Supplementary Material for Yang et al., Generation of oligodendroglial cells by direct lineage conversion

Transcription

1 Supplementary Material for Yang et al., Generation of oligodendroglial cells by direct lineage conversion Supplementary Figure 1. The presence of Plp::EGFP + /O4 + cells 21 days after transgene induction. Plp::GFP MEF was transduced with a pool of 10 lentiviruses containing candidate genes. 21 days after transduction, cells expressing Plp::EGFP and O4 were detected. Scale bar: 50 µm.

2 Supplementary Figure 2. Combinations of three transcription factors induce Plp::EGFP expression at different levels. FACS analyses for GFP expression in mouse fibroblasts were performed 1 week after transgene induction.

3 Supplementary Figure 3. O4 + cells proliferate in response to PDGF signal. (a) Fourteen days after transduction, thymidine analogue EdU was added into the media. Six hours after the addition of EdU, cells were fixed for immunostaining using O4 antibody and EdU was detected using the Click-iT EdU cell proliferation kit (Invitrogen). Scale bar: 50 µm. (b) 11.39% ± 6.87 SD of the O4 + cells incorporated EdU within 6 hours.

4 Supplementary Figure 4. Astrocytes but not neurons were generated through reprogramming. (a) GFAP+/O4- astrocytes were detected 20 days after the induction, which constituted 18.11±7.83% of the entire culture. (b) After the purification and differentiation of O4+ cells, GFAP+/Nestin+ astrocyte-looking cells were detected. Scale bar: 50 µm.

5 Supplementary Figure 5. Screen of antibodies recognizing oligodendroglial cells using fibroblasts, OPCs and oligodendrocytes. From the tested panel of antibodies, only S100, O4, Olig2, MBP, MOG, CC1 and CNPase were specifically detected in OPCs or oligodendrocytes.

6 Supplementary Figure 6. Expression of reprogramming factors in O4 + cells. (a) Map of the lentiviral vector used to introduce the reprogramming factors and the schematic drawing of the experimental setup. The forward primer was specific to the candidate gene and the reverse primer was specific to the woodchuck response elements (WRE). (b) Genomic DNA was extracted from O4-immunopanned cells and PCR analysis showed the integration of individual provirus that express specific factors into the genome of O4 + cells.

7 Supplementary Figure 7. The graft-derived MBP+ cells do not express markers of periphery lineage. (a and c) The graft-derived MBP+ cells do not express P0 or Peripherin. (b and d) Positive stainings of P0 and Peripherin in the mouse spinal cord. Scale bar: 50 µm.

8 Supplementary Figure 8. Identification and imaging of the graft-derived myelination in the shiverer mouse corpus callosum. (a) Immunofluorescence of MPB + cells in the shiverer mouse corpus callosum. The asterisks mark two vessels in the vibratome section. (b) The region containing MBP + cells was micro-dissected, post-fixed, epon-imbedded and cut into semi-thin (1 µm)

9 sections. The framed region in (a) was identified in the semi-thin section stained by Toluidine Blue. The asterisks indicate the same vessels observed in (a). The numbers in the red frame in (b) labels the landmarks seen in both (b) and (c), including the small vessels (1, 2 and 6) and neuron soma (3-5). (c) Electronic microscope images of the ultrathin (80-90 nm) sections focusing on the region framed in (b) using the same landmarks. Colored frames highlight the cells shown in (d,e,f). The cell in (e) is the same cell shown in Fig.5g in lower magnification. The numbered signatures correlated to the same ones in (b). (d,e,f) High-magnification TEM images showed the myelin sheath and inserts highlight the ultra-structures. C.C: corpus callosum. Scale bars: 500 nm.

10 Supplementary Table 1 Primers used in this study for qrt-pcr analysis Gene Symbol Forward Primer Reverse Primer Amplicon Size Accession Number mbp taccctggctaaagcagagc gggagccgtagtgggtagtt 111nt NM_ ENSRNOT00000 nkx2-2 gcagcgacaacccctaca acttggagctcgagtcttgg 105nt sox6 caaaggacgaaaggaggaaa ggatttccagcgagatccta 89nt NM_ sox2 attacccgcagcaaaatgac tttttgcgttaatttggatgg 65nt NM_ plp1 ctgccagtctattgccttcc agcattccatgggagaacac 94nt NM_ tubb4 gtcttccgaggacggatgt ttgctctgcacacttagcatc 62nt NM_ col5a1 gaattcaagcgtgggaaact ggcagaggcactcagcag 99nt NM_ col1a1 tgcttgaagacctatgtgggta aaaggcagcatttggggtat 71nt NM_ beta-actin cccgcgagtacaaccttct cgtcatccatggcgaact 72nt NM_

11 Supplementary Table 2 List of genes with higher expression level in the iopcs compared to fibroblasts, OPCs and differentiated OPCs. Gene Title Gene Symbol (iopc vs. Fibroblasts) Fold-Change (iopc vs. day3 OL) (iopc vs. day6 OL) (iopc vs. OPC) myelin protein zero Mpz region containing similar to NGF-binding Ig light chain LOC tyrosinase-related protein 1 Tyrp cadherin 1 Cdh desert hedgehog homolog (Drosophila) Dhh hydroxy-3-methylglutaryl-Coenzyme A synthase 2 Hmgcs olfactomedin-like 2A Olfml2a laminin, alpha 2 Lama CUE domain containing 2 Cuedc prepronociceptin Pnoc neurofilament, light polypeptide Nefl sodium channel, voltage-gated, type VII, alpha Scn7a hypothetical protein LOC LOC sulfotransferase family, cytosolic, 1B, member 1 Sult1b reelin Reln hypothetical protein LOC LOC myelin protein zero Mpz neuropeptide Y Npy melanoma inhibitory activity Mia superoxide dismutase 3, extracellular Sod fibrinogen beta chain Fgb calpain 6 Capn family with sequence similarity 180, member A Fam180a decorin Dcn

12 Supplementary Table 3 GO analyses of genes with higher expression level in the iopcs compared to fibroblasts, OPCs and differentiated OPCs. GO enrichment P-Value extracellular structure organization 6.83E-05 extracellular matrix organization 3.88E-04 transmission of nerve impulse response to organic substance thyroid hormone metabolic process protein polymerization