SUPPLEMENTAL MATERIAL

Size: px
Start display at page:

Download "SUPPLEMENTAL MATERIAL"

Transcription

1 SUPPLEMENTAL MATERIAL Cell Selective Cardiovascular Biology of Microsomal Prostaglandin E Synthase- Chen, et al Cell specific role of mpges- Lihong Chen,,*, MD, PhD; Guangrui Yang,,*, MD, PhD; Xiufeng Xu 3, PhD; Gregory Grant,, PhD; John A. Lawson,, BS; Mohammad Bohlooly-Y 3, PhD and Garret A. FitzGerald,, MD, FRS, Institute for Translational Medicine and Therapeutics,, Department of Pharmacology, University of Pennsylvania, Philadelphia, PA, 94 3, RAD-Transgenics, Discovery Sciences, Astra Zeneca R&D, Mölndal, 4383 Mölndal, Sweden * These authors contributed equally to this work. Corresponding Author: Garret A. FitzGerald Institute for Translational Medicine and Therapeutics, Department of Pharmacology, University of Pennsylvania, - Translational Research Center, 34 Civic Center Blvd, Philadelphia, PA, 94 Fax: , Tel: , garret@upenn.edu. The journal subject code: [3] [6] [7]

2 Supplemental Methods. Targeted disruption of mpges- To construct a mpges- gene targeting vector, 4. kb,.9 kb and.8 kb genomic DNA fragments were prepared from a BAC clone which contains about kb 9/Sv genomic sequence including the mpges- gene (ResGen, Invitrogen Corporation) for 5 homology, deletion and 3 homology sequences respectively. The fragments were cloned into a plasmid containing loxp-loxp-pgkneo-loxp sequence, applying a standard cloning technique. In brief, a.9 kb fragment containing exon of mpges- was inserted between an isolated loxp site and loxp-flanked PGK-Neo cassette and then placed between the two homology sequences. The targeting vector was linearized and electroporated into R mouse embryonic stem (ES) cells and ES cell clones were selected with G48 (3 µg/ml). The candidate ES cell clones underwent homologous recombination were screened by PCR and confirmed by Southern blotting according to a standard protocol. The targeted ES cells were injected into C57BL/6J blastocysts and the injected embryos were implanted into the uteruses of pseudopregnant B6CBA mice. Chimeric males were mated with C57BL/6 females to produce agouti heterozygous animals (F). The heterozygous F males were bred with Rosa6Cre transgenic mice on a C57BL/6 background to delete the whole loxp floxed region, including the exon and the neo cassette. mpges- null mice were then obtained by intercrossing. Offspring were genotyped by PCR using primers 8, 83 and 84 (8, forward: 5'- AAGGTTGATGGTGCACGTCTA-3 ; 83, reverse: 5 -TTTGTTTGGCCTCACTCTACA-3 ; 84, forward: 5 - CTCAGGCAGGGCTCATCTACC-3 ) that detected wild type alleles (.79 kb fragment) and null alleles (.47 kb fragment), respectively. For generating mpges- conditional mice, the heterozygous F mice were bred with EIIaCre transgenic mice on a C57BL/6 background to

3 delete the loxp flanked PGK-Neo cassette only, keeping the loxp flanked.9 kb deletion fragment in the genome. The genotyping for conditional mice was achieved by PCR using primers 8 and 83 to identify the wild type (.79 kb fragment) and floxed alleles (.399 kb fragment), respectively. Three primers located in different exons, 854, 855 and 856 (854, forward: 5'- CCAGGTGCTCCCGGCCTTTCT-3', 855, reverse: 5'-CGCTCCACATCTGGGTCACTC-3'; and 856, reverse: 5'-GTAGGCCACGGTGTGTACCAC-3') were used for RT-PCR analysis. A.7 kb fragment can be amplified by RT-PCR from wild type, but not from KO mice with primers 854 and 855. Applying primers 854 and 856,.33 kb or.39 kb fragments can be obtained by RT-PCR from wild type and KO mice, respectively.. Immunohistochemistry After conventional deparaffining and hydration, sections were treated with 3% H O for min to eliminate endogenous activity of peroxidase. Then sections were heated in a target retrieval solution (DakoCytomation, Carpinteria, CA) for 3min. After cooling at room temperature and washing with PBS, sections were incubated with primary antibodies against α-sma, PCNA (Abcam, Cambridge, MA), TN-C (Chemicon International Inc., Temecula, CA) or CD45 (Abcam, Cambridge, MA) for 6min followed by incubation with antibody enhancer and Polymer-horseradish peroxidase conjugated secondary antibodies and chromogen AEC staining (Golden Bridge International, Mukilteo, WA). After several washes with distilled water, sections were counterstained with hematoxylin and mounted routinely. 3. Endothelial cell characterization The identification of mouse endothelial cells was confirmed by staining for platelet endothelial cell adhesion molecule (PECAM-) and by DiI-Ac-LDL uptake as previously described. Briefly,

