Illumina Read QC. UCD Genome Center Bioinformatics Core Monday 29 August 2016
|
|
- Garry Cox
- 6 years ago
- Views:
Transcription
1 Illumina Read QC UCD Genome Center Bioinformatics Core Monday 29 August 2016
2 QC should be interactive
3 Error modes Each technology has unique error modes, depending on the physico-chemical processes involved in the whole sequencing life cycle (not just base-calling step). Improving reads will work better if the assumptions made by the remediation tools match the source(s) of error. How do you know? Trial and error? Read QC is experimental, just like bench science.
4 Illumina read problems Contaminating sequence within reads adapters adapter dimers Poor quality and/or wrong sequence substitution, insertion / deletion ( indel ) errors Sample contamination Chimerism in library Sampling bias
5 Illumina errors Illumina errors are biased - they occur after some sequence motifs (not well addressed by any tools currently, IMO), and predominantly at the 3 -ends of reads.
6 Illumina - 3 -end errors
7 Illumina - 3 -end errors
8 Illumina - error rates Overall Illumina error rate ~ 0.1-1% Of that, 99% are substitutions, 1% are insertions / deletions ( indels )
9 Quality Remediation: Sickle
10 Adapter contamination
11 Adapter contamination Older "in-line" or "homebrew" adapters can be added to one or both ends of DNA library fragments. Tools like Sabre (Nik Joshi) can recognize these, separate reads into different files, and remove barcode bases.
12 Adapter contamination The problem is heterogeneous fragment sizes, resulting from any of the current library preparation techniques. All libraries will contain DNA fragments of variable size.
13 Adapter contamination Contamination is the result of the sequencer reading through a short read, into adapter sequence that didn't come from your sample!
14 Adapter contamination Where can you find out adapter sequences? Google "github ucdavis-bioinformatics", look for Scythe, look for "*_adapters.fa" Check Seqanswers.com Contact Illumina, PacBio, etc. for "tech notes" specifying the library prep primer / adapter sequences (not always that clear to work out). Find them in your data.
15 Adapter contamination >TruSeq_forward_contam AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[8bp index]atctcgtatgccgtcttctgcttgaaaaa >TruSeq_reverse_contam AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT[8bp index]gtggtcgccgtatcattaaaaa >Nextera_forward_contam CTGTCTCTTATACACATCTCCGAGCCCACGAGAC[8bp index]atctcgtatgccgtcttctgcttg >Nextera_reverse_contam CTGTCTCTTATACACATCTGACGCTGCCGACGA[8bp index]gtgtagatctcggtggtcgccgtatcatt >TruSeq_SmallRNA_forward_contam TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC[6bp adapter]atctcgtatgccgtcttctgcttg >TruSeq_SmallRNA_reverse_contam GATCGTCGGACTGTAGAACTCTGAACCTGTCG Also note small RNA trimming instructions here: find mirna on page
16 Adapter Removal: Scythe
17 Error Correction Paired-read overlap ( read merging, paired read assemblers ) FLASH PEAR PANDAseq Correct bases in overlapping region; output a single read No merging / correction possible; output pair of reads Correct in overlapping region; trim overhangs (adapter); output single read
18 Questions?
19 Illumina - 3 -end errors (glass substrate)
20 Illumina - 3 -end errors (glass substrate)
21 Illumina - 3 -end errors 5 -CTCTTCCGATCT <-- add sequencing primers 5 -CTCTTCCGATCT 5 -CTCTTCCGATCT 5 -CTCTTCCGATCT 5 -CTCTTCCGATCT 5 -CTCTTCCGATCT (glass substrate) 5 -CTCTTCCGATCT 5 -CTCTTCCGATCT
22 Illumina - 3 -end errors 5 -CTCTTCCGATCTC <-- cycle 1 5 -CTCTTCCGATCTC 5 -CTCTTCCGATCTC 5 -CTCTTCCGATCTC 5 -CTCTTCCGATCTC 5 -CTCTTCCGATCTC (glass substrate) 5 -CTCTTCCGATCTC 5 -CTCTTCCGATCTC
23 Illumina - 3 -end errors 5 -CTCTTCCGATCTCT <-- cycle 2 5 -CTCTTCCGATCTCT 5 -CTCTTCCGATCTCT 5 -CTCTTCCGATCTCT 5 -CTCTTCCGATCTCT 5 -CTCTTCCGATCTCT (glass substrate) 5 -CTCTTCCGATCTCT 5 -CTCTTCCGATCTCT
24 Illumina - 3 -end errors 5 -CTCTTCCGATCTCTC <-- cycle 3 5 -CTCTTCCGATCTCTC 5 -CTCTTCCGATCTCTC 5 -CTCTTCCGATCTCTC 5 -CTCTTCCGATCTCTC 5 -CTCTTCCGATCTCTC (glass substrate) 5 -CTCTTCCGATCTCTC 5 -CTCTTCCGATCTCTC
25 Illumina - 3 -end errors 5 -CTCTTCCGATCTCTCTGCGCTTGAGAG in phase 5 -CTCTTCCGATCTCTCTGCGCTTGAGAG in phase 5 -CTCTTCCGATCTCTCTGCGCTTGAGAGA pre-phasing (+1) 5 -CTCTTCCGATCTCTCTGCGCTTGAGAG in phase 5 -CTCTTCCGATCTCTCTGCGCTTGAGAG in phase 5 -CTCTTCCGATCTCTCTGCGCTTGAGAG in phase (glass substrate) 5 -CTCTTCCGATCTCTCTGCGCTTGAGA post-phasing (-1) 5 -CTCTTCCGATCTCTCTGCGCTTGAGAG in phase
26 Illumina - 3 -end errors Cycle 1 # of molecules A T C G True cycle offset (pre- / post-phasing events)
27 Illumina - 3 -end errors Cycle 15 # of molecules stochastic variability A T C G Process Error
28 Illumina - 3 -end errors Intensity = A T C G Measurement Error
29 Illumina - 3 -end errors Measurement Error
Single Cell Genomics
Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell
More informationHigh Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015
High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio
More informationGenomics AGRY Michael Gribskov Hock 331
Genomics AGRY 60000 Michael Gribskov gribskov@purdue.edu Hock 331 Computing Essentials Resources In this course we will assemble and annotate both genomic and transcriptomic sequence assemblies We will
