Principles of Sequencing and Pla3orms

Transcription

1 Principles of Sequencing and Pla3orms 6/4/2018 RCPA Workshop Ms Leah Roberts PhD candidate University of Queensland

2 TradiMonal diagnosmcs Standardised, established methods and infrastructure, reasonably fast turn- around Mme Relies on phenotype Lacks high- resolumon discriminatory power

3 Whole genome sequencing high resolumon diagnosmcs for microbiology Ability to discriminate at the nucleomde level Allows for the highest comparamve resolumon Whole genome characterisamon Plasmids AnMbioMc resistance genes (and their context) Virulence genes Becoming more applicable for the clinic Technology becoming faster, more accessible and more cost effecmve

4 Importance of genomics in the superbug era Epidemiological surveillance Outbreak inves6ga6on

5 Major landmarks in DNA sequencing 1 st GeneraMon 2 nd GeneraMon 3 rd GeneraMon DNA Structure Discovery Sanger Sequencing 454 Solexa PacBio Nanopore MinION SOLiD Illumina Illumina HiseqX Ion Torrent

6

7 ExponenMal growth of sequencing data hdps://doi.org/ / (2013)

8

9 Principles of Sequencing First GeneraMon Sanger Sequencing Dideoxy chain- terminamon method Chain termina6on nucleo6de Normal nucleo6de Normal nucleomdes (dntps) Dideoxy chain terminamon nucleomdes (ddntps) Fluorescently labelled Polymerase Primer hdp:// method- gene- sequencing/

10 Principles of Sequencing First GeneraMon Sanger Sequencing Dideoxy chain- terminamon method GAGCA T ATGCGAGCTCGTACGTACGTAATATC GAGCATG ATGCGAGCTCGTACGTACGTAATATC GAGCATGC ATGCGAGCTCGTACGTACGTAATATC dntps: ATGC ddntps: ATGC Polymerase Primers GAGCATGCA ATGCGAGCTCGTACGTACGTAATATC

11 hdps://en.wikipedia.org/wiki/sanger_sequencing

12 Principles of Sequencing First GeneraMon Sanger Sequencing Dideoxy chain- terminamon method Sanger sequencing applicamons: 99.99% accuracy Small scale SMll used for validamon tesmng and small regions

13 Principles of Sequencing Second GeneraMon Illumina Next GeneraMon Sequencing High Throughput Sequencing Other pla3orms: Roche 454, Solexa, Ion Torrent, ABI/SOLiD (2015): Whole genome sequencing in clinical and public health microbiology. J. C. Kwong, N. McCallum, V. Sintchenko, and B. P. Howden (2016): The sequence of sequencers: The history of sequencing DNA. James M. Heather and Benjamin Chain (2017): Genera6ons of Sequencing Technologies: From First to Next Genera6on. Mehdi Kchouk, Jean- François Gibrat and Mourad Elloumi

14 Principles of Sequencing Second GeneraMon Illumina hdps:// markemng/documents/products/illumina_sequencing_introducmon.pdf

15 Illumina Bridge amplificamon 1. DNA hybridised to flow cell using adapters 2. Hybridised DNA bends over to form bridge 3. DNA polymerase creates a complementary strand 4. DNA is denatured Process is repeated unml millions of clonal clusters are created hdps://binf.snipcademy.com/lessons/ngs- techniques/bridge- pcr

16 Illumina sequencing by synthesis hdps:// generamon- sequencing/

17 Illumina sequencing by synthesis

18 Illumina sequencing by synthesis 1. All four nucleomdes are washed over flow cell 2. Fluorescence detected 3. Flow cell washed 4. Cycle repeated Number of cycles determines the length of the sequencing read: HiSeq 100 bp MiSeq 300 bp NextSeq 150 bp hdps:// markemng/documents/products/illumina_sequencing_introducmon.pdf

19 Illumina sequencing applicamons: Large- scale WGS projects 99.9% base accuracy (1 in 1000 probability of error) Cost effecmve (<$100 bacterial genome) Widely used Principles of Sequencing Second GeneraMon Illumina Wide range of analysis tools available hdps://sapac.illumina.com/science/educamon/sequencing- quality- scores.html