4 the cells were passaged onto sterile glass coverslips and grown overnight. For PECAM- staining, the cells were incubated with or without mouse anti-pecam- monoclonal antibody (:) for hour at room temperature after being fixed for minutes in acetone. Then they were washed with PBS and incubated with rhodamine-conjugated secondary antibody (:) for hour. After extensive washing, the cells were visualized with a fluorescence microscope. For the acetylated LDL uptake experiments, the cells were incubated with μg/ml DiI-Ac-LDL (Biomedical Technologies Inc., Stoughton, MA) in DMEM for hour at 37 C. Then the medium was removed and the cells were washed with PBS and the DiI-Ac-LDL was visualized with a fluorescence microscope.

5 A Wild-type allele S.6 kb 8 83 S Targeting vector PGK neo 4. kb.9 kb.8 kb DTA S 7.5 kb S Targeted allele PGK neo Cre In vivo Probe Conditional allele 8 83 Cre In vivo Deleted allele Supplemental Figure

6 B C UTR 3 3 UTR cdna -/- +/- +/+ -/- +/- +/+ -/- +/- +/+.6 kb 7.5 kb mpges- (854/855) 7bp mpges- (854/856) 3bp 39bp GAPDH Muscle Lung Brain Supplemental Figure

7 A BM VD B mpges- 6kd β-actin 4kd flox TieCre/flox Supplemental Figure

8 A Fluorescence Phase PECAM- No primary antibody B Uptake of Dil-Ac-LDL Supplemental Figure 3

9 IL-β Relative mrna level 3 * Mac-mPGES--WT Mac-mPGES--KO ctrl LPS4h Supplemental Figure 4

10 A EP EP3 B EP EP3 3 flox SM/flox Tie/flox flox SM/flox Tie/flox 3 WT KO.3... WT KO EP EP4 EP EP4 5 5 flox SM/flox Tie/flox 4 3 flox SM/flox Tie/flox WT KO WT * KO Supplemental Figure 5

11 Supplemental Figure Legends Supplemental Figure. Targeted disruption of the mpges- gene. A, The native 5 region of the mpges- gene and targeting vector (top), the targeted and conditional allele (middle) and the disrupted mpges- gene (bottom) are shown. A region containing exon was flanked by loxp sites and was deleted after breeding with Cre transgenic mice. The open rectangles with numbers indicate the exons. The filled rectangle shows the untranslated region (UTR). Horizontal bars indicate the probe used for Southern blotting. DTA, diphtheria toxin A fragment gene cassette. S, SpeI. The triangle indicates loxp site. The arrow indicates the oligos used for genotyping. B, Southern blot analysis of the targeted ES clones. Genomic DNA was digested with SpeI and probed with a 3 flanking probe shown in (A). Expected sizes of DNA fragments of the wild-type and mutant alleles are indicated in (A). Lane and, markers; Lane 3-3, targeted clones. Lane 4-5, wild type ES clones. C, mpges- transcript (top) and RT-PCR analysis (bottom). Tissues were obtained from mpges- +/+, +/- and -/- littermates. The arrows indicate the oligos used for RT-PCR. Supplemental Figure. Western blot analysis of mpges- expression in bone marrow cells of the TieCre mice. Total protein of bone marrow (BM) cells was extracted from mpges-- flox and TieCre/flox mice. Vas Deferens (VD) was used as a positive control for mpges- expression and β-actin staining was performed as a protein loading control. 4µg protein of each sample was loaded. A) Representative blots. B) Quantitative analysis of mpges- protein expression (normalized to β-actin) (n=3). Supplemental Figure 3. Characterization of mouse ECs. A, The ECs isolated from the mouse aorta were examined for the presence of the endothelium-specific marker PECAM-. Fluorescence and phase images show that the positive PECAM- staining was observed in