More informationAutomated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep
Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS LIBRARY PREP FOR NEXT GEN SEQUENCING PROTEIN EXPRESSION &
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationInfectious Disease Omics
Infectious Disease Omics Metagenomics Ernest Diez Benavente LSHTM ernest.diezbenavente@lshtm.ac.uk Course outline What is metagenomics? In situ, culture-free genomic characterization of the taxonomic and
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationRNA-Seq Software, Tools, and Workflows
RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:
More informationConsiderations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center
Considerations for Illumina library preparation Henriette O Geen June 20, 2014 UCD Genome Center Diversity of applications De novo genome Sequencing ranscriptome Expression Splice Isoform bundance Genotyping
More informationTargeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales
Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology
More informationJenny Gu, PhD Strategic Business Development Manager, PacBio
IDT and PacBio joint presentation Characterizing Alzheimer s Disease candidate genes and transcripts with targeted, long-read, single-molecule sequencing Jenny Gu, PhD Strategic Business Development Manager,
More informationAlignment. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014
Alignment J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationIntroduction to RNA-Seq
Introduction to RNA-Seq Monica Britton, Ph.D. Sr. Bioinformatics Analyst March 2015 Workshop Overview of RNA-Seq Activities RNA-Seq Concepts, Terminology, and Work Flows Using Single-End Reads and a Reference
More informationRNA-Seq with the Tuxedo Suite
RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop The Basic Tuxedo Suite References Trapnell C, et al. 2009 TopHat: discovering splice junctions with
More informationRIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)
Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information
More informationLong and short/small RNA-seq data analysis
Long and short/small RNA-seq data analysis GEF5, 4.9.2015 Sami Heikkinen, PhD, Dos. Topics 1. RNA-seq in a nutshell 2. Long vs short/small RNA-seq 3. Bioinformatic analysis work flows GEF5 / Heikkinen
More informationNext Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017
Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA
More informationAnalysing genomes and transcriptomes using Illumina sequencing
Analysing genomes and transcriptomes using Illumina uencing Dr. Heinz Himmelbauer Centre for Genomic Regulation (CRG) Ultrauencing Unit Barcelona The Sequencing Revolution High-Throughput Sequencing 2000
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationEcole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech
GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG
More informationSequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
More informationNext Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
More informationIncorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits
Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationGenome Assembly. J Fass UCD Genome Center Bioinformatics Core Friday September, 2015
Genome Assembly J Fass UCD Genome Center Bioinformatics Core Friday September, 2015 From reads to molecules What s the Problem? How to get the best assemblies for the smallest expense (sequencing) and
More informationTechnical note: Molecular Index counting adjustment methods
Technical note: Molecular Index counting adjustment methods By Jue Fan, Jennifer Tsai, Eleen Shum Introduction. Overview of BD Precise assays BD Precise assays are fast, high-throughput, next-generation
More informationGenomics and Transcriptomics of Spirodela polyrhiza
Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence
More informationSOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit
SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationRNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
More informationRADSeq Data Analysis. Through STACKS on Galaxy. Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé
RADSeq Data Analysis Through STACKS on Galaxy Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé RAD sequencing: next-generation tools for an old problem INTRODUCTION source: Karim Gharbi
More information1.1 Post Run QC Analysis
Post Run QC Analysis 100 339 200 01 1. Post Run QC Analysis 1.1 Post Run QC Analysis Welcome to Pacific Biosciences' Post Run QC Analysis Overview. This training module will describe the workflow to assess
More informationBioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationA shotgun introduction to sequence assembly (with Velvet) MCB Brem, Eisen and Pachter
A shotgun introduction to sequence assembly (with Velvet) MCB 247 - Brem, Eisen and Pachter Hot off the press January 27, 2009 06:00 AM Eastern Time llumina Launches Suite of Next-Generation Sequencing
More informationAnnouncements. Coffee! Evalua,on. Dr. Yoshiki Sasai, R.I.P.
