Long Noncoding RNA LOC Suppresses Apoptosis by. Targeting mir p and mir-4767 in Vascular Endothelial Cells
|
|
|
- Everett Morgan
- 5 years ago
- Views:
Transcription
1 Long Noncoding RNA LOC Suppresses Apoptosis by Targeting mir p and mir-4767 in Vascular Endothelial Cells Wei Lu 1, ShuYa Huang 1, Le Su 1, BaoXiang Zhao 2, *, JunYing Miao 1, 3, * 1 Shandong Provincial Key Laboratory of Animal Cells and Developmental Biology, School of Life Science, Shandong University, Jinan , China 2 Institute of Organic Chemistry, School of Chemistry and Chemical Engineering, Shandong University, Jinan , China 3 The Key Laboratory of Cardiovascular Remodeling and Function Research, Chinese Ministry of Education and Chinese Ministry of Health, Shandong University Qilu Hospital, Jinan, , China *Correspondence to: Prof. JunYing Miao and Prof. BaoXiang Zhao, Institute of Developmental Biology, School of Life Science, Shandong University, Jinan , China. Fax: ; Tel.: address: miaojy@sdu.edu.cn, bxzhao@sdu.edu.cn
2 Supplementary Information Supplementary Figures
3 Figure S1 Effect of ABO on VEC apoptosis induced by deprivation of serum and FGF-2. When HUVECs reached to 80% confluent, treated in three ways: Nor: M199 medium (with FGF-2 and serum); Ctr: basal M199 medium with 0.05% dimethyl sulfoxide (DMSO); ABO: basal M199 medium with 50 µm ABO. (A) The morphological changes of the cells treated in the three ways as described above for 12 and 24h. Scale bar: 20 μm. Images are representative of at least 3 independent experiments. (B) The changes of nuclear fragmentation and chromatin condensation were observed by AO staining in the cells treated in the three ways as described above for 12 and 24h. Scale bar: 20 μm. Images are representative of at least 3 independent experiments. (C) DNA fragmentation detected by TUNEL assay in the cells treated in the three ways as described above for 24h. Scale bar: 20 μm. Images are representative of at least 3 independent experiments. The percent of apoptosis was measured (%). Data are mean ± SEM. of three independent experiments. *P < 0.05, ** p < 0.01 vs. control (Ctr). n 3.
4 Figure S2 The cell-specific expression of lncrna LOC Data are mean ± SEM. of three independent experiments.
5 Figure S3 LncRNA LOC positively regulated cell viability in HUVECs. Cells were seeded onto 96-well plates. Nor: M199 medium (with FGF-2 and serum); OE-Ctr: transfected with pcdna3.1-empty vector; OE-LOC : transfected with pcdna3.1-loc at 0.2μg/mL; sictr: transfected with scramble RNA for negative control; siloc : transfected with siloc at 40nM for 24h. After transfected for 24h, all the cells described above were deprived of serum and FGF-2 for another 24h. SRB assay was used to determine the cell viability.
6 Figure S4 Uncropped blots probed with PARP and β-actin in Fiugre 2.
7 Figure S5 mirna quantified real-time PCR analysis of mir p/mir-4767 after transfection with mimics and inhibitor at 25, 50nM for 24h, then serum starvation for another 24h in HUVECs. Data are mean ± SEM. of three independent experiments. *P < 0.05, ** p < 0.01 vs. control (Ctr). n 3.
8 Figure S6 Predicted sites in 3 UTR of API5 and BCL2L12 targeted by mir p and mir (RNAhybrid) (A) Potential sites in API5 3 UTR targeted by mir p. (B) Potential sites in BCL2L12 3 UTR targeted by mir-4767.
