supplementary information
|
|
|
- David Sanders
- 5 years ago
- Views:
Transcription
1 DOI: /ncb1992 Figure S1 (a-b) Verification of actin flow patter using photobleaching of actin:gfp and Lifeact:RFP in migrating dendritic cells (DCs). (a) Actin:GFP and Lifeact:RFP double-trafected DC migrating under agarose in a CCL19 gradient imaged with a spinning disc confocal microscope. The region in the dotted box was bleached with a 405nm focused laser beam, leading to bleaching of the actin:gfp signal whereas Lifeact:RFP recovers almost immediately. (b) Kymographic analysis of (a) (yellow line); the retrograde actin flow directly at the very leading edge is highlighted by a dashed yellow line and the bleached actin:gfp is highlighted by a yellow arrowhead, demotrating the same pattern of the actin:gfp speckle signal, the bleached actin:gfp signal and the Lifeact:RFP signal. (c-d) Undisturbed migration of integrin deficient dendritic cells in under agarose assays. (c) Scheme of the experimental setup of the under agarose assay. (d) Wild-type (Wt) and integrin -/- (Itg -/- ) dendritic cells migrating under agarose. x indicates time in seconds. 1
2 Figure S2 Verification of actin flow patter using photobleaching of actin:gfp trafected dendritic cells (DCs). DCs migrated under agarose in CCL19 gradients and were imaged with a spinning disc confocal microscope. (a) Fluorescence recovery after photobleaching: the region in the dotted box was bleached with a 405nm focused laser beam. Yellow arrowheads mark the bleached area that undergoes retrograde movement, while the leading edge advances over time. The right panels show inteity sca of the area marked with the yellow line in the left panels. The dotted grey line in the inteity diagram demarks the site of initial photobleaching, the green bars indicate the position of the leading edge, yellow bars the position of the bleached area. Green and yellow arrows on the bottom of the diagrams indicate the advancement of the leading edge (protrusion) and the retrograde slippage of the actin cortex (retrograde flow). Note that the bleached area moves backward almost without recovering in inteity, indicating that actin polymerization occurs predominantly at the leading edge. (b) A fluorescent localization after photobleaching type of experiment to exclude that bleaching directly at the leading edge induces an artificial behavior. The region in the dotted box was bleached as in (a). Yellow arrowheads demarcate the line where the first bleached G-actin monomers are incorporated into the leading edge cortex. Subsequently this line moves backward with the retrograde flow while the leading edge advances. Right panels show inteity sca of the area marked with a yellow line in the left panels. The grey dotted line in the inteity diagrams indicates the position of the leading edge at the time point of bleaching. The green line marks the position of the advancing leading edge, the yellow line the area where the first bleached monomers are incorporated. Green and yellow arrows on the bottom of the diagrams indicate the advancement of the leading edge (protrusion) and the retrograde slippage of the actin cortex (retrograde flow). x indicates time in seconds. a.u.: arbitrary units. 2
3 Figure S3 Verification of actin flow patter on the inert substrate polyethylene glycol (PEG) using photobleaching of actin:gfp trafected dendritic cells (DCs). DCs migrated under agarose in CCL19 gradients on PEG coated substrates and were imaged with a spinning disc confocal microscope. (a) Fluorescence recovery after photobleaching: same experimental set-up and figure labelling as in Fig. S2a. (b) A fluorescent localization after photobleaching type of experiment to exclude that bleaching directly at the leading edge induces artificial behavior: same experimental set-up and figure labelling as in Fig. S2b. x indicates time in seconds. a.u.: arbitrary units. 3
4 Figure S4 Verification of actin flow patter in Itg -/- dendritic cells using photobleaching of actin:gfp trafected Itg -/- dendritic cells (DCs). DCs migrated under agarose in CCL19 gradients and were imaged with a spinning disc confocal microscope. (a) Fluorescence recovery after photobleaching: same experimental set-up and figure labelling as in Fig. S2a. (b) A fluorescent localization after photobleaching type of experiment to exclude that bleaching directly at the leading edge induces an artificial behavior: same experimental set-up and figure labelling as in Fig. S2b. x indicates time in seconds. a.u.: arbitrary units. 4
