SUPPLEMENTARY INFORMATION

Transcription

1 doi: /nature10202 Supplementary Figure 1: Rapid generation of neurons from human ES cells. a, Phase contrast image of feeder-free culture of human ES cells infected with Brn2, Ascl1, Myt1l (BAM) and EGFP 2 days after infection. b-d, BAM-ES cells rapidly acquired neuronal morphologies within 7 days after dox treatment based on EGFP fluorescence microscopy. Inserts show enlarged area of typical morphology of cells at different stages. Scale bars indicate 100 μm. e-g, Scatter data plots of membrane resistance (Rin, e), membrane capacitance (Cm, f) and resting membrane potential (RMP, g) showing the degree of heterogeneity of these parameters. 1

2 Supplementary Figure 2: Quantification and representative images of human ES cells infected with 1-3 BAM factors. a, Quantification of MAP2-positive cells with the indicated 1-3 factor combinations of the genes Brn2 (B), Ascl1 (A) and Myt1l (M) 8 days after infection (average and SD of three randomly taken pictures (AxioCam) with a 20 objective on a Zeiss Axio Observer microscope). The total amount of virus was kept constant between different factor combinations and the same numbers of ES cells were seeded in each condition before infection. b-h, Representative images showing the typical morphology of cells in different conditions. While several conditions produce similar numbers of MAP2-positive cells, the BAM condition appears to generate cells with the most complex neuronal morphologies. Scale bar in b is applicable to all images and indicates 20 μm. 2

3 Supplementary Figure 3: Generation of neurons from human ips cells. a-b, Eight days after induction, BAM-infected ips cells displayed complex neuronal morphologies and expressed the pan-neuronal markers MAP2 (a) and Tuj1 (b). c, Representative traces of action potentials (black traces, 3 traces were overlapped) in response to ramp current injections (lower panel) 15 days after induction. Action potentials could be blocked by application of 10-6 M TTX. Membrane potential was maintained at around 63mV. d, Wholecell currents in an ips-in cell. Insert, fast activating and inactivating sodium currents. Lower panel indicates the protocol applied. e, Whole-cell currents in the presence of 10-6 M TTX. Open arrowhead indicates that prominent voltage-dependent sodium currents were blocked by TTX. Lower panel indicates the protocol applied. f, Membrane potential changes including action potential generations in response to step current injections (lower panel) in an in cell generated from BAMN-infected ips cells. Scale bars: 10μm (a,b). 3

4 Supplementary Figure 4: RT-PCR and immunofluorescence characterization of primary human fibroblast lines a, The human fetal fibroblast lines (HFF-A, B, C) and the human postnatal fibroblast lines (HPF- A, B) were grown for 2 weeks in three different conditions each: (i) in MEF media (DMEM+10% serum), (ii) N3 media a serum-free media supporting the survival of various neural cell types, (iii) N3 media + GFs = N3 media supplemented with EGF and FGF2, a condition known to promote neural progenitor growth. The cells were fixed and stained for antibodies known to recognize the human Brn2, GFAP, Sox2, MAP2, PSA-NCAM, Tuj1, Sox10 4

5 and Pan-Cytokeratin (clone Lu-5). For all antibody stainings except Tuj1 no single positive cell could be detected in 100, ,000 cells screened per condition and cell line. The Tuj1 antibodies weakly labeled the majority of the fibroblasts mostly in a diffuse cytoplasmatic pattern. The staining intensity in fibroblasts was orders of magnitudes lower than that in neurons (compare to positive control staining below). Our RT-PCR analysis on the bulk population (see below) and single cell level (see Fig. 2h) confirmed expression of tubulins on the RNA level. We were not surprised to see low level Tuj1 expression in fibroblasts as we have seen the same phenomena in mouse fibroblasts before 11. Note: For this reason when in cells were quantified in this manuscript we included only bright Tuj1-positive cells with a round soma and processes of at least the length 3 of the diameter of the soma. We conclude that none of the cultures have the potential to spontaneously differentiate into neurons. Shown are representative images of the stained fibroblast lines HFF-A and HPF-B under the indicated culture conditions. Bottom panel: positive control stainings: Brn2 (transfected fibroblasts), GFAP (mouse glia), Sox2 (mouse precursor cells), MAP2 (5 week old HFF-iN cells), PSA-NCAM (5 week old HFF-iN cells), Tuj1 (5 week old HFF-iN cells), Sox10 (human melanoma), Pan-Cytokeratin staining (clone Lu- 5, human keratinocytes). b, RT-PCR analysis of the three fetal and two of the three foreskin fibroblast lines generated. Fibroblasts were grown in different conditions as described above. Human total brain RNA (Invitrogen) was used for positive control reactions except otherwise stated. As expected, nestin, Tuj1, and sox9 mrnas were detected in all samples. Brn1, Gfap, and Pax6 were not detectable. For some lines we detected low level expression of p75 and Sox10. This may suggest the presence of small numbers of neural crest-derived cell types in these cultures. Please note that we tested lines HFF-A and HPF-B also for the presence of Sox10-postive cells by immunofluorescence (see above). While the positive control sample gave a strong and specific staining pattern we could not detect any positive cells in either line (out of about 100,000 cells screened). Thus, either the RNA signal stems from cells with extremely low Sox10 expression levels (that would not be typical for neural crest stem cells) or from very few high Sox10-expressing cells (less than 1:100,000). Ncx1 (also known as Tlx2) was not detected in any sample or media condition. Msx1 and Slug transcripts were detected in all samples, which was not surprising given their broad-spectrum expressions in endoderm and mesoderm originated tissues (see e.g. Cobaleda et al. 2007, Ann. Rev. Genet. Vol. 41, 41-61; Hatano et al., 1997 Anat. Embryol. 195(5):419-25; Davidson 1995, Trends Genet. 11(10):405-11). Human 5