20 Principles of Sequencing Third GeneraMon Long- read sequencing Pacific Biosciences Single Molecule Real- Time (SMRT) sequencing Oxford Nanopore MinION

21 Library preparamon: SMRTbell template Third GeneraMon PacBio SMRT Library preparamon hdps://doi.org/ /s

22 Third GeneraMon PacBio SMRT Zero Mode Waveguide (ZMW) SMRT cell 1000 s of ZMWs Library loaded into SMRT cell using Magbeads Each ZMW has a single polymerase at the base hdps:// genomics.com/pacbio- smrt- sequencing.html hdp://dnatech.genomecenter.ucdavis.edu/pacbio- sequencing/

23 Third GeneraMon PacBio SMRT Sequencing DOI /nrg2626

24 Principles of Sequencing Third GeneraMon PacBio SMRT sequencing PacBio SMRT sequencing applicamons: Generate high- quality reference genomes using long- reads 85-89% base accuracy* With enough coverage, consensus accuracy exceeds Illumina >99.99% Some problems with homopolymers Expensive (~$2000 bacterial genome) Reliable and reproducible Can detect epigenemc modificamons: methylamon *hdps://doi.org/ /j.ygeno

25 Principles of Sequencing Third GeneraMon Nanopore MinION 1D sequencing by ligamon: Rapid sequencing: hdps://store.nanoporetech.com/

26 Nanopore = nano- scale hole Ionic current passes through nanopores and measures the changes in current Current change can be used to idenmfy that molecule Nanopore MinION flow cell hdp://biochemistri.es/post/ /of- nanopores- and- isoforms hdps://nanoporetech.com/how- it- works

27 Principles of Sequencing Third GeneraMon Nanopore MinION Nanopore MinION sequencing applicamons: Generate reference genomes using long- reads ~60-70% accuracy (2015) Consensus accuracy >97% Requires Illumina polishing for SNPs and Indels 1 Flow cell ~$1000 MulMplexing and repeat use opmons available Capacity for real- Mme analysis hdps://doi.org/ /j.bdq

28 Why is read size important? GeneraMng complete genomes Traversing repeat regions in genomes A Repeat 1 B Repeat 2 C Scenario 1: short read (Illumina) sequencing A B C Repeat 1 + 2

29 Why is read size important? GeneraMng complete genomes Traversing repeat regions in genomes A Repeat 1 B Repeat 2 C Scenario 2: long read (PacBio or Nanopore) sequencing Repeat 1 Repeat 2 A B C

30 Why is read size important? Scenario 1: short read sequencing Scenario 2: Long read sequencing Produce dra{ genomes Produce complete genomes Chromosome and plasmids hdps://github.com/rrwick/bandage/wiki/effect- of- kmer- size

31 Time and cost comparisons Cost per bacterial genome ~$100 ~$2000 ~$1000* *MulMplexing can reduce price per genome hdps://doi.org/ /ma17047

32 Sample requirements? Illumina: Flexible DNA requirements Low input kits available PacBio SMRT sequencing: Require ~20 ug of DNA ~6 x 5ml overnight broth cultures ~6 x agar plates Low input kits available Must be high molecular weight Aim for ~20-40 kb Must be high quality DNA Nanopore MinION: Requires 1.5ug DNA Low input kits available Ideal to be high molecular weight Can sequence directly from sample hdps:// content/uploads/2015/09/guide- Pacific- Biosciences- Template- PreparaMon- and- Sequencing.pdf

33 Summary of each pla3orm Illumina PacBio Nanopore Pros Cost effecmve, Reliable, widely- used, High quality, high throughput Reliable, widely- used, High quality, methylamon results, complete genomes Near- complete genomes, sequencing directly from samples, rapid results Cons Difficult to produce complete genomes Long turn- around Mme, expensive SMll in beta, variable results, more expensive than Illumina

34 Other logismcal problems to consider for the clinic Illumina NextSeq PacBio RSII Nanopore MinION

35 Looking to the future Illumina MiniSeq PacBio Sequel

36 PromethION SmidgION GridION Flongle

37 Acknowledgements Scod Beatson Mark Schembri Brian Forde Patrick Harris