5 Figure S5 Membrane flow dynamics following photobleaching of the leading edge of dendritic cells (DCs) labelled with a membrane dye. DCs labelled with the plasma membrane dye DiO migrated under agarose in CCL19 gradients on a PEG coated glass substrate and were imaged with a spinning disc confocal microscope. Fluorescence recovery after photobleaching (FRAP): the region in the dotted box was bleached with a 405nm focused laser beam and subsequent images were recorded every 200 ms. Right panels are line sca illustrating the recovery of fluorescence inteity along the yellow line indicated in the left panels. The grey dotted line in the inteity diagrams indicates the position of the leading edge at the time point of bleaching. The green line marks the position of the advancing leding edge. x indicates time in seconds. a.u.: arbitrary units. 5
6 Figure S6 (a-f) The movement of MLC:GFP follows the same principal trajectories as F-actin and MLC-patches gradually converged at the trailing edge, reflecting their contractile activity. (a) Lifeact:GFP trafected dendritic cell (DC) migrating under agarose in a CCL19 gradient. (b) Kymographic analysis through the vertical cell axis (yellow line 1 in (a)). (c) Kymographic analysis along the horizontal cell axis (yellow line 2 in (a)). (d) MLC:GFP trafected DC migrating under agarose in a CCL19 gradient. (e) Kymographic analysis along the vertical cell axis (yellow line 1 in (d)). (f) Kymographic analysis along the horizontal cell axis (yellow line 2 in (d)). Flow directio are highlighted by dashed yellow lines. MLC: myosinlight chain. (g-h) Retrograde flow in the absence of integri is not caused by increased myosin II dependent contractility. Quantitative analysis of retrograde flow velocities of dendritic cells (DCs) migrating under agarose in CCL19 gradients. (g) Blebbistatin (50µM) treated vs. untreated integrin -/- (Itg -/- ) DCs migrating under agarose (n Contr =30; n Bleb =9). (h) Blebbistatin treated wild-type (Wt) vs. Itg -/- DCs migrating under agarose (n Wt =10; n Itg- /- =9). Numbers indicate mean values +/- SD (in brackets). For statistical analysis see Supplementary Information, table S1. 6
7 Figure S7 β2 integri mediate tramembrane force coupling in the under agarose assay. Quantitative analysis of retrograde flow velocities of dendritic cells migrating under agarose in CCL19 gradients. Cells of the following genotypes were analyzed: (a, d) Itgb1 -/- ; (b, e) Itgb2 -/- ; (c, f) Itgb2 only, meaning cells that express only β2 integri and no other integri. (a-c) show images with the yellow line indicating the area displayed as a kymograph in (D-F). Here the dotted lines mark retrograde flow velocities. (g) shows the quantitative analysis in comparison to the data sets of integrindeficient (Itg -/- ) and wild-type (Wt) cells (displayed in Fig. 2). : not significant; Single asterisks always denote P < Numbers in brackets in G and H represent median, 25% and 75% percentile (n Itgb1-/- =13; n Itgb2-/- =32; n Itgb2only =15). For statistical analysis see tables S1 and S2. 7
8 Figure S8 (a) Indication that the friction between actin cortex and membrane is mainly due to force coupling via integri. Quantitative analysis of retrograde flow velocities of wild-type (wt) and Itg -/- dendritic cells (DCs) migrating under agarose in CCL19 gradients on serum or on ConcavalinA (ConA). DCs were unable to migrate ConA as the membrane was glued to the surface due to the upecific binding of membrane carbohydrates to ConA (not shown). Note that actin retrograde flow rates are similar between wt DCs on serum coated surfaces and wt DCs on ConA, and similar between Itg -/- DCs on serum coated surfaces and Itg -/- on ConA. Numbers in brackets represent median, 25% and 75% percentile (n WtSerum =33; n WtConA =29; n Itg-/-Serum =29; n Itg-/-ConA =30). For statistical analysis see Supplementary Information, table S1. (b-c) Kymograph analysis of a dendritic cell migrating on polyethylene glycol (PEG), highlighting the convergence zone of actin flow. (b) Time-lapse sequence, the yellow line marks the region depicted in (c) as a kymograph. (c) Kymographic analysis of (b), the actin flow directio are highlighted by yellow dotted lines. x indicates time in seconds. 8
9 Figure S9 (a-d) Increased actin polymerization rate in macrophages on polyethylene glycol (PEG) vs. serum coated surfaces. Lifeact:GFP trafected macrophage in the under-agarose-assay (a) on a serum-coated surface or (c) on PEG. (b) and (d) show the kymographic analysis of the yellow line regio in (a) and (c), respectively, the actin retrograde flow is highlighted by yellow dotted lines. (e) Quantitative analysis of retrograde flow velocities. Numbers in brackets represent median, 25% and 75% percentile (n Glas =23; n PEG =19). (f) Quantitative analysis of actin polymerization rates (n Glas =9; n PEG =8). For statistical analysis see Supplementary Information, table S1. (g) Schematic of protrusion and retrograde actin flow velocities upon different degrees of force coupling. Note that retrograde actin flow velocities enhance upon uncoupling whereas the protrusion velocity stays cotant, leading to an enhanced actin polymerization rate (as the sum of protrusion and retrograde flow) at the leading edge. 9