6 spinal cord total RNA (DV Biologics) was used for positive control reactions for Ncx1, Msx1 and Slug. In summary, the absence of some and presence of other neural crest-associated markers shows that the proportion of neural crest stem cells must be below our detection limit. Importantly, even the potentially few numbers of neural crest cells in the cultures (i) have no endogenous neurogenic potential (ii) could not explain the relatively high efficiency rates to generate neuronal cells. Please also note that we focused our analysis on those lines in which neither Sox10 nor p75 mrna expression was detected (HFF-A and HPF-B). 6

7 Supplementary Figure 5: Morphological and functional properties of IMR-90-derived BAM-iN cells. a, Human IMR-90 fetal lung fibroblasts infected with BAM and EGFP. Twenty days after dox treatment the cells exhibited Tuj1 expression and typical neuronal morphologies. In contrast, cells infected with the EGFP virus alone did not exhibit any neuron-like morphologies up to 3 weeks post infection. b, Membrane properties of IMR-90 derived in cells. Single, action potential-like responses could be recorded following step current injections (n=4). Membrane potential was held around 66mV. Scale bar:100 μm. 7

8 Supplementary Figure 6: Quantification, morphology and functional characterizations of human fetal fibroblasts infected with different combination of BAMN pool viruses. a, The number of Tuj1-positive neuronal cells were determined in the various indicated 2-, 3, and 4- Factor conditions (B=Brn2, A=Ascl1, M=Myt1l, N=Neurod1). Shown are average numbers and standard deviations per 20 visual field (n=8 fields). b, Left panel; Tuj1 staining of human fibroblast under indicated conditions; right panels; Representative membrane potential changes in response to ramp current injections. Cells were maintained at membrane potential as indicated 8

9 in each trace. A 500 pa ramp with 1sec duration protocol was applied. n equals the number of neurons recorded from three independent cultures. Bar=50 m. While the 2-Factor condition BN was surprisingly efficient to generate cells with neuronal morphology, action potentials were observed in a subpopulation of cells. On the other hand, the BAMN condition yielded similar amount of neuronal cells but those were able to generate repetitive action potentials. 9

10 Supplementary Figure 7: Generation of human in cells from multiple HFF lines. HFF-A derived in cells express Tuj1 (green) and Neurofilament (NF, red) (a), Synaptotagmin 1 (Syt1, red) (b). Immunofluorescence analysis of HFF-B derived in cells with Tuj1(c) and PSA-NCAM (d) antibodies. e, Representative traces of membrane potentials in response to step hypopolarization and depolarizations. f-g, Immunofluorescence analysis of HFF-C derived in cells with Tuj1 (f) and PSA-NCAM (g) antibodies. h, Representative traces of membrane potentials in response to step hypoplarization and depolarizations. i, Scatter plots showing the distribution of intrinsic membrane properties between individual cells (Rin = input resistance, Cm = capacitance, RMP = resting membrane potential). Bar=10 m. 10