9 Figure S7 Uncropped blots probed with PARP, API5 and β-actin in Fiugre 5A and B.
10 Figure S8 Uncropped blots probed with PARP, BCL2L12 and β-actin in Fiugre 5C and D.
11 Supplementary Tables Table S1. Differentially expressed transcripts induced by 50 μm ABO for 6 h under serum and FGF-2 starvation. Gene name Cy5/(T) Intensity Cy3/(C) Intensity Ratio(T/C) Increased LOC PDPK AK ARMET DKFZP566M COQ Decreased AK ABCC APEG GIMAP AK FGFBP TEKT ARMC FLJ LAG ZFPM KSP NGFR CXCL KEL KIAA Table S2. Primer pairs for quantitative real-time PCR. Gene name Sequence of sense primer Sequence of antisense primer ACTB GAAGTGTGACGTGGACATCC CCGATCCACACGGAGTACTT LOC GAGAGGACGGGAGAGGAGAC GTGAGGCAGGCGGTGAAG API5 GTCTTCATTACCATTACCTCTACACTG GATTATTGCCACCACTCCATAGC BCL2L12 GCTGTTTGGCACCGACTACC GGAGGAGACGATGAGGATGAGA mir p AATAAATAAGCCCCGGCG ACGCTTCACGAATTTGCGTGTC mir-4767 AATAATACGCGGGCGCTC ACGCTTCACGAATTTGCGTGTC LOC for RIP GCTTAGGGATGCTGGGTGATTT GATCTGCACGAGAGGCTTGG
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the
Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
Supplementary Figure 1 A
Supplementary Figure A B M. mullata p53, 3 UTR Luciferase activity (%) mir-5b 8 Le et al. Supplementary Information NC-DP - + - - - - - NC-DP - - + - - - - NC-DP3 - - - + - - - 5b-DP - - - - + + + NC-AS
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing
HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid
SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/496/eaam6291/dc1 Supplementary Materials for Regulation of autophagy, NF-κB signaling, and cell viability by mir-124 in KRAS mutant mesenchymal-like NSCLC cells
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
Supplementary information Activation of AMP-activated protein kinase
Supplementary information Activation of AMP-activated protein kinase 2 by nicotine instigates formation of abdominal aortic aneurysms in mice in vivo Shuangxi Wang 1,2,5, Cheng Zhang 1,2,5, Miao Zhang
b alternative classical none
Supplementary Figure. 1: Related to Figure.1 a d e b alternative classical none NIK P-IkBa Total IkBa Tubulin P52 (Lighter) P52 (Darker) RelB (Lighter) RelB (Darker) HDAC1 Control-Sh RelB-Sh NF-kB2-Sh
Glutamine activates STAT3 to control cancer cell proliferation. independently of glutamine metabolism
Glutamine activates STAT3 to control cancer cell proliferation S1 independently of glutamine metabolism Andrea Cacace, Martina Sboarina, Thibaut Vazeille, and Pierre Sonveaux Supplementary tables: Table
Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in
Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in mouse NOD/SCID/Jak3 null mice were transplanted with human CD34 + hematopoietic stem cells. (Top) Four weeks after the transplantation
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time
Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr
Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.
RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy
Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy of various tumor type TRCs, including H22 (murine hepatocarcinoma) and CT26 (murine colon cancer). Bar, 50 µm. b, B16 cells
Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95
Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:
Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
supplementary information
Figure S1 ZEB1 full length mrna. (a) Analysis of the ZEB1 mrna using the UCSC genome browser (http://genome.ucsc.edu) revealed truncation of the annotated Refseq sequence (NM_030751). The probable terminus
Supplementary Information
Supplementary Information MLL histone methylases regulate expression of HDLR- in presence of estrogen and control plasma cholesterol in vivo Khairul I. Ansari 1, Sahba Kasiri 1, Imran Hussain 1, Samara
a KYSE270-CON KYSE270-Id1
a KYSE27-CON KYSE27- shcon shcon sh b Human Mouse CD31 Relative MVD 3.5 3 2.5 2 1.5 1.5 *** *** c KYSE15 KYSE27 sirna (nm) 5 1 Id2 Id2 sirna 5 1 sirna (nm) 5 1 Id2 sirna 5 1 Id2 [h] (pg per ml) d 3 2 1
CDK5 is essential for TGF-β1-induced epithelial-mesenchymal transition and breast cancer progression
Supplementary information for: CDK5 is essential for TGF-β1-induced epithelial-mesenchymal transition and breast cancer progression Qian Liang, Lili Li, Jianchao Zhang, Yang Lei, Liping Wang, Dong-Xu Liu,
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1.
