LEVEL ZERO VOICE CATALYST (4 minutes, individual work):

Transcription

1 Assignment #10 Genetic Counseling LO: To discuss genetic counseling and to identify different types of genetic changes. EQ: What are the ways new traits come about in a population? AGENDA 11/28-11/29 1. Group task 2. Individual Task 3. Notes 4. Processing Task HOMEWORK 1. Synthesis (Next Wed) 2. Punnett Wksht (Wed) LEVEL ZERO VOICE CATALYST (4 minutes, individual work): 1. Dad is heterozygous for long eyelashes. Mom has short eye lashes. What is the percent probability that the child will be homozygous recessive? 2. Mom and dad are both heterozygous for brown hair. What is the percent probability the child will be blonde?

2 30s quiet thinking - Would you pay to have your DNA sequenced?

3 Task 1 10 min Group Task: Read the genetic counseling scenarios and discuss the skills and knowledge required to be a genetic counselor and issues and questions that arise in the field of genetic counseling. Group Task Criteria: Be ready to share A list of knowledge and skills needed to be an effective genetic counselor at least 3 issues or questions that are prevalent in the field of genetic counseling Write you list on paper provided

4 Task 1 Genetic Counseling 10 min Focus Question: What do genetic counselors do? Read This! Genetic counselors work as members of a health care team, providing information and support to families who have members with birth defects or genetic disorders and to families and individuals who may be at risk for a variety of inherited conditions. They identify families at risk, investigate the problem, interpret information about the disorder, analyze inheritance patterns and risks of recurrence, and review available options with the family or individual. Individual Task: 1. Ask a question about the profession and report out findings to group 2. Explain the knowledge and skills required to be a genetic counselor (restate question) 3. Explain your interest in the field (restate question) Use links on task card (on my website)

5 Figure out what has change in the before and after snapshots of the DNA sequence. What down what you think happened in the space provided. DNA sequence What happened? Before After Before After Before After Before After AGTTCCGAAGGACTGCACA AGTTCCGAAGCACTGCACA AGTTCCGAAGGACTGCACA AGTTCCGAAGCCGGGACTGCACA AGTTCCGAAGGACTGCACA AGTTCCGAAGGACTCA AGTTCCGAAGGACTGCACA AGTTGCGAAGGAGTGGACA

6 MUTATION VIDEO Point mutations- (leave one space between for your definitions if you re a big writer) Insertion - Deletion- Mutation How do mutations get passed on?

7 MUTATION VIDEO

8 MUTATION VIDEO Point mutations- mismatched base pair that goes unnoticed. Insertion - When strand breaks and new nucleotides are added to join strand back. Making strand longer. Deletion - when base pairs are deleted making strand shorter. Mutation - Mutations are slight/large changes in the genetic sequence.

9 How does changing the DNA a little bit cause a change in an organism?

10 RECALL PROTEIN CODING This DNA segment from an organism (ATTCGGTCT) has been coding for the proteins that make up the eyes. DNA mrna Amino Acid chain Usual code After mutation ATGCGGTCT ATGGTCT

11 Protein Synthesis What do you think will happen to eyes of the zygote if the gametes had a deletion mutation...or any other mutation? DNA mrna Amino Acid chain Usual code ATGCGGTCT Try - Ala - Arg After mutation ATGGTCT Try - Gln

12 Assignment #10 Genetic Counseling LO: To discuss genetic counseling and to identify different types of genetic changes. EQ: What are the ways new traits come about in a population? AGENDA 11/28-11/29 1. Group task 2. Individual Task 3. Notes 4. Processing Task HOMEWORK 1. Synthesis (Next Wed) 2. Punnett Wksht (Wed) LEVEL ZERO VOICE PROCESSING TASK (10 minutes, individual work): Complete this overview for one of the disorders Genetic Disorder Overview 1. Disorder: 2. Gene: describe the function of the gene 3. Mutation Type: 4. Mutation Explanation: 5. Healthy patient: do a rough sketch of the picture 6. Affected patient: do a rough sketch of the picture 7. Explanation: describe how the affected patient s results are different from the healthy patient.