INTRODUCTION TO GENOMICS & SEQUENCING

Size: px

Start display at page:

Download "INTRODUCTION TO GENOMICS & SEQUENCING"

Lesley Summers
5 years ago
Views:

1 With thanks to: Mark Pallen Lex Nederbragt NICK LOMAN UNIVERSITY OF BIRMINGHAM INTRODUCTION TO GENOMICS & SEQUENCING

2 PICTURE QUIZ

3 1859

5 1856

6 1871

9 1953

12 1977

13 Sanger sequencing method Chain extension by DNA polymerase is only possible when there is a hydroxyl group on the 3 carbon.

14 Chain terminadon sequencing

15 Methods for genome sequencing historic Sanger method sequencing

16 Genome, noun, the complete set of genes or genedc material present in a cell or organism.

18 The Human Genome Project

19 Sequencing automadon

20 Whole- genome shotgun sequencing J. Craig Venter

21 H. influenzae genome Genome size 1.8Mb (on the small size) 1740 genes Circular organisadon

22 De novo assembly is difficult Analogy: Shredding up a book and reconstrucdng its text

24 Assembly exercise

25 Assembly It was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness, it was the epoch of belief, it was the epoch of incredulity, it was the season of Light, it was the season of Darkness, it was the spring of hope, it was the winter of despair, we had everything before us, we had nothing before us, we were all going direct to heaven, we were all going direct the other way - in short, the period was so far like the present period, that some of its noisiest authorities insisted on its being received, for good or for evil, in the superlative degree of comparison only.

26 Discussion points What text did you manage to reconstruct? Which parts were hard? Which parts were easy? What techniques did you find that helped? What would help do this?

28 The Book of Life ~3Gb genome Comprises 23 pairs of chromosomes and mitochondria 7.5x coverage >340,000 runs Cost: $1,000,000,000 Time: 13 years

29 High- throughput Sequencing >1000x faster, >1000x cheaper! A disrupdve technology Three second- generadon technologies established in the marketplace Solexa (Illumina) 454 (Roche) Ion Torrent (Life Technologies)

30 Cost per genome

31 Sequencing in Birmingham

32 454 amplificadon Metzker, Nature Reviews Genetics

33 454 sequencing

34 Sequencing technology Free proton current shift sequencing-by-synthesis

35 Illumina (HiSeq, MiSeq etc.) Metzker, Nature Reviews Genetics

36 Error profiles Substitution errors ACGTAGCTGATTTTAGGCTTAGCT ACGTAGCTGCTTTTAGGCTTAGCT Homopolymer errors ACGTAGCTGATTTTAGGCTTAGCT ACGTAGCTGATTT-AGGCTTAGCT

37 ApplicaDons Pla<orm 454 Illumina HiSeq Illumina MiSeq Ion Torrent resequencing de novo metagenomics mrna mirna ChIP DNA meth

38 Case studies in NGS Microbial genomics Cancer Also: Human genedcs Pre- implantadon genedc diagnosis Down s tesdng during pregnancy Environmental sequencing

39 A Bacterial Genome: WYSIWYG

40 ComparaDve genomics Bacterial epidemiology Who caught what from who? Where did it come from? EvoluDonary history (of bacteria and humans) Pathogen biology What does the genome tell us about pathogenesis?

41 The birth of genomic epidemiology for bacteria Illustrative not exhaustive!

42 Bacterial Genomic Epidemiology Genome sequencing brings the advantages of open-endedness (revealing the unknown unknowns ), universal applicability ultimate in resolution

43 Case Study Acinetobacter baumannii Gram-negative bacillus Multi-drug or extremely-drug resistant Associated with wound infections and ventilator-associated pneumonia bloodstream infections returning military personnel from Iraq and Afghanistan transmission from military to civilian patients

44 Applications and Questions Epidemiology Q1: Can whole-genome sequencing detect differences between isolates within an outbreak? Q2: Can these differences be used to help determine chains of transmission?

