Nature Methods doi: /nmeth Supplementary Figure 1. Screening for cancer stem cell marker(s)

Size: px

Start display at page:

Download "Nature Methods doi: /nmeth Supplementary Figure 1. Screening for cancer stem cell marker(s)"

Darren May
6 years ago
Views:

1 Supplementary Figure 1 Screening for cancer stem cell marker(s) (a) Flow cytometry analysis of CD133 at increasing times to analysis. Cells were trypsinized, stained, transferred to RPMI medium and then flow cytometry analysis was performed with 0, 10, 20, or 60 min delay. (b) Flow cytometry analysis of CD44 + CD133 + and CD44 + cmet + in 185 (left panel) and 215 cells cultured as adherent cells or spheres. (c) Representative in vivo tumorigenicity of cells sorted for different surface marker (combinations). * For statistical analysis, we used limiting dilution analysis (LDA; LDA is based on the Poisson single-hit model, which assumes that the number of biological active cells in each group varies according to a Poisson distribution, and a single biologically active cell is sufficient for inducing tumor formation. n.s., not significant.

2 Supplementary Figure 2 Screening for cancer stem cell marker(s) (a) Representative cytometry plots for side population (SP) and non-side population (Non-SP) cells derived from primary PDAC tissue (untreated or treated with FTC) (left panel). Representative images of sphere formation for SP versus non-sp cells and subsequent quantification (right panel). (b) In vivo tumorigenicity of SP versus non-sp cells (top row, left panel), of aldehyde dehydrogenases (ALDH) negative versus ALDH positive (top row, right panel), adherent versus sphere-derived cells (bottom row, left panel), and Fluo versus Fluo + cells (bottom row, right panel). * For statistical analysis, we used limiting dilution analysis (LDA; n.s., not significant.

3 Supplementary Figure 3 Screening for cancer stem cell marker(s) In vivo tumorigenicity of primary cells sorted for various CSC markers. * For statistical analysis, we used limiting dilution analysis (LDA; n.s., not significant.

4 Supplementary Figure 4 Identification of autofluorescent cancer stem cells (a) Representative cytometry plots showing no excitation of autofluorescence with 561 nm yellow-green laser (left panel) and with 640 nm red laser (right panel) using the indicated filters. (b) Emission spectra for GFP and autofluorescence, respectively. (c) RTqPCR analysis of GFP mrna expression. Control values for each sample were compared to a standard curve comprised of serially diluted GFP DNA (left panel). Western blot analysis of GFP protein expression in indicated samples (right panel). (d) Flow cytometry of cell size for Fluo + and Fluo cells, respectively.

5 Supplementary Figure 5 Identification of autofluorescent cancer stem cells (a) Genotyping comparison for unsorted, sorted Fluo + and sorted Fluo from 3 different PDX samples. Sample groups shared a 100% similar genotype profile (upper table). Graph sample for the SNP rs showing the same genotype profile between each patient tumor sample (lower panel) (b) Flow cytometry analysis of autofluorescent content in a freshly digested patient sample (left panel), gated for EPCAM + cells in Fluo + population (upper right) and Fluo - (lower panel). (c) Flow cytometry analysis of stroma and epithelial cells in a freshly digested patient tumor stained for EpCAM. EpCAM - cells (stroma) were gated to analyze the autofluorescent content.

6 Supplementary Figure 6 Identification of autofluorescent cancer stem cells (a) Representative flow cytometry plots illustrating the gating strategy used for autofluorescence analyses. (b) Representative flow cytometry plots for AnnexinV staining in Fluo + and Fluo cells.

7 Supplementary Figure 7 Characterization of autofluorescent cancer stem cells (a) Flow cytometry analysis of autofluorescence content in CRC-014 and CRC-010 tumors (left panel). RT-qPCR analysis of pluripotency-associated gene expression in sorted Fluo + and Fluo cells from CRC-014 and CRC-010 (n=2, performed in triplicate). Data are normalized for ß-actin expression (right panel). (b) Flow cytometry analysis of autofluorescence content in HCC-6 cells (left panel), RT-qPCR analysis of pluripotency-associated gene expression in primary HCC sorted for Fluo + and Fluo cells. Data are normalized for ß-actin expression and performed in triplicate (right panel). (c) Flow cytometry analysis of autofluorescence content in Lung-005 tumors (left panel). RT-qPCR analysis of pluripotency-associated gene expression in sorted NSCLC Fluo + and Fluo cells. Data are normalized for ß-actin expression and performed in triplicate (right panel). (d) Autofluorescent content in different primary patient and PDX tumors. Statistical significance was assessed by Mann-Whitney test.

