Mining: Affymetrix Software Package and In-House Complementary Packages
University of New Orleans ScholarWorks@UNO University of New Orleans Theses and Dissertations Dissertations and Theses 12-19-2003 DNA Microarray Data Analysis and Mining: Affymetrix Software Package and
Lecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
Nucleotide Metabolism Biochemistry by Lippincott pp
Nucleotide Metabolism Biochemistry by Lippincott pp 291-306 Metabolism: CONCEPT Ø Metabolism is the totality of an organism s chemical reactions. Ø A metabolic pathway begins with a specific molecule and
Package GeneExpressionSignature
Package GeneExpressionSignature December 30, 2017 Title Gene Expression Signature based Similarity Metric Version 1.25.0 Date 2012-10-24 Author Yang Cao Maintainer Yang Cao , Fei
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects
Description of Logit-t: Detecting Differentially Expressed Genes Using Probe-Level Data
Description of Logit-t: Detecting Differentially Expressed Genes Using Probe-Level Data Tobias Guennel October 22, 2008 Contents 1 Introduction 2 2 What s new in this version 3 3 Preparing data for use
UNIVERSITY OF TORINO. Department of Clinical and Biological Sciences. Doctoral School in Complex Systems in Medicine and Life Sciences
UNIVERSITY OF TORINO Department of Clinical and Biological Sciences Doctoral School in Complex Systems in Medicine and Life Sciences Ph.D. in COMPLEX SYSTEMS IN POST-GENOMIC BIOLOGY XXIII cycle Computational
SPH 247 Statistical Analysis of Laboratory Data
SPH 247 Statistical Analysis of Laboratory Data April 14, 2015 SPH 247 Statistical Analysis of Laboratory Data 1 Basic Design of Expression Arrays For each gene that is a target for the array, we have
Biomarkers, Early Prediction of Vaccine Efficacy and Safety
Biomarkers, Early Prediction of Vaccine Efficacy and Safety Giuseppe Pantaleo, M.D. Professor of Medicine Head, Division of Immunology and Allergy Executive Director, Swiss Vaccine Research Institute Lausanne
Gene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
Quantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology
Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology Question No. 1 of 10 1. Which statement describes how an organism is organized from most simple to most complex? Question
Analysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
Technical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
Agilent Seahorse XF Live-Cell Metabolism Solutions for STEM CELL RESEARCH
Agilent Seahorse XF Live-Cell Metabolism Solutions for STEM CELL RESEARCH MONITOR CELL FATE TRANSITIONS Improve Differentiation and Reprogramming Outcomes Adult Fibroblast Cells Reprogramming (ips Cells)
CS 5984: Application of Basic Clustering Algorithms to Find Expression Modules in Cancer
CS 5984: Application of Basic Clustering Algorithms to Find Expression Modules in Cancer T. M. Murali January 31, 2006 Innovative Application of Hierarchical Clustering A module map showing conditional
AP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
FORAGES IN TOTAL MIXED RATIONS. Mireille Chahine 1. Forages in the diet of dairy cows
FORAGES IN TOTAL MIXED RATIONS Mireille Chahine 1 s in the diet of dairy cows Feed costs account for 40 to 50 % of total production costs on dairies with forages cost allocation varying between 38 and
In Vitro Angiogenesis Assay Kit
In Vitro Angiogenesis Assay Kit Catalog Number KA1323 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...
Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip
Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip Reproducibility of Extraction of Genomic DNA from Whole Blood samples in EDTA using FUJIFILM membrane technology on the QuickGene-810
New Statistical Algorithms for Monitoring Gene Expression on GeneChip Probe Arrays
GENE EXPRESSION MONITORING TECHNICAL NOTE New Statistical Algorithms for Monitoring Gene Expression on GeneChip Probe Arrays Introduction Affymetrix has designed new algorithms for monitoring GeneChip
Linking Genetic Variation to Important Phenotypes
Linking Genetic Variation to Important Phenotypes BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under
sirna Overview and Technical Tips
1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION
Section 2: Eukaryotic Sample and Array Processing Rev. 3
Section 2: Eukaryotic Sample and Array Processing 701024 Rev. 3 Section 2 Contents Section 2 Eukaryotic Sample and Array Processing Chapter 1 Eukaryotic Target Preparation 2.1.3 Eukaryotic Chapter 2 Eukaryotic
3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
Nucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora
FACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY
FACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY K. L. Knudtson 1, C. Griffin 2, A. I. Brooks 3, D. A. Iacobas 4, K. Johnson 5, G. Khitrov 6,
Exercise1 ArrayExpress Archive - High-throughput sequencing example
ArrayExpress and Atlas practical: querying and exporting gene expression data at the EBI Gabriella Rustici gabry@ebi.ac.uk This practical will introduce you to the data content and query functionality
High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours
High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours Application Note Authors Paula Costa and Anniek De Witte Agilent Technologies, Inc. Santa Clara, CA USA Abstract As
Intro to Microarray Analysis. Courtesy of Professor Dan Nettleton Iowa State University (with some edits)
Intro to Microarray Analysis Courtesy of Professor Dan Nettleton Iowa State University (with some edits) Some Basic Biology Genes are DNA sequences that code for proteins. (e.g. gene lengths perhaps 1000
Analysis of milk microbial profiles using 16s rrna gene sequencing in milk somatic cells and fat
Analysis of milk microbial profiles using 16s rrna gene sequencing in milk somatic cells and fat Juan F. Medrano Anna Cuzco* Alma Islas-Trejo Armand Sanchez* Olga Francino* Dept. of Animal Science University
Question. In the last 100 years. What is Feed Efficiency? Genetics of Feed Efficiency and Applications for the Dairy Industry
Question Genetics of Feed Efficiency and Applications for the Dairy Industry Can we increase milk yield while decreasing feed cost? If so, how can we accomplish this? Stephanie McKay University of Vermont
1. Introduction. 1 Page 1
1. INTRODUCTION Osteoblast differentiation is the key component of the bone formation, growth and remodeling. During this incompletely understood process a subpopulation of multipotential mesenchymal stem
Understanding protein lists from comparative proteomics studies
Understanding protein lists from comparative proteomics studies Bing Zhang, Ph.D. Department of Biomedical Informatics Vanderbilt University School of Medicine bing.zhang@vanderbilt.edu A typical comparative
Protein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
A systematic guideline for developing the best real-time PCR primers
Scientific article Lessons learned from designing assays for more than 14, genes George Quellhorst and Sam Rulli QIAGEN, 6951 Executive Way, Frederick, Maryland 213, USA Abstract: Primer design is the