12 almost all of the cells. Images with no primary antibody were used as background controls. B, ECs were identified by the DiI-Ac-LDL uptake experiments. Fluorescence and phase images show that almost all cells are able to uptake DiI-Ac-LDL after hour incubation. Supplemental Figure 4. Inflammatory cytokine expression in mpges- deleted macrophages. Real-time RT-PCR of IL-β expression in peritoneal macrophages. Thioglycollate-elicited macrophages harvested from Mac-mPGES--WT (WT) or Mac-mPGES- KO (KO) mice were treated with or without 5μg/ml LPS for 4h and whole cell lysates were prepared for quantitative RT-PCR analysis. All samples were normalized to 8s rrna (n=3; *P=.5, nonparametric Mann-Whitney test). Supplemental Figure 5. Expression of EP receptors in wire-injured femoral arteries. A, Real-time RT-PCR analysis of the relative expressions of EP, EP, EP3 and EP4 in injured arteries from SMCre/flox, TieCre/flox mice and mpges--flox mice 8 days after wire injury(n=4-5). B, Real-time RT-PCR analysis of the relative expressions of EP, EP, EP3 and EP4 in injured arteries from Mac-mPGES--WT or Mac-mPGES--KO mice 8 days after wire injury (n=5; *P<.5, unpaired t-test with welch s correction).

13 Supplemental References. Shi W, Haberland ME, Jien ML, Shih DM, Lusis AJ. Endothelial responses to oxidized lipoproteins determine genetic susceptibility to atherosclerosis in mice. Circulation. ;:75-8.

A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet

A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet A Low salt diet GV [AU]:. [mmhg]: 0..... 09 9 7 B High salt diet GV [AU]:. [mmhg]: 7 8...0. 7.8 8.. 0 8 7 C Low salt diet + mf-c GV [AU]:. [mmhg]:.0.9 8.7.7. 7 8 0 D High salt diet + mf-c E Lymph capillary

More information

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals: TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene

More information

Nature Medicine doi: /nm.2548

Nature Medicine doi: /nm.2548 Supplementary Table 1: Genotypes of offspring and embryos from matings of Pmm2 WT/F118L mice with Pmm2 WT/R137H mice total events Pmm2 WT/WT Pmm2 WT/R137H Pmm2 WT/F118L Pmm2 R137H/F118L offspring 117 (100%)

More information

Revised: RG-RV2 by Fukuhara et al.

Revised: RG-RV2 by Fukuhara et al. Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the

More information

DRG Pituitary Cerebral Cortex

DRG Pituitary Cerebral Cortex Liver Spinal cord Pons Atg5 -/- Atg5 +/+ DRG Pituitary Cerebral Cortex WT KO Supplementary Figure S1 Ubiquitin-positive IBs accumulate in Atg5 -/- tissues. Atg5 -/- neonatal tissues were fixed and decalcified.

More information

The RRPA knock-in allele was generated by homologous recombination in TC1 ES cells.

The RRPA knock-in allele was generated by homologous recombination in TC1 ES cells. Supplemental Materials Materials & Methods Generation of RRPA and RAPA Knock-in Mice The RRPA knock-in allele was generated by homologous recombination in TC1 ES cells. Targeted ES clones in which the

More information

TRANSGENIC ANIMALS. transient. stable. - Two methods to produce transgenic animals:

TRANSGENIC ANIMALS. transient. stable. - Two methods to produce transgenic animals: Only for teaching purposes - not for reproduction or sale CELL TRANSFECTION transient stable TRANSGENIC ANIMALS - Two methods to produce transgenic animals: 1- DNA microinjection 2- embryonic stem cell-mediated

More information

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination

More information

Analysis of gene function

Analysis of gene function Genome 371, 22 February 2010, Lecture 12 Analysis of gene function Gene knockouts PHASE TWO: INTERPRETATION I THINK I FOUND A CORNER PIECE. 3 BILLION PIECES Analysis of a disease gene Gene knockout or

More information

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

More information

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab. / 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

More information

Mouse Engineering Technology. Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology

Mouse Engineering Technology. Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology Mouse Engineering Technology Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology Core service and new technologies Mouse ES core Discussions

More information

Supplementary Information

Supplementary Information Supplementary Information MicroRNA-212/132 family is required for epithelial stromal interactions necessary for mouse mammary gland development Ahmet Ucar, Vida Vafaizadeh, Hubertus Jarry, Jan Fiedler,

More information

species- Mus musculus Engineering the mouse genome David Ornitz

species- Mus musculus Engineering the mouse genome David Ornitz species- Mus musculus Engineering the mouse genome David Ornitz How do we analyze gene function in mice? Gene addition (transgenic approach) Permits GOF, DN and knockdown experiments Ectopic (spatial or