11 Supplementary Figure 8: Single cell collection guided by fluorescence and light microscope. a, A merged image of fluorescence and DIC images showing the morphology of an in cell generated from HFF cells infected with BAMN and EGFP. A glass pipette was placed near the cell body. b-c, DIC images showing the cell body of the in cell was aspirated into the pipette tip. d, Merged fluorescence and bright-field images shows that a single fluorescent cell was collected. Aspirated cells were collected into individual PCR tubes containing 5 µl 2 cellsdirect reaction buffer (Invitrogen) by positive pressure and processed for single-cell gene profiling using Fluidigm technology. Bar=10 µm. 11

12 Supplementary Figure 9: in cells derived from HFF cells express Tbr1 and Peripherin a-c, Representative images of HFF-iN cells expressing GFP (a), Tbr1 (b), and DAPI (c). d, Merged picture of a-c. The arrowhead indicates a Tbr1-positive in cell; the asterisk indicates a Tbr1-negative in cell. e and f, Representative images of HFF-iN cells expressing peripherin. g, An merged picture of EGFP (green) and peripherin staining (red) showing a peripherin-positive and a peripherin-negative in cell. Scale bars: in (d)=10 µm, applies to a-c; in (e)=50 µm and in (g)=10 µm and applies to (f). 12

13 Supplementary Figure 10: Endogenous and exogenous mrna expression levels of BAMN factors. The transcript levels of the endogenous (human) genes and exogenous (mouse) genes were quantified in human fetal fibroblasts that were (i) uninfected (before), (ii) infected but in absence of dox (no dox), (iii) 48h after infection and dox treatment (dox 48 h), and (iv) cultured for 2 weeks in dox and another 10 days without dox (dox withdrawal, dox WD). Quantitative RT-PCR reactions were performed using SYBR Green (Applied Biosystems, see methods) according to manufacturer s recommendations, relative mrna levels were calculated by the delta-delta-ct method and normalized to mrna levels of each gene at 48 hours after addition of dox. Primers were designed to specifically amplify either the human UTR or the mouse coding sequence of the respective cdnas. Primer sequences are listed in Suppl. Table

14 Supplementary Figure 11: HFF-iN cells do not require continuous expression of exogenous BAMN factors to retain a neuronal phenotype. HFF-iN cells 5 weeks after BAMN infection. Cells were treated with dox for the initial 2 weeks of culture, and cultured in the absence of dox for the remaining 3 weeks. a-c, Immunofluorescence analyses were performed for Tuj1 (a), MAP2 (b) and PSA-NCAM (c) to confirm retention of neuronal characteristics. d, HFF-iN cell generated action potentials upon current injections. Bar=20 m. 14

15 Supplementary Figure 12: Membrane properties of HFF-iN cells a, Spontaneous action potentials recorded from an in cell 25 days after infection (observed in 1/42 cells recorded). b, Representative traces of induced action potentials by a ramp depolarization (500 pa over 1 sec) with or without 1 M TTX. Two traces from each condition were overlayed. TTX effectively blocked the formation of action potentials. c, Representative 15

16 traces of whole-cell currents measured in voltage-clamp mode. Cell was held at -70 mv, voltage was increased stepwise from -90 mv to +60 mv in 10 mv intervals. d, Current-voltage relationship of outward whole-cell currents recorded from HFF-iN cells. Currents were measured at 50 ms before the end of the pulse (arrow indicated in c). Cells were held at -70 mv, 500 ms durations of voltage steps from -90 mv to +80 mv, at 10 mv intervals, were applied (n=3). e. Inward current response following application of 10-4 M GABA from a pipette using a picospritzer (n=4); lower trace shows that application of picrotoxin, a specific antagonist of GABA A receptors, blocks the GABA-induced current response. The internal solution contained ~135 mm Cl - explaining the inward current response. Cells were held at -70 mv. f. Inward current responses following application of 10-3 M L-glutamate from a pipette using a picospritzer (n=4). Lower panel indicates that glutamate-induced current response could be blocked by CNQX, a specific antagonist of AMPA receptors. Cells were held at -70 mv. g, Scatter plots showing the distribution of intrinsic membrane properties between individual cells of HFF-A and HPF-B at indicated time points after infection (Rin = input resistance, Cm = capacitance, RMP = resting membrane potential). Note the observed heterogeneity. 16