Supplementary Figure 1. Characterization and high expression of Lnc-β-Catm in liver CSCs. (a) Heatmap of differently expressed lncrnas in Liver CSCs (CD13 + CD133 + ) and non-cscs (CD13 - CD133 - ) according
SUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
B. Transgenic plants with strong phenotype (%)
A. TCTAGTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTT AAATATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAATATGG 2XP35S STTM165 5 GGGGGATGAAGctaCCTGGTCCGA3 3 CCCCCUACUUC---GGACCAGGCU5 mir165 HindIII mir165 96 nt GTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTT
Construction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
Electronic Supplementary Information
Electronic Supplementary Information Amplified Visualization of Protein-Specific Glycosylation in Zebrafish via Proximity-Induced Hybridization Chain Reaction Jingying Li, Shuya Liu, Liqin Sun, Wei Li,
mir-24-mediated down-regulation of H2AX suppresses DNA repair
Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn
Supplementary Figure 1.
Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed
Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of
Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,
Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two
![Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two](/thumbs/89/98549522.jpg "Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two")
Supplemental Materials and Methods Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two upstream regions of the human Klf9 gene (-5139 to -5771 bp and -3875 to -4211 bp)
Cell line CDH1 mrna AS-paRNA S-paRNA
a b Cell line mrna AS-paRNA S-paRNA HCT116 P53 +/+ 39.47 + + HCT116 P53 -/- 35.36 + + LNCAP 1562.4 + - MCF7 C1 1864.76 + - MCF7 C2 1812.81 + - Supplementary Figure 1. Promoter-associated transcripts at
Legend for Supplemental Figures and Tables
Legend for Supplemental Figures and Tables Supplemental Fig. 1. Negative regulation of the CYP27B1 promoter in a ligand-dependent manner (A) OK-P cells were transfected with pcdna-trα, pcdna-trβ1 or pcdna3
Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.
Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292
MeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by
Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by down-regulating PKA and CREB activation Sudha Saryu Malhotra 1, Pankaj Suman 2 and Satish Kumar Gupta 1 * 1 Reproductive
Supplementary Figure 1. NORAD expression in mouse (A) and dog (B). The black boxes indicate the position of the regions alignable to the 12 repeat
Supplementary Figure 1. NORAD expression in mouse (A) and dog (B). The black boxes indicate the position of the regions alignable to the 12 repeat units in the human genome. Annotated transposable elements
Supporting Information
Supporting Information Cascade Signal Amplification Based on Copper Nanoparticle-Reported Rolling Circle Amplification for Ultrasensitive Electrochemical Detection of the Prostate Cancer Biomarker Ye Zhu
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Generation of the AARE-Gene system construct. (a) Position and sequence alignment of AAREs extracted from human Trb3, Chop or Atf3 promoters. AARE core sequences are boxed in grey.
Supplementary Figure 1. Nur77 and leptin-controlled obesity. (A) (B) (C)
Supplementary Figure 1. Nur77 and leptin-controlled obesity. (A) Effect of leptin on body weight and food intake between WT and KO mice at the age of 12 weeks (n=7). Mice were i.c.v. injected with saline
Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information
Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information 1. Supplementary Figure S1-S10: Pages 2-11 2. Supplementary References:
Department of Geriatric Medicine, Graduate School of Medicine
(ONLINE DATA SUPPLEMENT) RENIN ANGIOTENSIN SYSTEM MODULATES OXIDATIVE STRESS- INDUCED ENDOTHELIAL CELL APOPTOSIS IN RATS Masahiro Akishita, MD, PhD 1 ; Kumiko Nagai, MS 1 ; Hang Xi, MD, PhD 1 ; Wei Yu,
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
WT Day 90 after injections
Supplementary Figure 1 a Day 1 after injections Day 9 after injections Klf5 +/- Day 1 after injections Klf5 +/- Day 9 after injections BLM PBS b Day 1 after injections Dermal thickness (μm) 3 1 Day 9 after
B. C. Staurosporine BEZ235 DMSO. -actin. Suppl. Fig. 1 BEZ235 and BGT226 inhibit phosphorylation of Akt and downstream targets of PI3K and mtor.