More information

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,

More information

We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and

We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and Mice We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and an Frt flanked neo cassette (Fig. S1A). Targeted BA1 (C57BL/6 129/SvEv) hybrid embryonic stem cells

More information

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL SUPPLEMENTAL MATERIAL MATERIALS AND METHODS Generation of TSPOΔ/Δ murine embryonic fibroblasts Embryos were harvested from 13.5-day pregnant TSPOfl/fl mice. After dissection to eviscerate and remove the

More information

Theoretical cloning project

Theoretical cloning project Theoretical cloning project Needed to get credits Make it up yourself, don't copy Possible to do in groups of 2-4 students If you need help or an idea, ask! If you have no idea what to clone, I can give

More information

(i) A trp1 mutant cell took up a plasmid containing the wild type TRP1 gene, which allowed that cell to multiply and form a colony

(i) A trp1 mutant cell took up a plasmid containing the wild type TRP1 gene, which allowed that cell to multiply and form a colony 1. S. pombe is a distant relative of baker s yeast (which you used in quiz section). Wild type S. pombe can grow on plates lacking tryptophan (-trp plates). A mutant has been isolated that cannot grow

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

More information

GENOME 371, Problem Set 6

GENOME 371, Problem Set 6 GENOME 371, Problem Set 6 1. S. pombe is a distant relative of baker s yeast (which you used in quiz section). Wild type S. pombe can grow on plates lacking tryptophan (-trp plates). A mutant has been

More information

Supplemental Information. Role of phosphatase of regenerating liver 1 (PRL1) in spermatogenesis

Supplemental Information. Role of phosphatase of regenerating liver 1 (PRL1) in spermatogenesis Supplemental Information Role of phosphatase of regenerating liver 1 (PRL1) in spermatogenesis Yunpeng Bai ;, Lujuan Zhang #, Hongming Zhou #, Yuanshu Dong #, Qi Zeng, Weinian Shou, and Zhong-Yin Zhang

More information

Pei et al. Supplementary Figure S1

Pei et al. Supplementary Figure S1 Pei et al. Supplementary Figure S1 C H-CUL9: + + + + + Myc-ROC1: - - + + + U2OS/pcDN3 U2OS/H-CUL9 U2OS/ + H-CUL9 IP: -H -myc input -H -myc 1 2 3 4 5 H-CUL9 Myc-ROC1 -H -H -H -H H-CUL9: wt RR myc-roc1:

More information

Supporting Online Material. 3. Analysis of in vivo TLR4-mediated response in TRIF-deficient mice

Supporting Online Material. 3. Analysis of in vivo TLR4-mediated response in TRIF-deficient mice Supporting Online Material 1. Materials and Methods 2. Generation of TRIF-deficient mice 3. Analysis of in vivo TLR4-mediated response in TRIF-deficient mice 4. Measurement of LPS-induced IRAK-1 kinase

More information

CFTR-null wt CFTR-null 1.0. Probe: Neo R. Figure S1

CFTR-null wt CFTR-null 1.0. Probe: Neo R. Figure S1 A. B. 4.0 3.0 2.0 1.0 4.0 3.0 2.0 1.0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Probe: Neo R CFTR-null wt CFTR-null Figure S1 A. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 10kb 8kb CFTR-null wt B. Probe: CFTR

More information

Supporting Online Material Y. Tang et al., published 1/24/03

Supporting Online Material Y. Tang et al., published 1/24/03 Y. Tang SOM, p. 1 Supporting Online Material Y. Tang et al., published 1/24/03 MATERIALS AND METHODS Construction of the Targeting Vector and Generation of Mice Carrying Mutations Targeting vector. Recombinant

More information

A) (5 points) As the starting step isolate genomic DNA from

A) (5 points) As the starting step isolate genomic DNA from GS Final Exam Spring 00 NAME. bub ts is a recessive temperature sensitive mutation in yeast. At º C bub ts cells grow normally, but at º C they die. Use the information below to clone the wild-type BUB

More information

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

More information

SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES

SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Generation of inducible BICD2 knock-out mice. A) The mouse BICD2 locus and gene targeting constructs. To generate an inducible Bicd2

More information

Percent survival. Supplementary fig. S3 A.