17 Supplementary Figure 13: Gene expression analyses of in cells derived from HPFs a-c, Representative images of HPF cultures 6 weeks after infection with BAMN and EGFP viruses (a), Tbr1 (b), and DAPI (c). d, Merged picture of a-c. Almost all postnatal fibroblasts expressed Tbr1 in the nucleus (asterisks) but the signal was much weaker than in in cells. ImageJ (NIH) software was used to quantify the numbers of Tbr1-positive in cells expressing higher levels than the average fibroblast expression level. To achieve this, images of Tbr1 staining were taken at constant exposure time (20 objectives). Background fluorescence was subtracted from the whole picture by threshold level to exclude the signal of the weakly stained fibroblast nuclei. Resulting Tbr1/DAPI-positive structures per in cells was quantified. e, Representative images of HPF-iN cells expressing Peripherin. f, Single cell gene expression profiling using Fluidigm dynamic arrays. Rows represent the evaluated genes and columns represent individual cells. Heatmap (blue to red) represents the threshold Ct values as indicated. Scale bars=10 µm. 17

18 Supplementary Figure 14: in cells derived from skin fibroblasts of an 11-year-old human a, Representative pictures of Tuj1 (left panels) and MAP2 (right panels) staining of in cells generated from a primary culture of dermal fibroblasts 21 days after BAMN transduction. b, Representative traces of membrane potential changes in response to a ramp current injection. c, Representative traces of whole-cell currents in response to a ramp voltage depolarization. Fast activating and inactivating sodium currents were shown. Bar=50 m 18

19 Supplementary Figure 15: in cells derived from HPF cells receive synaptic inputs from mouse cortical neurons. HPFs were infected with BAMN-factor and human synapsin promoter-driving td-tomato. Fourteen days after transduction, in cells expressing td-tomato were insolated by FACS and seeded on mouse cortical neuronal cultures established 5 days before. Fourteen days after replating (28 days after dox), two out of six recorded cells showed unambiguous synaptic responses. The trace shows an example of the spontaneous bursting synaptic activity recorded from one in cell integrated into the mouse cortical neuronal network in vitro. The lower panel shows expanded traces indicating the kinetics of the synaptic responses. 19

20 Supplementary Table 1: Electrophysiological characterizations of human ES-iN and HFFiN cells. Electrophysiological Parameters in human in cells Average ± S.E. N p Value hes-in cells Membrane Input Resistance (GΩ) Day ± Day ± p<0.001 Day ± p<0.001 Membrane Capacitance (pf) Day ± Day ± p<0.001 Day ± p<0.001 RMP (mv) Day ± Day ± p<0.001 Day ± p<0.001 After-hyperpolarization potential (mv) Day 0 n.a. n.a. 12 Day ± Day ± AP (Spontaneous and Induced) Spontaneous Induced Total neurons recorded Day 0 n.d. n.d. 12 Day Day Human Fetal Fibroblast (HFF) - in cells Membrane Input Resistance (GΩ) HFF-A (Day 14-25) 1.77 ± HFF-A (Day 34-35) 1.11 ± p<0.05 HFF-B (Day 24) 1.24 ± HFF-C (Day 24) 1.35 ± Membrane Capacitance (pf) HFF-A (Day 14-25) ± HFF-A (Day 34-35) ± p<0.001 HFF-B (Day 24) ±

21 HFF-C (Day 24) 17.4 ± RMP (mv) HFF-A (Day 14-25) ± HFF-A (Day 34-35) ± n.s. HFF-B (Day 24) ± HFF-C (Day 24) ± AP (Spontaneous and Induced) Spontaneous Induced Total neurons recorded 28 (9 with AP like HFF-A (Day 14-25) 1 responses) 42 HFF-A (Day 34-35) HFF-B (Day 24) HFF-C (Day 24) Synaptic activities (co-cultured with mouse cortical neurons) HFF-A Spontaneous only Evoked only Spontaneous & Evoked Total neurons recorded Day Day Human Postnatal Fibroblast (HPF) - in cells (Day 28 to 35 after infection) Membrane Input Resistance (GΩ) HPF-A 1.56 ± HPF-B 1.58 ± HPF-C 1.34 ± Membrane Capacitance (pf) HPF-A 23.2 ± HPF-B ± HPF-C 19.8 ± RMP (mv) HPF-A -39 ± HPF-B ± HPF-C -46 N.A 2 AP (Spontaneous and Induced) Spontaneous Induced Total neurons recorded HPF-A HPF-B HPF-C

22 Synaptic activities (co-cultured with mouse cortical neurons) HPF Spontaneous only Evoked only Spontaneous & Evoked Total neurons recorded Day Note: hes-in cells were induced using BAM pool and HFF-iN cells and HPF-iN cells were induced using BAMN pool of transcription factors. AP: Action Potential; HFF: Human fetal fibroblast (lines A, -B, and C); HPF: Human postnatal fibroblast (lines A, -B and C); RMP: Resting Membrane Potential. Student t-tests were used for statistical analysis. 22