10 Supplementary movie legends Movie S1 Comparison of retrograde actin flow patter in Lifeact:RFP and actin:gfp double-trafected dendritic cells. Dendritic cells migrate under agarose towards a CCL19 gradient. Photobleaching in the centre leads to integration of bleached actin:gfp monomers directly at the cellular front with a subsequent backward movement (left panel), whereas Lifeact:RFP directly recovers (right panel). Spinning disc confocal microscopy, time-lapse over 32s after photobleaching (2 s/frame), the scale bar is equal to 5μm. Movie S2 The pushing force of actin polymerization is not the sole force driving actin retrograde flow. The G-actin sequestering drug latrunculin is added to a Lifeact:GFP trafected dendritic cell adherent to poly-l-lysine. The membrane stays attached to the substrate, whereas the actin cytoskeleton moves into the cell upon latrunculin treatment, indicating that actin polymerization is not the sole force driving actin retrograde flow. The sequence shows the timepoints directly following latrunculin addition. TIRF microscopy, time-lapse over 200s (1 s/frame), the scale bar is equal to 5μm. Movie S3 Actin polymerization and myosin II activity are the main forces acting onto the actin cytoskeleton of dendritic cells. Before the addition of the actin-polymerization-inhibiting drug latrunculin to a Lifeact:GFP trafected dendritic cell adherent to poly-l-lysine, the myosin- inhibiting drug Blebbistatin is added. This pretreatment leads to an almost complete stalling of actin dynamics, indicating that actin polymerization and myosin II activity are the main forces acting onto the actin cytoskeleton of dendritic cells. The sequence shows the timepoints directly before, 10 min after Blebbistatin addition and directly following latrunculin addition (time-lapse over 38s, 30s and 34s, respectively). TIRF microscopy, 1 s/frame, the scale bar is equal to 10μm. Movie S4 Spatial and temporal dynamics of the actin cytoskeleton in dendritic cells. Lifeact:GFP trafected dendritic cell migrates under agarose towards a CCL19 gradient. The cell shows a broad leading edge with a diffusely protruding actin-cortex and a trailing edge with thicker actin bundles. TIRF microscopy, time-lapse over 50s (1 s/frame), the scale bar is equal to 10μm. Movie S5 Retrograde actin flow measurements in actin:gfp expressing dendritic cells by fluorescence recovery after photobleaching. Actin:GFP trafected dendritic cells migrate under agarose towards a CCL19 gradient. Photobleaching at the leading edge (left panel) leads to integration of actin monomers directly at the cellular front, whereas the bleached area moves backwards into the cell center. Photobleaching in the centre (right panel) leads to integration of bleached actin:gfp monomers directly at the cellular front with a subsequent backward movement. The sequence shows timepoints before and after photobleaching. Spinning disc confocal microscopy, time-lapse over 3,5s before and 25s after photobleaching (0.5 s/frame), the scale bar is equal to 5μm. Movie S6 Membrane flow measurements in dendritic cells by fluorescence recovery after photobleaching. Dendritic cells are labelled with the fluorescent lipid dye DiO to label membrane lipids and migrate under agarose towards a CCL19 gradient on a PEG coated substrate. Photobleaching at the leading edge does not lead to a preferential recovery at the cell front. The sequence shows timepoints in pseudocolours (reflecting the distribution of fluorescence inteity) before and after photobleaching. Spinning disc confocal microscopy, time-lapse over 3,5s before and 25s after photobleaching (0.5 s/frame), the scale bar is equal to 5μm. Movie S7 Spatial and temporal dynamics of myosin II in dendritic cells. A MLC-GFP trafected dendritic cell migrates under agarose towards a CCL19 gradient. The dot-like appearance of MLC with a deity gradient decreasing from the cell rear to the front can be seen. The leading edge is completely devoid of signal and the MLC patches started to materialize 5-10 µm behind the leading front. TIRF microscopy, time-lapse over 120s (2 s/frame), the scale bar is equal to 10μm. Movie S8 Spatial and temporal dynamics of the actin cytoskeleton in integrin-deficient dendritic cells. Lifeact:GFP trafected integrin -/- dendritic cell migrates under agarose towards a CCL19 gradient. The actin retrograde is dramatically increased in comparison to wild-type dendritic cells, whereas protrusion velocity is unaffected. TIRF microscopy, time-lapse over 70s (1 s/frame), the scale bar is equal to 10μm. Movie S9 Spatial and temporal dynamics of myosin II in integrin-deficient dendritic cells. MLC-GFP trafected integrin -/- dendritic cell migrates under agarose towards a CCL19 gradient, displaying an enhanced retrograde movement of MLC in comparison to the MLC movement in wild-type dendritic cells. TIRF microscopy, time-lapse over 150s (1 s/frame), the scale bar is equal to 10μm. Movie S10 Increased actin polymerisation rate and retrograde flow velocity upon uncoupling of the molecular clutch on an inert substrate. Lifeact:GFP trafected