Percent survival. Supplementary fig. S3 A. Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice

More information

Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites

Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells in the injured sites Yunyuan Li, Reza Baradar Jalili, Aziz Ghahary Department of Surgery, University of British Columbia,

More information

Dominguez et al., 2005

Dominguez et al., 2005 Dominguez et al., 005 SUPPLEMENTARY INFORMATION EXPERIMENTAL PROCEDURES Generation of BACE1 targeted ES cells- For the generation of the first BACE1 line (BACE1I), a 19/ola mouse cosmid library from RZPD

More information

Table S1. Primers used in the study

Table S1. Primers used in the study Table S1. Primers used in the study Primer name Application Sequence I1F16 Genotyping GGCAAGTGAGTGAGTGCCTA I1R11 Genotyping CCCACTCGTATTGACGCTCT V19 Genotyping GGGTCTCAAAGTCAGGGTCA D18Mit184-F Genotyping

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10163 Supplementary Table 1 Efficiency of vector construction. Process wells recovered efficiency (%) Recombineering* 480 461 96 Intermediate plasmids 461 381 83 Recombineering efficiency

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 Supplemental figure 1. Generation of gene targeted mice expressing an anti-id BCR. (A,B) Generation of the VDJ aid H KI mouse. (A) Targeting Construct. Top: Targeting construct for

More information

Materials and Methods

Materials and Methods Materials and Methods Construction of noxa / mice and genotyping The targeting vector (see Fig. S) was prepared from a C57BL/6 DNA λ phage library (Stratagene) by replacing a 2.7 kb region encompassing

More information

TRANSGENIC TECHNOLOGIES: Gene-targeting

TRANSGENIC TECHNOLOGIES: Gene-targeting TRANSGENIC TECHNOLOGIES: Gene-targeting Reverse Genetics Wild-type Bmp7 -/- Forward Genetics Phenotype Gene or Mutations First Molecular Analysis Second Reverse Genetics Gene Phenotype or Molecular Analysis

More information

Easi CRISPR for conditional and insertional alleles

Easi CRISPR for conditional and insertional alleles Easi CRISPR for conditional and insertional alleles C.B Gurumurthy, University Of Nebraska Medical Center Omaha, NE cgurumurthy@unmc.edu Types of Genome edits Gene disruption/inactivation Types of Genome

More information

AIP1 functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis

AIP1 functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis SUPPLEMENTAL MATERIALS functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis Haifeng Zhang 1*, Yun He 1*, Shengchuan Dai 1*, Zhe Xu 2*, Yan Luo 2, Ting Wan 2,

More information

Biotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics. BIT 220 End of Chapter 22 (Snustad/Simmons)

Biotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics. BIT 220 End of Chapter 22 (Snustad/Simmons) Biotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics BIT 220 End of Chapter 22 (Snustad/Simmons) Nucleic Acids as Therapeutic Agents Many diseases (cancer, inflammatory diseases) from

More information

A Survey of Genetic Methods

A Survey of Genetic Methods IBS 8102 Cell, Molecular, and Developmental Biology A Survey of Genetic Methods January 24, 2008 DNA RNA Hybridization ** * radioactive probe reverse transcriptase polymerase chain reaction RT PCR DNA

More information

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFPHigh cells. Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

More information

Flowcytometry-based purity analysis of peritoneal macrophage culture.

Flowcytometry-based purity analysis of peritoneal macrophage culture. Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript 45444-RG- Supplementary Figure Legends Figure S Flowcytometry-based purity analysis of peritoneal macrophage culture. Thioglycollate

More information

Ma, et al. Supplemental Data

Ma, et al. Supplemental Data Ma, et al Supplemental Data Title: Calpain mediates pulmonary vascular remodeling in rodent models of pulmonary hypertension and its inhibition attenuates pathologic features of disease Authors: Wanli

More information

(a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for

(a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for Supplementary Figure 1 Generation of Diaph3 ko mice. (a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for different regions of Diaph3 mrna from WT, heterozygote

More information

Myofibroblasts in kidney fibrosis. LeBleu et al.

Myofibroblasts in kidney fibrosis. LeBleu et al. Origin and Function of Myofibroblasts in Kidney Fibrosis Valerie S. LeBleu, Gangadhar Taduri, Joyce O Connell, Yingqi Teng, Vesselina G. Cooke, Craig Woda, Hikaru Sugimoto and Raghu Kalluri Supplementary

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature875 a promoter firefly luciferase CNS b Supplementary Figure 1. Dual luciferase assays on enhancer activity of CNS1, 2, and 3. a. promoter sequence was inserted upstream of firefly luciferase

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

TITLE: Mammary Specific Expression of Cre Recombinase Under the Control of an Endogenous MMTV LTR: A Conditional Knock-out System