Announcements Coffee! Evalua,on. Dr. Yoshiki Sasai, R.I.P. Sequencing considerations Three basic problems Resequencing, coun,ng, and assembly. A. B. C. 1. Resequencing analysis We know a reference genome,
More informationThird Generation Sequencing
Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence
More informationMapping strategies for sequence reads
Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements
More informationIntroduction to Next Generation Sequencing (NGS)
Introduction to Next eneration Sequencing (NS) Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark 2012 Today 9.00-9.45: Introduction to NS, How it
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationQIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
More informationData Analysis with CASAVA v1.8 and the MiSeq Reporter
Data Analysis with CASAVA v1.8 and the MiSeq Reporter Eric Smith, PhD Bioinformatics Scientist September 15 th, 2011 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense
More informationLab methods: Exome / Genome. Ewart de Bruijn
Lab methods: Exome / Genome 27 06 2013 Ewart de Bruijn Library prep is only a small part of the complete DNA analysis workflow DNA isolation library prep enrichment flowchip prep sequencing bioinformatics
More informationA Genomics (R)evolution: Harnessing the Power of Single Cells
A Genomics (R)evolution: Harnessing the Power of Single Cells Fundamental Question #1 If Transcriptional Heterogeneity ( Noise ) is so great in single cells What s the Point? Single Cells = True Biology
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationManipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
More informationLawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory
Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory Title Glomus intraradices: Initial Whole-Genome Shotgun Sequencing and Assembly Results Permalink https://escholarship.org/uc/item/4c13k1dh
More informationGenomic DNA ASSEMBLY BY REMAPPING. Course overview
ASSEMBLY BY REMAPPING Laurent Falquet, The Bioinformatics Unravelling Group, UNIFR & SIB MA/MER @ UniFr Group Leader @ SIB Course overview Genomic DNA PacBio Illumina methylation de novo remapping Annotation
More informationNEBNext. for Ion Torrent LIBRARY PREPARATION KITS
NEBNext for Ion Torrent LIBRARY PREPARATION KITS NEBNEXT PRODUCTS FOR ION TORRENT Table of Contents 3 General Introduction 4 5 6 6 7 8 DNA Library Preparation Workflow Product Selection Product Details
More informationNOW GENERATION SEQUENCING. Monday, December 5, 11
NOW GENERATION SEQUENCING 1 SEQUENCING TIMELINE 1953: Structure of DNA 1975: Sanger method for sequencing 1985: Human Genome Sequencing Project begins 1990s: Clinical sequencing begins 1998: NHGRI $1000
More informationNext Generation Sequencing. Target Enrichment
Next Generation Sequencing Target Enrichment Next Generation Sequencing Your Partner in Every Step from Sample to Data NGS: Revolutionizing Genetic Analysis with Single-Molecule Resolution Next generation
More informationBase Composition of Sequencing Reads of Chromium Single Cell 3 v2 Libraries
TECHNICAL NOTE Base Composition of Sequencing Reads of Chromium Single Cell 3 v2 Libraries INTRODUCTION The Chromium Single Cell 3 v2 Protocol (CG00052) produces Single Cell 3 libraries, ready for Illumina
More informationEfficiency in Next-Generation Sequencing for Public Health
Efficiency in Next-Generation Sequencing for Public Health Patrick Van Roey June 27, 2016 June 27, 2016 2 Overview Introduction Applied Genomic Technologies Core Implementing NGS for Public Health NGS
More informationIntroductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology
Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as
More informationTargeted Sequencing in the NBS Laboratory
Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationIntroduction to genome biology
Introduction to genome biology Lisa Stubbs We ve found most genes; but what about the rest of the genome? Genome size* 12 Mb 95 Mb 170 Mb 1500 Mb 2700 Mb 3200 Mb #coding genes ~7000 ~20000 ~14000 ~26000
More informationDe novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Bioinformatics Facility Cornell University Data generation Sequencing Platforms Short reads: Illumina Long reads: PacBio; Oxford Nanopore Contiging/Scaffolding
More informationProbes can be designed in an evolutionary hierarchy
Probes can be designed in an evolutionary hierarchy Probes can be designed to be highly redundant to increase the certainly of identification The match between clone counts and hybridization intensity
More information2 Gene Technologies in Our Lives
CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?