23 Supplementary Table 2 Primers used in this study for Fluidigm dynamic array RT-PCR, RT-PCR, and quantitative RT-PCR. Gene Symbol NCBI acc. No. primer sequences sense/antisense method ACTB NM_ ccaaccgcgagaagatga sense F ccagaggcgtacagggatag antisense F CAMKIIB NM_ gagccatcctcaccaccat sense F tattcgtctggggcttgact antisense F DCX NM_ catccccaacacctcagaag sense F ggaggttccgtttgctga antisense F GAD65 M ctcattgccttcacgtctga sense F gctgtctgttccaatccctaa antisense F GAD67 NM_ atggtgatgggatattttctcc sense F gccatgccctttgtcttaac antisense F GFAP NM_ ccaacctgcagattcgaga sense F tcttgaggtggccttctgac antisense F GAPDH NM_ agccacatcgctcagacac sense F gcccaatacgaccaaatcc antisense F MAP2 NM_ cctgtgttaagcggaaaacc sense F agagactttgtcctttgcctgt antisense F NCAM NM_ taccgcggcaagaacatc sense F ccacctgcagagaaactgc antisense F OLIGO2 NM_ agctcctcaaatcgcatcc sense F atagtcgtcgcagctttcg antisense F PAVLB NM_ caaaattggggttgacgaa sense F ggggcagtcagtgcttctta antisense F SYN1 NM_ gacggaagggatcacatcat sense F ctggtggtcaccaatgagc antisense F TUBB3 NM_ gcaactacgtgggcgact sense F cgaggcacgtacttgtgaga antisense F TH NM_ gccaaggacaagctcagg sense F agcgtgtacgggtcgaact antisense F VGAT AK ccacgacaagcccaaaat sense F taggcccagcacgaacat antisense F VGAT NM_ cacgacaagcccaaaatcac sense F NM_ agatgatgagaaacaaccccag antisense F vglut1 ENST cacgtggtggtgcagaaa sense F cgtgtatgaggccgacagt antisense F VGluT1 NM_ tcaataacagcacgacccac sense NM_ tcctggaatctgagtgacaatg antisense F F 23

24 Gene Symbol NCBI acc. No. primer sequences sense/antisense method VGLUT2 ENST aatcactcggccagatctaca sense F cgtcagctcgattgtctcc antisense F VGLUT3 AJ tggccacaacctctttttg sense F ccatccaatgtactgcacca antisense F NESTIN NM_ agacttccctcagctttcaggaccc sense R ctctggtccaggcaggacgct antisense R BRN1 NM_ tctattgtgcactcggacgcgg sense R ggtggctgctgggggctg antisense R GFAP NM_ gcacgaacgagtccctggagag sense R aatgacctctccatcccgcatctc antisense R PAX6 NM_ gccagcaacacacctagtca sense R ggggaaatgagtcctgttga antisense R p75 NM_ ctgcaagcagaacaagcaag sense R ggcctcatgggtaaaggagt antisense R SOX9 NM_ ggcgagcactcggggcaatc sense R gcctgctgcttggacatccacac antisense R SOX10 NM_ gaaagaccacccggactaca sense R tccaactcagccacatcaaa antisense R TUJ1 NM_ gagcggatcagcgtctactacaa sense R gatactcctcacgcaccttgct antisense R mascl1 NM_ agggatcctacgaccctctta sense Q accagttggtaaagtccagcag antisense Q mbrn2 NM_ gacacgccgacctcagac sense Q gatccgcctctgcttgaat antisense Q mmyt1l NM_ cctatgaggaccagtctcca sense Q tcttttctgttcgagggatctt antisense Q mneurod1 NM_ gtcccagcccactaccaat sense Q caagaaagtccgagggttga antisense Q hgapdh NM_ agccacatcgctcagacac sense Q gcccaatacgaccaaatcc antisense Q hascl1 NM_ caagagagcgcagccttag sense Q gcaaaagtcagtgctgaacg antisense Q hbrn2 NM_ aataaggcaaaaggaaagcaact sense Q caaaacacatcattacacctgct antisense Q hmyt1l NM_ caatggaaagggattttaagca sense Q tttgagattatgtaccaacgttagatg antisense Q hneurod1 NM_ gttattgtgttgccttagcacttc sense Q agtgaaatgaattgctcaaattgt antisense Q Note: F: primers for Fluidigm assays; R: primers for RT-PCR; Q: primers for qrt-pcr. 24