TITLE: Mammary Specific Expression of Cre Recombinase Under the Control of an Endogenous MMTV LTR: A Conditional Knock-out System AD Award Number: DAMD17-98-1-8233 TITLE: Mammary Specific Expression of Cre Recombinase Under the Control of an Endogenous MMTV LTR: A Conditional Knock-out System PRINCIPAL INVESTIGATOR: Rama Kudaravalli,

More information

Nature Biotechnology: doi: /nbt.4166

Nature Biotechnology: doi: /nbt.4166 Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained

More information

Supplementary Data. Plasmid -2486CAT containing the 2.5 kb fragment of VE-cadherin promoter region (-2486

Supplementary Data. Plasmid -2486CAT containing the 2.5 kb fragment of VE-cadherin promoter region (-2486 Supplementary Data Materials and Methods Generation and Genotyping of Transgenic Mice Plasmid -2486CAT containing the 2.5 kb fragment of VE-cadherin promoter region (-2486 to +24) was a gift from P. Huber.

More information

Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.

Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. Supplementary Figure 1 Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. (left) Representative bright-field images of wild type (wt), heterozygous (het)

More information

Experimental genetics - 2 Partha Roy

Experimental genetics - 2 Partha Roy Partha Roy Experimental genetics - 2 Making genetically altered animal 1) Gene knock-out k from: a) the entire animal b) selected cell-type/ tissue c) selected cell-type/tissue at certain time 2) Transgenic

More information

Supplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860

Supplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860 Supplementary Figure 1 Generation of B2M -/- ESCs. (a) Maps of the B2M alleles in cells with the indicated B2M genotypes. Probes and restriction enzymes used in Southern blots are indicated (H, Hind III;

More information

a Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs

a Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs a Lamtor (gene) b Lamtor (mrna) c BMDMs: Φ WT Φ KO Lamtor flox 8 bp LysM-Cre 93 bp..5 p =.4 WT BMDMs: Φ WT Φ KO Lamtor (protein) BMDMs: Φ WT Φ KO Lamtor 8 kda Lamtor 4 kda Lamtor3 4 kda Lamtor4 kda Lamtor5.5

More information

Fatchiyah

Fatchiyah Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing

More information

Map-Based Cloning of Qualitative Plant Genes

Map-Based Cloning of Qualitative Plant Genes Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward

More information

Student Learning Outcomes (SLOS) - Advanced Cell Biology

Student Learning Outcomes (SLOS) - Advanced Cell Biology Course objectives The main objective is to develop the ability to critically analyse and interpret the results of the scientific literature and to be able to apply this knowledge to afford new scientific

More information

Figure S Relative MUC4 transcript level* CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4

Figure S Relative MUC4 transcript level* CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S1 Relative MUC4 transcript level* 1.4 1.2 1 0.8 0.6 0.4 0.2 0 CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S2 * * CD18/HPAF-Scr CD18/HPAF-siMUC4 CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S3 CD18/HPAF-Scr

More information

7.03, 2005, Lecture 25 Transgenes and Gene Targeting in Mice II

7.03, 2005, Lecture 25 Transgenes and Gene Targeting in Mice II 7.03, 2005, Lecture 25 Transgenes and Gene Targeting in Mice II In the last lecture we discussed sickle cell disease (SCD) in humans, and I told you the first part of a rather long, but interesting, story

More information

C57BL/6N Female. C57BL/6N Male. Prl2 WT Allele. Prl2 Targeted Allele **** **** WT Het KO PRL bp. 230 bp CNX. C57BL/6N Male 30.

C57BL/6N Female. C57BL/6N Male. Prl2 WT Allele. Prl2 Targeted Allele **** **** WT Het KO PRL bp. 230 bp CNX. C57BL/6N Male 30. A Prl Allele Prl Targeted Allele 631 bp 1 3 4 5 6 bp 1 SA β-geo pa 3 4 5 6 Het B Het 631 bp bp PRL CNX C 1 C57BL/6N Male (14) Het (7) (1) 1 C57BL/6N Female (19) Het (31) (1) % survival 5 % survival 5 ****

More information

indicated numbers of pups at day of life (DOL) 10, or embryonic day (ED) B. Male mice of

indicated numbers of pups at day of life (DOL) 10, or embryonic day (ED) B. Male mice of SUPPLEMENTRY FIGURE LEGENDS Figure S1. USP44 loss leads to chromosome missegregation.. Genotypes obtained from the indicated numbers of pups at day of life (DOL) 10, or embryonic day (ED) 13.5.. Male mice

More information

Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s. disease-like pathology. Nagata et al.

Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s. disease-like pathology. Nagata et al. Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s disease-like pathology Nagata et al. Supplementary Fig 1. Previous App knock-in model did not show Aβ accumulation

More information

Figure S1. Generation of HspA4 -/- mice. (A) Structures of the wild-type (Wt) HspA4 -/- allele, targeting vector and targeted allele are shown together with the relevant restriction sites. The filled rectangles

More information

Approved for Public Release; Distribution Unlimited

Approved for Public Release; Distribution Unlimited AD Award Number: DAMD17-00-1-0057 TITLE: Conditional Estrogen Receptor Knockout Mouse Model for Studying Mammary Tumorigenesis PRINCIPAL INVESTIGATOR: Sohaib A. Khan, Ph.D. CONTRACTING ORGANIZATION: University

More information

Persistent fibroblast growth factor 23 signalling in the parathyroid glands for secondary. hyperparathyroidism in mice with chronic kidney disease

Persistent fibroblast growth factor 23 signalling in the parathyroid glands for secondary. hyperparathyroidism in mice with chronic kidney disease Supplementary Information Title: Persistent fibroblast growth factor 23 signalling in the parathyroid glands for secondary hyperparathyroidism in mice with chronic kidney disease Authors: Kazuki Kawakami

More information

Supporting Information

Supporting Information Supporting Information Alenina et al. 10.1073/pnas.0810793106 SI Materials and Methods In Vivo Brain Magnetic Resonance Imaging (MRI). In vivo brain MRI was performed in 6-month-old Tph2 / and control

More information

Supplementary Figures and Figure legends

Supplementary Figures and Figure legends Supplementary Figures and Figure legends 3 Supplementary Figure 1. Conditional targeting construct for the murine Satb1 locus with a modified FLEX switch. Schematic of the wild type Satb1 locus; the conditional

More information

Generation and Application of Genetically Modified Mouse Models of Human Disease.

Generation and Application of Genetically Modified Mouse Models of Human Disease. Generation and Application of Genetically Modified Mouse Models of Human Disease. Nina Balthasar RCUK and BHF Research Fellow Department of Physiology and Pharmacology University of Bristol The Plan Techniques

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3

More information

Anti-ERK1/2, anti-p-erk1/2, anti-p38 anti-p-msk1 (Thr581) and anti-p-msk2

Anti-ERK1/2, anti-p-erk1/2, anti-p38 anti-p-msk1 (Thr581) and anti-p-msk2 Supplementary methods Antibodies Anti-ERK1/2, anti-p-erk1/2, anti-p38 anti-p-msk1 (Thr581) and anti-p-msk2 polyclonal were from Cell Signalling and the anti-p-histone H3(Ser1) antibody was from Upstate.

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 A P1 NOD - SCID(X*X*)(0/0) NOD - SCID(X*Y)(A*0201/A*0201) B F1 (X*X)(A*0201/0) (X*X*)(0/0) F2 (X*X*)(0/0) (X*Y)(0/0) (X*X*)(A*0201/0) (X*X*)(A*0201/0) F3 (X*X*)(0/0) (X*X)(A*0201/0)

More information

1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA.

1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA. Supplemental data: 1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA. Strategy#1: 20nt at both sides: #1_BglII-Fd primer : 5 -gga

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 Supplemental Figure 1 (previous page): Heavy chain gene content of ARS/Igh66 transgenic lines. A. Tail DNA from the indicated transgenic lines was amplified for the indicated gene

More information

LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation

LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation Mi Young Park, 1# Raki Sudan, 1# Neetu Srivastava, 1 Sudha Neelam, 1 Christie Youngs, 1 Jia- Wang Wang, 4 Robert W. Engelman, 5,6,7

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Ricke et al., http://www.jcb.org/cgi/content/full/jcb.201205115/dc1 Figure S1. Kinetochore localization of mitotic regulators in wild-type

More information

Supplemental Table S1. RT-PCR primers used in this study

Supplemental Table S1. RT-PCR primers used in this study Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------

More information

Regulation of axonal and dendritic growth by the extracellular calcium-sensing

Regulation of axonal and dendritic growth by the extracellular calcium-sensing Regulation of axonal and dendritic growth by the extracellular calcium-sensing receptor (CaSR). Thomas N. Vizard, Gerard W. O Keeffe, Humberto Gutierrez, Claudine H. Kos, Daniela Riccardi, Alun M. Davies