More informationSome types of Mutagenesis
Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine
More informationRNAseq Differential Gene Expression Analysis Report
RNAseq Differential Gene Expression Analysis Report Customer Name: Institute/Company: Project: NGS Data: Bioinformatics Service: IlluminaHiSeq2500 2x126bp PE Differential gene expression analysis Sample
More information1. A brief overview of sequencing biochemistry
Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry
More informationPCR settings, pitfalls and artefacts
De gekoppelde afbeelding kan niet worden weergegeven. Het bestand is mogelijk verplaatst, heeft een andere naam gekregen of is verwijderd. Controleer of de koppeling verwijst naar het juiste bestand en
More informationBioinformatics for High Throughput Sequencing
Bioinformatics for High Throughput Sequencing Eric Rivals LIRMM & IBC, Montpellier http://www.lirmm.fr/~rivals http://www.lirmm.fr/~rivals 1 / High Throughput Sequencing or Next Generation Sequencing High
More informationHow much sequencing do I need? Emily Crisovan Genomics Core
How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationTruSeq ChIP Sample Preparation
FOR RESEARCH USE ONLY Date: Illumina Kit Description: NOTE Unless familiar with the protocol in the latest version of the TruSeq ChIP Sample Preparation Guide (part # 15023092), new or less experienced
More informationNext Generation Sequencing Technologies. Rob Mitra 1/30/17
Next Generation Sequencing Technologies Rob Mitra 1/30/17 Outline Overview of next-generation sequencing How does it work? What technologies are being used? How would one use it in practice? Math basic
More informationMarch 20-23, 2010 Sacramento, CA
Comparison of Commercially Available Target Enrichment Methods for Next Generation Sequencing with the Illumina Platform March 20-23, 2010 Sacramento, CA Anoja Perera, Scottie Adams, David Bintzler, Kip
More information2100 Bioanalyzer. Overview & News. Ralph Beneke Dec 2010
2100 Bioanalyzer Overview & News Ralph Beneke Dec 2010 RNA QC in Gene Expression Workflows Cited in over 10,000 peer-reviewed papers RIN is the industry standard for RNA QC For any size and at low sample
More informationAssembly of Ariolimax dolichophallus using SOAPdenovo2
Assembly of Ariolimax dolichophallus using SOAPdenovo2 Charles Markello, Thomas Matthew, and Nedda Saremi Image taken from Banana Slug Genome Project, S. Weber SOAPdenovo Assembly Tool Short Oligonucleotide
More informationSymphony Genomics Workflow Management System Managing, Integrating, and Delivering Your NGS Data and Results
Symphony Genomics Workflow Management System Managing, Integrating, and Delivering Your NGS Data and Results Precision Genomics for Immuno-Oncology www.personalis.com info@personalis.com 1 855-GENOME4
More informationDe novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Minghui Wang Bioinformatics Facility Cornell University DNA Sequencing Platforms Illumina sequencing (100 to 300 bp reads) Overlapping reads ~180bp fragment
More informationBiochemistry 412. New Strategies, Technologies, & Applications For DNA Sequencing. 12 February 2008
Biochemistry 412 New Strategies, Technologies, & Applications For DNA Sequencing 12 February 2008 Note: Scale is wrong!! (at least for sequences) 10 6 In 1980, the sequencing cost per finished bp $1.00
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationWELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)
WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow
More informationBIOINFORMATICS 1 SEQUENCING TECHNOLOGY. DNA story. DNA story. Sequencing: infancy. Sequencing: beginnings 26/10/16. bioinformatic challenges
BIOINFORMATICS 1 or why biologists need computers SEQUENCING TECHNOLOGY bioinformatic challenges http://www.bioinformatics.uni-muenster.de/teaching/courses-2012/bioinf1/index.hbi Prof. Dr. Wojciech Makałowski"
More informationRNA spike-in controls & analysis methods for trustworthy genome-scale measurements
RNA spike-in controls & analysis methods for trustworthy genome-scale measurements Sarah A. Munro, Ph.D. Genome-Scale Measurements Group ABRF Meeting March 29, 2015 Overview External RNA Controls Consortium