dendritic cell migrates under agarose towards a CCL19 gradient on an inert substrate (polyethylene glycol), displaying an enhanced retrograde actin flow. TIRF microscopy, time-lapse over 150s (1 s/frame), the scale bar is equal to 10μm. Movie S11 Fibroblasts strictly adapt their shape to the adhesive surface, but form short protrusio onto the inert substrate which goes in hand with a massive retrograde actin flow. Lifeact:GFP trafected fibroblasts in the under agarose assay on patterned surfaces containing serum-coated tracks alternating with PEG-coated areas. The left panel shows the the Lifeact:GFP signal (and the border of the serum-coated track as a red line), the right panel shows the Alexa555-BSA signal marking the serum-coated tracks. TIRF microscopy, time-lapse over 100s (1 s/frame), the scale bar is equal to 5μm. 10
11 Table S1. Statistical analyses T-tests and ANOVAs were performed after data were confirmed to fulfill the criteria, otherwise Kruskal-Wallis tests or Mann-Whitney U-tests were applied. If overall ANOVA or Kruskal-Wallis tests were significant, we performed posthoc tests with pair-wise comparison (ANOVA: Tukey, Kruskal-Wallis: Dunn). Analyses were performed with Sigma Stat Fig. Test statistic Sample size / degrees of freedom P-value 1b t-test; t=0.53 df=9 P=0.61 1d ANOVA; F=92.1 Posthoc test df=2.29 P<0.001 Tukey, all pairwise P< j U-test; T=21 n1=6, n2=16 P< k t-test; t=0.774 df=60 P= l t-test; t=8.7 df=60 P< g, 3e, S7g, S7h Kruskal- Wallis; H= df=6 P<0.001 Dun, all pairwise, for details see table S2 3f t-test; t=3.2 df=54 P= g Spearman Rank correlation; r=0.12 n=33 P=0.52 4d t-test; t=5, df=12 P<0.001 S6Ba t-test; t=2.786 df=37 S6Bb t-test; t=5.496 df=17 P<0.001 S8A S9Ae S9Af Kruskal- Wallis; H= Mann- Whitney; T= t-test; t= df=3 P<0.001 Dun, all pairwise, n(small)= 19 n(big)= 23 df=15 P<0.001
12 Table S2. Posthoc tests of Figs. 2g, 3e, suppl. fig. 7g, 7h Kruskall Wallis; posthoc all pairwise comparison (Dunn's Method): COMPARISON Itg -/- vs Wt Itg -/- vs Tln -/- Itg -/- vs Itgb2 only Itg -/- vs Wt on PEG Itg -/- vs Tln -/- Itg -/- vs Itgb2 -/- Itgb2 -/- vs Wt Itgb2 -/- vs Itgb1 -/- Itgb2 -/- vs Itgb2 only Itgb2 -/- vs Wt on PEG Itgb2 -/- vs Tln -/- Tln -/- vs Wt Tln -/- vs Itgb1 -/- Tln -/- vs Itgb2 only Tln -/- vs WT on PEG Wt on PEG vs WT Wt on PEG vs Tln -/- Wt on PEG vs Itgb2 only Itgb2 only vs Wt Itgb2 only vs Itgb1 -/- Itgb1 -/- vs Wt P-value
SUPPLEMENTARY INFORMATION
a 14 12 Densitometry (AU) 1 8 6 4 2 t b 16 NMHC-IIA GAPDH NMHC-IIB Densitometry (AU) 14 12 1 8 6 4 2 1 nm 1 nm 1 nm 1 nm sirna 1 nm 1 nm Figure S1 S4 Quantification of protein levels. (a) The microtubule
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection
Supplementary Figures 1-6
1 Supplementary Figures 1-6 2 3 4 5 6 7 Supplementary Fig. 1: GFP-KlpA forms a homodimer. a, Hydrodynamic analysis of the purified full-length GFP-KlpA protein. Fractions from size exclusion chromatography
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Table S1. Definition of quantitative cellular features
SUPPLEMENTARY INFORMATION
DOI: 1.18/ncb46 a Damage Fracture s s 7 5 16 1 9 26 5 µm 5 µm b Position of photo-damage site in cells 15 Counts 1 5-14 -12-1 -8-6 -4-2 Distance from damage site to tip (µm) Supplementary Figure 1 Effect
Asymmetric endocytosis and remodeling of β1-integrin adhesions during growth cone chemorepulsion by MAG
Asymmetric endocytosis and remodeling of β1-integrin adhesions during growth cone chemorepulsion by MAG Jacob H. Hines, Mohammad Abu-Rub and John R. Henley Supplementary Figure 1. Validation of FM 5-95
JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Paul et al.,
Supplemental material JCB Paul et al., http://www.jcb.org/cgi/content/full/jcb.201502040/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Mutant p53-expressing cells display limited retrograde actin flow at
Supplementary Materials for
www.sciencemag.org/cgi/content/full/science.1245533/dc1 Supplementary Materials for A Mechanism for Reorientation of Cortical Microtubule Arrays Driven by Microtubule Severing Jelmer J. Lindeboom, Masayoshi
Supplemental figures (1-9) Gu et al. ADF/Cofilin-Mediated Actin Dynamics Regulate AMPA Receptor Trafficking during Synaptic Plasticity
Supplemental figures (1-9) Gu et al. ADF/Cofilin-Mediated Actin Dynamics Regulate AMPA Receptor Trafficking during Synaptic Plasticity Supplemental figure 1. The quantification method to determine the
MT minus end catastrophe
DOI: 1.138/ncb3241 MT minus end catastrophe frequency [s -1 ].2.15.1.5 control mgfp- TPX2 * * mgfp- TPX2 mini Supplementary Figure 1. TPX2 reduces catastrophes at the microtubule minus ends. Modified box-and-whiskers
Ac(n cytoskeleton 12/7/11. The Cytoskeleton. Func0ons of the Cytoskeleton. B Visegrady. Elements of the Cytoskeleton
The Cytoskeleton Ac(n cytoskeleton B Visegrady The cytoskeleton is an intricate network of protein filaments that extends throughout the cytoplasm. A skin cell (fibroblast) stained with Coomassie blue.