More information

Supplemental Information

Supplemental Information Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure

More information

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that

More information

Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates

Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates vascular calcification (VC). (a) Von Kossa staining shows that TSA potentiated the Pi-induced VC. Scale bar, 100

More information

Nature Medicine: doi: /nm.2171

Nature Medicine: doi: /nm.2171 Table 1. Anti-cystic effect of Genz-123346 in jck mouse model of PKD No No of animals Gender Dose (% in feed) Body weight (g) K/BW ratio (%) Cystic volume (%BW) BUN (mg dl 1 ) 1 Vehicle 10 F - 19.2 ± 0.6

More information

Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides

Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides targeting RCP (SMARTPool (RCP) or two individual oligos (RCP#1

More information

Supplementary Data. Generation and Characterization of Mixl1- Inducible Embryonic Stem Cells Under the Control of Oct3/4 Promoter or CAG Promoter

Supplementary Data. Generation and Characterization of Mixl1- Inducible Embryonic Stem Cells Under the Control of Oct3/4 Promoter or CAG Promoter Supplementary Data Generation and Characterization of Mixl1- Inducible Embryonic Stem Cells Under the Control of Oct3/4 Promoter or CAG Promoter We first introduced an expression unit composed of a tetresponse

More information

Aspergillus fumigatus CalA binds to integrin α 5 β 1 and mediates host cell invasion

Aspergillus fumigatus CalA binds to integrin α 5 β 1 and mediates host cell invasion In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16211 DOI: 10.1038/NMICROBIOL.2016.211 Aspergillus fumigatus CalA binds to integrin α 5 β 1 and mediates host

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune

More information

Kehler et al. 25 SUPPLIMENTARY INFORMATION. for on-line publication

Kehler et al. 25 SUPPLIMENTARY INFORMATION. for on-line publication Kehler et al. 25 SUPPLIMENTARY INFORMATION for on-line publication Kehler et al. 26 Legends to Supplimentary Figures Suppl. Figure 1. Conditionally targeting the Oct4 locus. A two-step loxp-flanking (

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1: Identification of new regulators of MuSC by a proteome-based shrna screen. (a) FACS plots of GFP + and GFP - cells from Pax7 ICN -Z/EG (upper panel) and

More information

Transgenesis. Stable integration of foreign DNA into host genome Foreign DNA is passed to progeny germline transmission

Transgenesis. Stable integration of foreign DNA into host genome Foreign DNA is passed to progeny germline transmission Transgenic Mice Transgenesis Stable integration of foreign DNA into host genome Foreign DNA is passed to progeny germline transmission integrates into all cells including sperm or egg Knockin mice DNA

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Ca 2+ /calmodulin Regulates Salicylic Acid-mediated Plant Immunity Liqun Du, Gul S. Ali, Kayla A. Simons, Jingguo Hou, Tianbao Yang, A.S.N. Reddy and B. W. Poovaiah * *To whom correspondence should be

More information

Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the

Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the phenotype of HDAC1-/- teratomas. 3x10 6 HDAC1 reintroduced (HDAC1-/-re) and empty vector infected

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible

More information

amplify the conditional allele (2-lox) and recombined allele (1-lox) following tamoxifen

amplify the conditional allele (2-lox) and recombined allele (1-lox) following tamoxifen Supplementary data Supplementary Table 1. Real-time PCR primer sequences Supplementary Fig. 1. (A) Genomic map of the Vhl (2-lox) conditional allele. Numbered boxes represent exon 1, which is targeted

More information

Supplementary Fig. 1 Generation and genotyping of ThPOK / mice

Supplementary Fig. 1 Generation and genotyping of ThPOK / mice Supplementary Fig. 1 Generation and genotyping of ThPOK / mice (a). The strategy used to target the ThPOK locus is schematically depicted. A targeting construct was generated by inserting a loxp site (filled

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.

Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

Supplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells

Supplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells Supplementary Information Conversion of vascular endothelial cells into multipotent stem-like cells Damian Medici 1, Eileen M. Shore 2,3,4, Vitali Y. Lounev 2,4, Frederick S. Kaplan 2,4,5, Raghu Kalluri

More information

Summary MicroRNAs (mirnas) are genomically encoded small RNAs used by organisms to regulate the expression of proteins generated from messenger RNA

Summary MicroRNAs (mirnas) are genomically encoded small RNAs used by organisms to regulate the expression of proteins generated from messenger RNA Summary MicroRNAs (mirnas) are genomically encoded small RNAs used by organisms to regulate the expression of proteins generated from messenger RNA transcripts. The in vivo requirement of specific mirnas

More information