More informationCOPE: An accurate k-mer based pair-end reads connection tool to facilitate genome assembly
Bioinformatics Advance Access published October 8, 2012 COPE: An accurate k-mer based pair-end reads connection tool to facilitate genome assembly Binghang Liu 1,2,, Jianying Yuan 2,, Siu-Ming Yiu 1,3,
More informationSerial Analysis of Gene Expression
Serial Analysis of Gene Expression Cloning of Tissue-Specific Genes Using SAGE and a Novel Computational Substraction Approach. Genomic (2001) Hung-Jui Shih Outline of Presentation SAGE EST Article TPE
More informationDe Novo Assembly of High-throughput Short Read Sequences
De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,
More informationNGS: Digital RNAseq & Library Prep Seminar. Next-Generation Sequencing Lunch & Learn
NGS: Digital RNAseq & Library Prep Seminar Next-Generation Sequencing Lunch & Learn Samuel Rulli, Ph. D Global Product Manager QIAseq Targeted RNA Panels 1 Targeted sequencing with UMIs QIAseq mirnaseq
More informationBarcode Sequence Alignment and Statistical Analysis (Barcas) tool
Barcode Sequence Alignment and Statistical Analysis (Barcas) tool 2016.10.05 Mun, Jihyeob and Kim, Seon-Young Korea Research Institute of Bioscience and Biotechnology Barcode-Sequencing Ø Genome-wide screening
More informationBST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data
BST227 Introduction to Statistical Genetics Lecture 8: Variant calling from high-throughput sequencing data 1 PC recap typical genome Differs from the reference genome at 4-5 million sites ~85% SNPs ~15%
More informationSMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
More informationGene Regulation & Mutation 8.6,8.7
Gene Regulation & Mutation 8.6,8.7 Eukaryotic Gene Regulation Transcription factors: ensure proteins are made at right time and in right amounts. One type forms complexes that guide & stabilize binding
More informationi5 Dual Indexing Add-on Kit for QuantSeq/SENSE for Illumina Instruction Manual
i5 Dual Indexing Add-on Kit for QuantSeq/SENSE for Illumina Instruction Manual Catalog Numbers: 001 (SENSE mrna-seq Library Prep Kit V2 for Illumina) 009 (SENSE Total RNA-Seq Library Prep Kit for Illumina)
More informationHuman genome sequence
NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion
More informationbioinformatics: state of art tools for NGS immunogenetics
bioinformatics: state of art tools for NGS immunogenetics Nikos Darzentas, Ph.D. CEITEC MU, Brno, Czech Republic bat.infspire.org nikos.darzentas@gmail.com Ministry of Health of theczech Republic, grant#
More informationMeasuring transcriptomes with RNA-Seq
Measuring transcriptomes with RNA-Seq BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2017 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC BY-NC
More informationGap Filling for a Human MHC Haplotype Sequence
American Journal of Life Sciences 2016; 4(6): 146-151 http://www.sciencepublishinggroup.com/j/ajls doi: 10.11648/j.ajls.20160406.12 ISSN: 2328-5702 (Print); ISSN: 2328-5737 (Online) Gap Filling for a Human
More informationRNA-seq Data Analysis
Lecture 3. Clustering; Function/Pathway Enrichment analysis RNA-seq Data Analysis Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Lecture 1. Map RNA-seq read to genome Lecture
More informationAnalysis of large deletions in human-chimp genomic alignments. Erika Kvikstad BioInformatics I December 14, 2004
Analysis of large deletions in human-chimp genomic alignments Erika Kvikstad BioInformatics I December 14, 2004 Outline Mutations, mutations, mutations Project overview Strategy: finding, classifying indels
More informationNext Generation Sequencing. Dylan Young Biomedical Engineering
Next Generation Sequencing Dylan Young Biomedical Engineering What is DNA? Molecule composed of Adenine (A) Guanine (G) Cytosine (C) Thymine (T) Paired as either AT or CG Provides genetic instructions
More informationHarnessing the power of RADseq for ecological and evolutionary genomics
STUDY DESIGNS Harnessing the power of RADseq for ecological and evolutionary genomics Kimberly R. Andrews 1, Jeffrey M. Good 2, Michael R. Miller 3, Gordon Luikart 4 and Paul A. Hohenlohe 5 Abstract High-throughput
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More information