Figure legends for supplement
Figure legends for supplement Supplemental Figure 1 Characterization of purified and recombinant proteins Relevant fractions related the final stage of the purification protocol(bingham et al., 1998; Toba
Actin cap associated focal adhesions and their distinct role in cellular mechanosensing
Actin cap associated focal adhesions and their distinct role in cellular mechanosensing Dong-Hwee Kim 1,2, Shyam B. Khatau 1,2, Yunfeng Feng 1,3, Sam Walcott 1,4, Sean X. Sun 1,2,4, Gregory D. Longmore
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rodríguez-Fraticelli et al., http://www.jcb.org/cgi/content/full/jcb.201203075/dc1 Figure S1. Cell spreading and lumen formation in confined
Visualizing mechanical tension across membrane receptors with a fluorescent sensor
Nature Methods Visualizing mechanical tension across membrane receptors with a fluorescent sensor Daniel R. Stabley, Carol Jurchenko, Stephen S. Marshall, Khalid S. Salaita Supplementary Figure 1 Fabrication
Supplementary Figures
Supplementary Figures Supplementary Figure 1: Collagen gel fibril sizes in vitro and in vivo. (a-b) Box and whisker plots for collagen fibril/bundle diameter (A) and length (B) for HR and FB16 matrices.*
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,
J. Cell Sci. 128: doi: /jcs : Supplementary Material. Supplemental Figures. Journal of Cell Science Supplementary Material
Supplemental Figures Figure S1. Trio controls endothelial barrier function. (A) TagRFP-shTrio constructs were expressed in ECs. Western blot shows efficient Trio knockdown in TagRFP-expressing ECs. (B)
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Craft et al., http://www.jcb.org/cgi/content/full/jcb.201409036/dc1 Figure S1. GFP -tubulin interacts with endogenous -tubulin. Ciliary
Journal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
Fast, three-dimensional super-resolution imaging of live cells
Nature Methods Fast, three-dimensional super-resolution imaging of live cells Sara A Jones, Sang-Hee Shim, Jiang He & Xiaowei Zhuang Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3
Supplementary Figure 1. Differential contribution α5β1 and αv-class integrins to the early adhesion of mouse kidney fibroblasts.
Supplementary Figure 1. Differential contribution α5β1 and αv-class integrins to the early adhesion of mouse kidney fibroblasts. (a) AFM-based single-cell force spectroscopy (SCFS) to characterize the
JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al.,
Supplemental material JCB Hong et al., http://www.jcb.org/cgi/content/full/jcb.201412127/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Analysis of purified proteins by SDS-PAGE and pull-down assays. (A) Coomassie-stained
Combined fluorescence and AFM imaging of cells
Combined fluorescence and AFM imaging of cells Introduction Combining optical and AFM imaging of cells opens up many possibilities for correlating structural information about the cell surface with functional
Supplementary Figure 1. Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect
Supplementary Figure 1 Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect integrin extension (E + ) and mab24 (green) can specifically detect headpiece-opening
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Prashar et al., http://www.jcb.org/cgi/content/full/jcb.201304095/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. FBT phagocytosis in cells expressing PM-GFP. (A) T-PC
Assembly of synapses by neuronal adhesion molecules: single molecule studies
Assembly of synapses by neuronal adhesion molecules: single molecule studies Olivier Thoumine Interdisciplinary Institute of Neurosciences CNRS - University of Bordeaux Connectivity in the brain 300 nm
(B) Comparable expression of major integrin subunits and glycoproteins on the surface of resting WT and Lnk -/- platelets.
Supplemental Figure S1. Characteristics of Lnk -/- platelets. (A) Electron micrographs of resting platelets showing the normal intracellular structure of Lnk -/ platelets. Samples were fixed with 4% PFA
Supplementary Figures
1 Supplementary Figures Supplementary Figure 1 Dynamics of DCL cell division and its relation to cell dispersion during epiboly of A. nigripinnis. (a) Temporal changes in the cumulative number of DCL cell
Imagerie et spectroscopie de fluorescence par excitation non radiative
Imagerie et spectroscopie de fluorescence par excitation non radiative comment s affranchir de la limite de diffraction Rodolphe Jaffiol, Cyrille Vézy, Marcelina Cardoso Dos Santos LNIO, UTT, Troyes NanoBioPhotonics
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/1/494/eaak972/dc1 Supplementary Materials for Blockade of surface-bound TGF-β on regulatory T cells abrogates suppression of effector T cell function in the tumor
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Wang et al., http://www.jcb.org/cgi/content/full/jcb.201405026/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Generation and characterization of unc-40 alleles. (A and
Single Cell Motility in Artificial Tissue
Single Cell Motility in Artificial Tissue Rhoda J. Hawkins Lecturer in Physics, University of Sheffield Raphaël Voituriez, Jean-François Joanny, Jacques Prost Matthieu Piel, Ana-Maria Lennon-Dumenil, Philippe
Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin
Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin (WGA-Alexa555) was injected into the extracellular perivitteline
Resolving Macromolecular Organization in Cells Using Super Resolution Microscopy Karen Porter-Davis Chamblee Charter High School
Resolving Macromolecular Organization in Cells Using Super Resolution Microscopy Karen Porter-Davis Chamblee Charter High School STEP-UP Program 2015 Super Resolution Imaging } Two Projects to Image }
Supplemental Data. Farmer et al. (2010) Plant Cell /tpc
Supplemental Figure 1. Amino acid sequence comparison of RAD23 proteins. Identical and similar residues are shown in the black and gray boxes, respectively. Dots denote gaps. The sequence of plant Ub is
SUPPLEMENTARY INFORMATION
DOI: 0.038/ncb35 Supplementary Figure Effect of Merlin depletion on velocity correlation function and correlations lengths. (a) Representative images showing the sheet migration of MDCK monolayer at the
Acetylated Microtubules Are Preferentially Bundled Leading to Enhanced
Biophysical Journal, Volume 113 Supplemental Information Acetylated Microtubules Are Preferentially Bundled Leading to Enhanced Kinesin-1 Motility Linda Balabanian, Christopher L. Berger, and Adam G. Hendricks
(a) Overview of the 2-helix bundle (2HB) nanospring design used in this study. The
1 Supplementary Figure 1 Design of the DNA origami spring (nanospring). (a) Overview of the 2-helix bundle (2HB) nanospring design used in this study. The scheme was produced by cadnano software 1. Scaffold,
SUPPLEMENTARY INFORMATION
VOLUME: 1 ARTICLE NUMBER: 0011 In the format provided by the authors and unedited. In situ Activation of Platelets with Checkpoint Inhibitors for Post-Surgical Cancer Immunotherapy Chao Wang 1, 2, Wujin
Plutoni et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB Plutoni et al., http ://www.jcb.org /cgi /content /full /jcb.201505105 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. Cell morphology during migration. (a) Protein extracts (20
me239 mechanics of the cell me239 mechanics of the cell 3.1 biopolymers - motivation 3.2 biopolymers - polymerization
4. the cytoskeleton - fiber bundle models bathe, heussinger, claessens, bausch, frey [2008] me239 mechanics of the cell 1 me239 mechanics of the cell 2 biopolymers polymerization of actin and tubulin Figure
Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides
Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides targeting RCP (SMARTPool (RCP) or two individual oligos (RCP#1
CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration
/, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing
Mechanical stimulation of Piezo1 receptors depends on extracellular matrix proteins and directionality of force. Supporting Information
Mechanical stimulation of Piezo1 receptors depends on extracellular matrix proteins and directionality of force Benjamin M. Gaub and Daniel J. Müller Supporting Information Supporting Information Note
JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Prospéri et al.,
Supplemental material JCB Prospéri et al., http://www.jcb.org/cgi/content/full/jcb.201501018/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Myo1b Tail interacts with YFP-EphB2 coated beads and genistein inhibits
Wt (Col-0) pom2-1 Wt (Ler) pom2-3 pom2-5. pom2-4 (0%) pom2-1 (0%)
Figure 1 Wt (Col-0) Wt (Ler) pom2-3 pom2-5 pom2-2 pom2-4 B Wt (0%) (0%) Wt (4.5%) (4.5%) Wt (0%) (0%) Wt (4.5%) (4.5%) (4.5%) Figure 1. Phenotypes of pom2 and wild type (Wt) seedlings after germination
Modeling cytoskeleton self-assembly
Modeling cytoskeleton self-assembly Dimitrios Vavylonis Department of Physics, Lehigh University BIOS 10 Lehigh University Oct 30, 2009 Cell organization How does the cell achieve internal organization?
SUPPLEMENTARY INFORMATION
DOI: 1.1/ncb2918 Supplementary Figure 1 (a) Biotin-dUTP labelling does not affect S phase progression. Cells synchronized in mid-s phase were labelled with biotindutp during a 5 min hypotonic shift (red)
-RT RT RT -RT XBMPRII
Base pairs 2000 1650 1000 850 600 500 400 Marker Primer set 1 Primer set 2 -RT RT RT -RT XBMPRII kda 100 75 50 37 25 20 XAC p-xac A 300 B Supplemental figure 1. PCR analysis of BMPRII expression and western
Lab Module 7: Cell Adhesion
Lab Module 7: Cell Adhesion Tissues are made of cells and materials secreted by cells that occupy the spaces between the individual cells. This material outside of cells is called the Extracellular Matrix
Supplementary Figure 1. Espn-1 knockout characterization. (a) The predicted recombinant Espn-1 -/- allele was detected by PCR of the left (5 )
Supplementary Figure 1. Espn-1 knockout characterization. (a) The predicted recombinant Espn-1 -/- allele was detected by PCR of the left (5 ) homologous recombination arm (left) and of the right (3 )
Supplementary Figures
Supplementary Figures a HindIII XbaI pcdna3.1/v5-his A_Nfluc-VVD 1-398 37-186 Nfluc Linker 1 VVD HindIII XhoI pcdna3.1/v5-his A_VVD-Nfluc 37-186 1-398 VVD Linker 2 Nfluc HindIII XbaI pcdna3.1/v5-his A_Cfluc-VVD
Supplementary Figure 1. Screening for monoclonal antibodies against GluA1 by immunoblotting.