Supplementary Figure 8 Characterization of autofluorescent cancer stem cells (a) Polydimethyl-siloxane post-arrays containing several thousand nano-volume wells (left panel).

8 Supplementary Figure 8 Characterization of autofluorescent cancer stem cells (a) Polydimethyl-siloxane post-arrays containing several thousand nano-volume wells (left panel). Representative images of single Fluo + cells giving rise to either (i) two Fluo + cells or (ii) one Fluo and one Fluo + cell. Arrows indicate Fluo + cells (upper right panels). Representative images of a Fluo cells giving rise to two Fluo cells (lower right panel). (b) In vivo serial passaging of Fluo and Fluo + cells derived from respective tumors originally generated from 10 3 cells. (c) Flow cytometry plot for autofluorescent content in PDAC PDX single cell-derived tumor (left panel). RT-qPCR analysis of pluripotency-associated gene expression in sorted Fluo + and Fluo cells obtained from PDAC PDX single cell-derived tumor (right panel). Data are normalized for ß-actin expression and performed in triplicate. Error bars (c) s.d. Statistical significance was assessed by Mann-Whitney test. For statistical analysis, we used limiting dilution analysis (LDA;

9 Supplementary Figure 9 Characterization of autofluorescent cancer stem cells (a) RT-qPCR analysis of pluripotency-associated gene expression in sorted Fluo and Fluo + cells derived from PDAC-Tumor-02, freshly digested and without culture or supplementation with Riboflavin. Data are normalized using ß-actin expression and performed in triplicate. (b) In vivo tumorigenicity of serially diluted sorted Fluo and Fluo + cells derived from freshly resected PDX tumors and primary tumors, respectively, without any culturing or supplementation with Riboflavin (right panel). (c) Unsorted cells were treated with Gemcitabine for 12 days. Following treatment, cells were sorted for autofluorescence and injected into mice. Shown are the tumorigenicity results of long-term Gemcitabine treated Fluo and Fluo + sorted cells after two months. Error bars (a) s.d. Statistical significance was assessed by Mann-Whitney test. For statistical analysis of tumorigenicity, we used limiting dilution analysis (LDA;

10 Supplementary Figure 10 Origin and mechanism of autofluorescence (a) Intracellular ATP content in sorted Fluo + and Fluo cells and unsorted cells. (b) RT-qPCR analysis of ATG12 gene expression in sorted Fluo + and Fluo cells of different primary PDAC PDX in vitro cultures (n = 2, each performed in duplicate) (upper panel). Western blot analysis of LC3 protein expression in sorted Fluo + and Fluo primary PDAC PDX in vitro cells (lower panel). (c) Representative flow cytometry analysis for autofluorescence content using specific autophagy inhibitors (E64D [10 µm] plus Pepstatin-A [1 µg/ml]) or the autophagy inducer Rapamycin (100 ng/ml). (d) Representative flow cytometry plots illustrating the recovery of autofluorescence following the addition of various vitamins. Error bars (a) s.d. of two technical replicates.

11 Supplementary Figure 11 Source of autofluorescence in cancer stem cells (a) RT-qPCR analysis of pluripotency-associated gene expression in sorted Fluo and Fluo + PDAC PDX in vitro cultured (185) cells either untreated or pretreated with 30 µm riboflavin for 24 h. Data are normalized for β-actin expression (left panel). Tumorigenicity of serially diluted sorted Fluo + and Fluo 185 cells pre-treated with riboflavin 30 µm (right panel). (b) Panc01 and implanted subcutaneously (upper panel) and orthotopically (lower panel), and treated with or without riboflavin prior to analysis. Error bars (a) s.d. of two technical replicates. For statistical analysis of tumorigenicity, we used limiting dilution analysis (LDA;