45 Acinetobacter Genomic Epidemiology Outbreak in Birmingham Hospital in 2008 Isolates indistinguishable by current typing methods

46 Acinetobacter Genomic Epidemiology 454 whole-genome sequencing of 6 isolates SNP detection by mapping reads against draft reference assembly SNP filtering for false positives SNP validation with Sanger sequencing of PCR amplicons

47 Outbreak isolates disdnguishable at only three loci SNP 1 SNP 2 SNP 3 AB0057 C A G M1 C A G M2 T A G M3 T A T M4 T A G C1 T T G C2 T A G

50 German E. coli O104:H4 outbreak aka SPROUTBREAK May- July 2011 >4000 cases, >50 deaths in Germany Link to sproudng seeds Increased risk of haemolydc- uraemic syndrome (>25%) Females pardcularly at risk

51 Crowd- sourcing the genome

52 Crowd- sourcing the genome

54 Crowd- sourcing the genome 50 CumulaKve blog posts Strain comparisons In silico MLST PCR targets Assembly AAF cluster WrbA Stx2 site 0

56 Applications: Cancer Biology Multiple hit hypothesis Mutations in: Proto-oncogenes Tumour suppressor genes (e.g. p45) DNA repair genes

57 Malignant Darwinism Cancer is an evolutionary process Mutational frequency heterogeneity analysis to become an integral component of molecular pathology

58 Spectrum of mutadons seen in cancer

59 Applications: Cancer Biology Genome versus exome versus transcriptome Even a transcriptome provides abundance of RNAs expressed mutations (point mutations, indels, inversions), alternative and novel splicing, gene fusions, RNA editing

63 Single molecule sequencing C2 (current) chemistry: Average read length bp reads 90 MB per run

64 Figure 4 Real-time sequencing. Pacific Biosciences four-colour r a The zero-mode waveguide (ZMW) design reduces the observatio fluorescently labelled molecules that enter the detection layer for a the dilemma that DNA polymerases perform optimally when fluores micromolar concentration range, whereas most single-molecule de REVIEWS Pacific Biosciences Real-time sequencing a Technology Phospholinked hexaphosphate nucleotides 10-3 ml G A b 10-6 microlitre picolitre ZEPTOlitre Zero-mode waveguide 100 nm Limit of detection zone Glass Epifluorescence detection Intensity Fluorescence pulse T

65 Nanopore sequencing

66 Video hmps:// minion- device- a- miniaturised- sensing- system/the- minion- device- a- miniaturised- sensing- system

68 Plaoorm Company formation First array chip constructed ASIC design initiated Radical redesign of chip surface to enable stable nanopore array Commercialisation of platform begins first product shipped to collaborators MAP begins 1000 s of participants in 10 s of countries worldwide MinION prototypes used internally MinION Access Programme (MAP) announced Chemistry First pore made that can discriminate individual bases First pore+enzyme construct made First sequence data generated internally Academic collaborators demonstrate discrimination of bases on ssdna strand, and the use of ratcheting enzymes Data presented at AGBT showing de novo sequencing of phix and ~50kb reads First de novo sequencing data released by a user 8kb read from P. aeruginosa Demonstration of nanopore sequencing to 50 attendees at ASHG hands on

69 Encapsulated Sample Prep Direct from biology

70 Protein sequencing with nanopores

71 Further Information High-throughput sequencing technology nrg2626.pdf /pdf Clinical Microbiology Pallen, Loman, Penn High-throughput sequencing and clinical microbiology: progress, opportunities and challenges Current Opinion in Infectious Disease

72 Further Information Cancer genomics , , , , , , cn=aacr&c=10165&s=20435&e=12623&&m=1&br=80&audio=false cn=aacr&c=10165&s=20435&e=12624&&m=1&br=80&audio=false

Aaron Liston, Oregon State University Botany 2012 Intro to Next Generation Sequencing Workshop

Output (bp) Aaron Liston, Oregon State University Growth in Next-Gen Sequencing Capacity 3.5E+11 2002 2004 2006 2008 2010 3.0E+11 2.5E+11 2.0E+11 1.5E+11 1.0E+11 Adapted from Mardis, 2011, Nature 5.0E+10