Supplementary Figure 1 Screening for monoclonal antibodies against GluA1 by immunoblotting. Hippocampal extract was subjected to western blotting with the hybridoma supernatants of candidate monoclonal
Article. Matrix Microarchitecture and Myosin II Determine Adhesion in 3D Matrices
Current Biology 23, 1607 1619, September 9, 2013 ª2013 Elsevier Ltd All rights reserved http://dx.doi.org/10.1016/j.cub.2013.06.053 Matrix Microarchitecture and Myosin II Determine Adhesion in 3D Matrices
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12072 SUPPLEMENTARY FIGURES: Supplementary Figure 1: The NV centre consists of a substitutional nitrogen atom (N) adjacent to a vacancy (V) in the diamond lattice. WWW.NATURE.COM/NATURE
Fibrin Clots Are Equilibrium Polymers That Can Be Remodeled Without Proteolytic Digestion
Supplementary Information Fibrin Clots Are Equilibrium Polymers That Can Be Remodeled Without Proteolytic Digestion Irina N. Chernysh 1, Chandrasekaran Nagaswami 1, Prashant K. Purohit 2 and John W. Weisel
Supplementary Table, Figures and Videos
Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation
0.5% Triton X-100 for 5 min at room temperature. Fixed and permeabilized cells were
1 Supplementary Methods Immunohistochemistry EBC-1 cells were fixed in 4% paraformaldehyde for 15 min at room temperature, followed by 0.5% Triton X-100 for 5 min at room temperature. Fixed and permeabilized
Lecture 13. Motor Proteins I
Lecture 13 Motor Proteins I Introduction: The study of motor proteins has become a major focus in cell and molecular biology. Motor proteins are very interesting because they do what no man-made engines
Supplementary Figure 1
Supplementary Figure 1 (A) Schematic of sequential hybridization and barcoding. (B) Schematic of the FISH images of the cell. In each round of hybridization, the same spots are detected, but the dye associated
Supplementary Table 1. Oligonucleotide sequences used in the study
Supplementary Table 1. Oligonucleotide sequences used in the study Oligonucleotides Sequences (5 3 ) Substrate strand Lock -4 Lock -5 Lock -6 Lock -7 Free control DNAzyme DNAzyme strand linked to AuNP
Supplementary Information. Tau co-organizes dynamic microtubule and actin networks. and Isabelle Arnal 1,2,*
Supplementary Information Tau co-organizes dynamic microtubule and actin networks Auréliane Elie 1,2, Elea Prezel 1,2, Christophe Guérin 3, Eric Denarier 1,2,4, Sacnicte Ramirez- Rios 1,2, Laurence Serre
Supporting information
Supporting information Construction of strains and plasmids To create ptc67, a PCR product obtained with primers cc2570-162f (gcatgggcaagcttgaggacggcgtcatgt) and cc2570+512f (gaggccgtggtaccatagaggcgggcg),
14_integrins_EGFR
α1 Integrin α1 -/- fibroblasts from integrin α1 knockout animals Figure S1. Serum-starved fibroblasts from α -/- 1 and +/+ mice were stimulated with 10% FBS for 30 min. (FBS) or plated on collagen I (CI)
Nature Methods: doi: /nmeth.3553
Supplementary Figure 1 Programming the reconstitution of fully ECM-embedded 3D microtissues by DNA-programmed assembly (DPAC). (a) Timeline for a three-component tissue synthesis by DPAC. The process proceeds
Changes in E-cadherin rigidity sensing regulate cell adhesion
Changes in E-cadherin rigidity sensing regulate cell adhesion Caitlin Collins a, Aleksandra K. Denisin b,c, Beth L. Pruitt b,c, and W. James Nelson a,1 a Department of Biology, Stanford University, Stanford,
Supporting Online Material
Supporting Online Material Two Distinct Actin Networks Drive the Protrusion of Migrating Cells A. Ponti, M. Machacek, S. L. Gupton, C. M. Waterman-Storer, G. Danuser This document contains: Experimental
Farnesoid X Receptor and its ligands inhibit the function of platelets
Farnesoid X Receptor and its ligands inhibit the function of platelets Article Accepted Version Figures and Legends Moraes, L. A., Unsworth, A. J., Vaiyapuri, S., Ali, M. S., Sasikumar, P., Sage, T., Flora,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2271 Supplementary Figure a! WM266.4 mock WM266.4 #7 sirna WM266.4 #10 sirna SKMEL28 mock SKMEL28 #7 sirna SKMEL28 #10 sirna WM1361 mock WM1361 #7 sirna WM1361 #10 sirna 9 WM266. WM136
Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with
Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated
Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility
Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,
Nature Neuroscience: doi: /nn Supplementary Figure 1. Comprehensive opto-mechanical design of the dual-axis microscope.
Supplementary Figure 1 Comprehensive opto-mechanical design of the dual-axis microscope. (a) The complete microscope is shown to scale. The laser beam is depicted in light red. (b) A close-up view of the
-dependent dynamics of DNA ejections for bacteriophage lambda
Biophysical Journal, Volume 99 Supporting Material -dependent dynamics of DNA ejections for bacteriophage lambda D Wu, David A Van Valen, Qicong Hu, and Rob Phillips Supplemental Information Spurious ejections
Leaf-inspired Artificial Microvascular Networks (LIAMN) for Threedimensional
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Supporting Information Leaf-inspired Artificial Microvascular Networks (LIAMN) for Threedimensional
Knockdown Rescue. * * * * AACTATGTTACCGTTATGCAG Nck2a AACTACGTGGTGGTCCTCAGT [ bp] * * *** ** ** ** ** ** * shnck2a AACTACGTGGTGGTCCTCAGT * *
![Knockdown Rescue. * * * * AACTATGTTACCGTTATGCAG Nck2a AACTACGTGGTGGTCCTCAGT [ bp] * * *** ** ** ** ** ** * shnck2a AACTACGTGGTGGTCCTCAGT * *](/thumbs/77/75202831.jpg "Knockdown Rescue. * * * * AACTATGTTACCGTTATGCAG Nck2a AACTACGTGGTGGTCCTCAGT [ bp] * * *** ** ** ** ** ** * shnck2a AACTACGTGGTGGTCCTCAGT * *")
A c GAGAGAGAGGATGAATTAT GAGGGGAGGATGAGTTGT D * * * * AATATGTTAGTTATGAG [465-483 bp] a AATAGTGGTGGTTAGT [83-833 bp] * * *** ** ** ** GAAGAGAGGATGAGTGT shc GAGAGAGAGGATGAATTAT ** ** * AATAGTGGTTGTTTAGT sha
Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking
Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking Chi Wai Lee, Jianzhong Han, James R. Bamburg, Liang Han, Rachel Lynn, and James Q. Zheng Supplementary Figures
Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions.
Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions. 1 (a) Etoposide treatment gradually changes acetylation level and co-chaperone
Supporting Information
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2017 Supporting Information Mapping cell behavior across a wide range of vertical silicon nanocolumn
No wash 2 Washes 2 Days ** ** IgG-bead phagocytosis (%)
Supplementary Figures Supplementary Figure 1. No wash 2 Washes 2 Days Tat Control ** ** 2 4 6 8 IgG-bead phagocytosis (%) Supplementary Figure 1. Reversibility of phagocytosis inhibition by Tat. Human
Flowcytometry-based purity analysis of peritoneal macrophage culture.
Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript 45444-RG- Supplementary Figure Legends Figure S Flowcytometry-based purity analysis of peritoneal macrophage culture. Thioglycollate
DOI: 0.038/ncb337 a RFP-Zyxin Actin b RFP Fluorescence 0 0 0 6 5 4 non-swirling CCW swirling, positive tilting of radial fibers c GFP-VASP Actin d GFP Fluorescence 0 0 0 6 5 4 non-swirling CCW swirling,
Connie H. Y. Wong, Craig N Jenne, Björn Petri, Navina L. Chrobok and Paul Kubes
Nucleation of platelets with bloodborne pathogens on Kupffer cell precedes other innate immunity and contributes to bacterial clearance Connie H. Y. Wong, Craig N Jenne, Björn Petri, Navina L. Chrobok
Supplementary Fig. 5
Supplementary Fig. 5 Supplemental Figures legends Supplementary Figure 1 (A) Additional dot plots from CyTOF analysis from untreated group. (B) Gating strategy for assessment of CD11c + NK cells frequency
Supplementary Figure 1. Serial deletion mutants of BLITz.
Supplementary Figure 1 Serial deletion mutants of BLITz. (a) Design of TEVseq insertion into J -helix. C-terminal end of J -helix was serially deleted and replaced by TEVseq. TEV cleavage site is labeled
Loose, M., Fischer-Friedrich, E., Ries, J., Kruse, K., Schwille, P. Science, Vol. 320,
Spatial Regulators for Bacterial Cell Division Self-Organize into Surface Waves in Vitro Loose, M., Fischer-Friedrich, E., Ries, J., Kruse, K., Schwille, P. Science, Vol. 320, 9.5.2008 Maximilian Hörner
over time using live cell microscopy. The time post infection is indicated in the lower left corner.
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3363 Supplementary Figure 1 Several WNTs bind to the extracellular domains of PKD1. (a) HEK293T cells were co-transfected with indicated plasmids. Flag-tagged proteins were immunoprecipiated
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
Supplementary Figure 1 Autoaggregation of E. coli W3110 in presence of native
Supplementary Figure 1 Autoaggregation of E. coli W3110 in presence of native Ag43 phase variation depends on Ag43, motility, chemotaxis and AI-2 sensing. Cells were grown to OD600 of 0.6 at 37 C and aggregation
Effect of Cytochalasin on Average Pseudopodia Length in Amoeba Proteus
Effect of Cytochalasin on Average Pseudopodia Length in Amoeba Proteus Alex Waciega Independent Research Project Report Cell Biology 219 December 3, 2008 Introduction In our experiment we studied the effects
Supplementary Figures
Supplementary Figures Supplementary Figure S1. Inhibition kinetics of p53/hdm2 binding induced by Nutlin 3 on live cells. Reproducibility of the p53/hdm2 binding disruption kinetics induced by Nutlin 3
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2806 Supplemental Material: Figure S1 Wnt4 PCP phenotypes are not mediated through canonical Wnt signaling. (a-a ) Illustration of wg, dwnt4 and dwnt6 expression patterns in wing (a) and
SUPPLEMENTARY INFORMATION
DOI:.38/ncb327 a b Sequence coverage (%) 4 3 2 IP: -GFP isoform IP: GFP IP: -GFP IP: GFP Sequence coverage (%) 4 3 2 IP: -GFP IP: GFP 33 52 58 isoform 2 33 49 47 IP: Control IP: Peptide Sequence Start
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION WWW.NATURE.COM/NATURECELLBIOLOGY 1 SUPPLEMENTARY INFORMATION 2 WWW.NATURE.COM/NATURECELLBIOLOGY SUPPLEMENTARY INFORMATION WWW.NATURE.COM/NATURECELLBIOLOGY 3 SUPPLEMENTARY INFORMATION
Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression
Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,
SUPPLEMENTARY INFORMATION
DOI: 1.138/NNANO.211.185 Mixing sub-attolitre volumes in a quantitative and highly parallel manner with soft matter nanofluidics Sune M. Christensen, Pierre-Yves Bolinger,Nikos S. Hatzakis, Michael W.Mortensen
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
Supplementary Figure 1. Botrocetin induces binding of human VWF to human
Supplementary Figure 1: Supplementary Figure 1. Botrocetin induces binding of human VWF to human platelets in the absence of elevated shear and induces platelet agglutination as detected by flow cytometry.