12 Supplementary Table 1 Composition of utilized media RPMI Media AMINO ACIDS Glycine L-Arginine L-Asparagine L-Aspartic acid Cyclopamine L-Cystine L-Glutamic Acid L-Glutamine L-Histidine L-Hydroxyproline L-Isoleucine L-Lysine L-Methionine L-Phenylalanine L-Proline L-Serine L-Threonine L-Tryptohan L-Tyrosine L-Valine VITAMINS Biotin Choline Chloride D-Calcium pantothenate (Vit B5) Folic Acid (Vit B9) Niacinamide Para-Aminobenzoic Acid Pyridoxine Hydroxhloride (Vit B6) Riboflavin (Vit B2) Thiamine hydrocloride (Vit B1) Vitamin B12 I-Inositol Basal Media DMEM gfp Antibleaching live cell visualization Evrogen, Moscow, Russia Component Contentration, mg/l CaCl FeSo 4 x7h KCl 400 MgSO NaCl 6400 NaHCO NaH 2 PO Glucose 4500 Sodium Pyruvate 110 L-Arginine HCl 84 L-Cystine 63 Glycine 30 L-Histidine HClxH 2 O 42 L-isoleucine 105 L-Leucine 105 L-Lysine HCl 146 L-Methionine 30 L-Phenytalanine 66 L-Serine 42 L-Threonine 95 L-Triptophan 16 L-Tyrosine 2Na x 2 H 2 O 104 L-Valine 94 Vitamin Cocktail Component Vitamins Concentration (mg/l) Choline Chloride 100 D-Calcium pantothenate 100 Folic Acid 100 Nicotinamide 100 Pyridoxal hydrochloride 100 Riboflavin 10 Thiamine hydrochloride 100 i-inositol 200 Inorganic Salts Sodium Chloride (NaCl) 8500 Supplementary Table 1. Composition of RPMI media (left panel), basal media (middle panel), and vitamin cocktail (right panel). Nature Methods: doi: /nmeth.3112

13 Supplementary Table 2 List of utilized primer sequences Gene Primer sense Primer antisense Nanog tgaacctcagctacaaacaggtg aactgcatgcaggactgcagag Klf4 acccacacaggtgagaaacc atgtgtaaggcgaggtggtc Sox2 agaaccccaagatgcacaac cggggccggtatttataatc BmiI ttctttgaccagaacagattgg gcatcacagtcaattgctgct Oct3/4 cttgctgcagaagtgggtggaggaa ctgcagtgtgggtttcgggca CXCR4 ggtggtctatgttggcgtct tggagtgtgacagcttggag CXCR7 gcagccagcagagctcacagt ccatcgttctgaggcgggcaa Nodal agcatggttttggaggtgac cctgcgagaggttggagtag Activin aaagcttcatgtgggcaaag aatctcgaagtgcagcgtct Alk4 ggagcgtcttgtctttggag tgcaacaggatcgacttgag hcnt1 ggtggcctgcctcctggatt aagcagcaagagctagacccctct hcnt3 cttttctggagtacacagatgct cggcaggaccttaaatgcaaa hent1 ctctcagcccaccaatgaaag ctcaacagtcacggctggaa hent2 tctccaactctcagcccaccaa cctgcgatgctggacttgacct ABCB1 tgacatttattcaaagttaaaagca tagacactttatgcaaacatttcaa ABCC1 ggaataccagcaaccccgactt ttttggttttgttgagaggtgtc ABCB5 cacaaaaggcca$caggct gctgaggaatccacccaatct ABCG1 tcagggacctttcctattcg ttcctttcaggagggtcttgt ABCG2 tcatgttaggattgaagccaaaggc tgtgagattgaccaacagacctga B-ACTIN gcgagcacagagcctcgcctt catcatccatggtgagctggcgg Supplementary Table 2. Table of utilized primer sequences for real-time RT-qPCR. Nature Methods: doi: /nmeth.3112

11 questions for a total of 120 points

Your Name: BYS 201, Final Exam, May 3, 2010 11 questions for a total of 120 points 1. 25 points Take a close look at these tables of amino acids. Some of them are hydrophilic, some hydrophobic, some positive