DMSO Staurosporine BGT226 A. B. C. BGT226 P-Akt 0 1 2 4 8 hrs. P-Akt 0 5 10 25 50 100 nm PS6 P-4E-BP1 -actin C-Caspase3 -actin PS6 P-4E-BP1 -actin Suppl. Fig. 1 and BGT226 inhibit phosphorylation of Akt
Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera
SUPPLEMENTARY INFORMATION Roles of human POLD1 and POLD3 in genome stability Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY METHODS Cell proliferation After sirna
Blimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling
1 2 3 4 5 6 7 8 9 10 11 Supplementary Methods Antibodies Blimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling (Danvers, MA) and used at 1:1000 to detect the total PRDM1 protein
Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of
Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and
Isolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
Utility of the dual-specificity protein kinase TTK as a therapeutic target
Utility of the dual-specificity protein kinase TTK as a therapeutic target for intrahepatic spread of liver cancer Ruoyu Miao, 1,2* Yan Wu, 2* Haohai Zhang, 1 Huandi Zhou, 3 Xiaofeng Sun, 2 Eva Csizmadia,
Supplementary Information. HBx-upregulated lncrna UCA1 promotes cell growth and tumorigenesis
Supplementary Information HBx-upregulated lncrna UCA1 promotes cell growth and tumorigenesis by recruiting EZH2 and repressing p27kip1/cdk2 signaling Jiao-Jiao Hu 1, Wei Song 1, Shao-Dan Zhang 1, Xiao-Hui
Therapeutic & Prevention Application of Nucleic Acids
Therapeutic & Prevention Application of Nucleic Acids Seyed Amir Hossein Jalali Institute of Biotechnology and Bioengineering, Isfahan University Of Technology (IUT). 30.7.2015 * Plasmids * DNA Aptamers
(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila
Molecular Cell, Volume 32 Supplemental Data Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila Rui Zhou, Ikuko Hotta, Ahmet M. Denli, Pengyu Hong, Norbert Perrimon, and Gregory
SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION
SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,
MiR-150 promotes cellular metastasis in non-small cell lung cancer by targeting
MiR-150 promotes cellular metastasis in non-small cell lung cancer by targeting FOXO4 Hui Li 1, #, Ruoyun Ouyang 2, #, Zi Wang 1, #, Weihua Zhou 1, Huiyong Chen 1, Yawen Jiang 1, Yibin Zhang 1, Hui Li
Supplementary Information
Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/198/ra74/dc1 Supplementary Materials for Short RNA Duplexes Elicit RIG-I Mediated Apoptosis in a Cell Type and Length-Dependent Manner Osamu Ishibashi, Md. Moksed
Supplemental Material for
Supplemental Material for TXI TELNGIECTSI MUTTED (TM)-MEDITED DN DMGE RESPONSE IN OXIDTIVE STRESS-INDUCED VSCULR ENDOTHELIL CELL SENESCENCE Hong Zhan 1, Toru Suzuki 1,2, Kenichi izawa 1, Kiyoshi Miyagawa,
of Medicine, Zhejiang University, Hangzhou, Zhejiang , China Michigan, 4424B MS-1, 1301 Catherine Street, Ann Arbor, MI 48109, USA.
Supplemental figure legends: Neddylation inhibitor MLN4924 suppresses growth and migration of human gastric cancer cells Huiyin Lan 1,2#, Zaiming Tang 1#, Hongchuan Jin 2, and Yi Sun 1,3,4* 1 Institute
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4
SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom
Document S1. Supplemental Experimental Procedures and Three Figures (see next page)
Supplemental Data Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Table S1. List of Candidate Genes Identified from the Screen. Candidate genes, corresponding dsrnas
IGF-1 promotes the development and cytotoxic activity of human NK cells regulated
Supplementary Information for IGF-1 promotes the development and cytotoxic activity of human NK cells regulated by mir-483-3p Fang Ni 1, 2, Rui Sun 1, Binqing Fu 1, Fuyan Wang 1, Chuang Guo 1, Zhigang
Effects of metformin on Sirt1, Nrf2 and AhR expression in cancer cells
A Dissertation for the Degree of Doctor of Philosophy Effects of metformin on Sirt1, Nrf2 and AhR expression in cancer cells Department of Pharmacy Graduate School Chungnam National University By Minh
Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
Galina Gabriely, Ph.D. BWH/HMS
Galina Gabriely, Ph.D. BWH/HMS Email: ggabriely@rics.bwh.harvard.edu Outline: microrna overview microrna expression analysis microrna functional analysis microrna (mirna) Characteristics mirnas discovered
Supplementary Figure 1. Additional RNAi screen data
Supplementary Figure 1. Additional RNAi screen data A. Cisplatin induced ATR autophosphorylation. Western blot illustrating ATR and phospho-atr (T1989) in cells exposed to 1 µm cisplatin for 24 hours prior
Supplementary Methods Plasmid constructs
Supplementary Methods Plasmid constructs. Mouse cdna encoding SHP-1, amplified from mrna of RAW264.7 macrophages with primer 5'cgtgcctgcccagacaaactgt3' and 5'cggaattcagacgaatgcccagatcacttcc3', was cloned
The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells
Supplementary Information The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells Bing Zhao 1,3, Zhen Qi 1,3, Yehua Li 1,3, Chongkai Wang 2,
Supplementary Figure 1, Wiel et al
Supplementary Figure 1, Wiel et al Supplementary Figure 1 ITPR2 increases in benign tumors and decreases in aggressive ones (a-b) According to the Oncomine database, expression of ITPR2 increases in renal
Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.
Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Construct name ISG12b2 (No tag) HA-ISG12b2 (N-HA) ISG12b2-HA (C-HA; FL-HA) 94-283-HA (FL-GFP) 93-GFP
Supplementary Information. ATM and MET kinases are synthetic lethal with. non-genotoxic activation of p53
Supplementary Information ATM and MET kinases are synthetic lethal with non-genotoxic activation of p53 Kelly D. Sullivan 1, Nuria Padilla-Just 1, Ryan E. Henry 1, Christopher C. Porter 2, Jihye Kim 3,
Cell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD
Supplemental information Materials and Methods: Cell lines, reagents and antibodies: Wild type (A3) and caspase-8 -/- (I9.2) Jurkat cells were cultured in RPMI 164 medium (Life Technologies) supplemented
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
Supplemental Data. Na Xu et al. (2016). Plant Cell /tpc
Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site
SUPPLEMENTARY INFORMATION
Supplementary Figure a T m ( C) Seq. '-3' uguuugugguaacagugugaggu L 62 AttGtcAcaCtcC L2 6 ccattgtcacactcc L3 66 attgtcacactcc 7 ccattgtcacactcca L 73 ccattgtcacactcc L6 74 AttGTcaCaCtCC L7 7 attgtcacactcc
Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.
Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either
Supplementary Figure 1: MYCER protein expressed from the transgene can enhance
Relative luciferase activity Relative luciferase activity MYC is a critical target FBXW7 MYC Supplementary is a critical Figures target 1-7. FBXW7 Supplementary Material A E-box sequences 1 2 3 4 5 6 HSV-TK
Xu et al., Supplementary Figures 1-7
Xu et al., Supplementary Figures 1-7 Supplementary Figure 1. PIPKI is required for ciliogenesis. (a) PIPKI localizes at the basal body of primary cilium. RPE-1 cells treated with two sirnas targeting to
Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers
Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers T.R. Mereniuk et al. Supplemental tlmt Material: il Supplemental l Figures
Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3
ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated
SureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
Supplemental Methods Cell lines and culture
Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals,
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
Supplementary Figure 1. Adipogenic protein expression in WT and KO MEFs after 7 days of adipogenic differentiation.
Merkestein et al. Supplementary Figure 1 A PLIN WT FTO KO 72 kda FABP4 17 kda HSC70 72 kda B Supplementary Figure 1. Adipogenic protein expression in WT and KO MEFs after 7 days of adipogenic differentiation.
Supplementary Information
Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on
Supplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
Estradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway
Estradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway Pelin Yaşar, Gamze Ayaz and Mesut Muyan SUPPLEMENTARY INFORMATION
Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation
1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura
JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Paul et al.,
Supplemental material JCB Paul et al., http://www.jcb.org/cgi/content/full/jcb.201502040/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Mutant p53-expressing cells display limited retrograde actin flow at
Supplementary Data. Supplementary Materials and Methods Quantification of delivered sirnas. Fluorescence microscopy analysis
Supplementary Data Supplementary Materials and Methods Quantification of delivered sirnas After transfection, cells were washed in three times with phosphate buffered saline and total RNA was extracted
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
Transcription Factor Runx3 Is Induced by Influenza A Virus and Double-Strand RNA and
Transcription Factor Is Induced by Influenza A Virus and Double-Strand RNA and Mediates Airway Epithelial Cell Apoptosis Huachen Gan 1, Qin Hao 1, Steven Idell 1,2 & Hua Tang 1 1 Department of Cellular
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of
Partial list of differentially expressed genes from cdna microarray, comparing MUC18-
Supplemental Figure legends Table-1 Partial list of differentially expressed genes from cdna microarray, comparing MUC18- silenced and NT-transduced A375SM cells. Supplemental Figure 1 Effect of MUC-18
Supplemental Table S1. RT-PCR primers used in this study
Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------