Functional Analysis of Nuage Component Maelstrom. Tan L.Z 1 and Kai T 2. Singapore
|
|
- Howard Thompson
- 6 years ago
- Views:
Transcription
1 Functional Analysis of Nuage Component Maelstrom Tan L.Z 1 and Kai T 2. Department of Biological Sciences, Faculty of Science, National University of Singapore Abstract This paper aims to address the functional mechanisms of germline-specific nuage component, Maelstrom. Malestrom (mael) has been shown to shuttle between cytoplasm and nucleus, suggesting its implications in its involvement in DNA silencing via pirna and mirna pathways in both cytoplasmic and nucleus region. The exact mechanism of mael shuttling into nucleus remains unknown; however, using Drosophila melangaster as a model system, and employment of molecular techniques such as immunostaining, DNA transformation, cell transfection, and western blotting, a proposed model where mael entry into nucleus is regulated by phosphorylation mechanism via p38 MAPK signaling pathway is illustrated in this paper. Heat sensitive p38 protein kinase level has been shown to increase in heat shock treated wild type Drosophila. Colocalisation of p38 and mael at perinuclear region has also been observed, suggesting phosphorylation of mael by p38 could potentially take place in perinuclear region. Results using transgenic flies with altered mael gene sequence further illustrates phosphorylation as a potential way of regulating mael shuttling into nucleus and a possible phosphorylation site in mael gene sequence is also being explored here. Results 1 Student 2 Assistant Professor
2 obtained have not disproved the proposed model and follow-up investigative work is required. Brief outline of what has been done in the course of the entire research Increase in heat sensitive p38 protein kinase level in yw Drosophila after one hour heat shock as compared to yw flies without heat shock was observed using western blot method. Antibody staining of flies that had undergone heat stress treatment showed colocalisation of p38 and maelstrom in the perinuclear region, suggesting perinuclear region might be the site where mael is phosphorylated by p38 mitogenactivated protein kinase (MAPK) when subjected to heat stress. p38 Fig 1. Lighter protein band observed in yw flies without heat shock treatment (-HS) compared to band observed in yw with heat shock treatment (+HS), suggesting higher level of p38 in ovaries of heat shock treated yw. Actin Fig 2. Antibody staining with anti-p38 (green) and anti-mael (red) reveals colocalisation of mael and p38 in perinuclear region, and also shuttling of some mael into the nucleus of germ cells.
3 Furthermore, western blotting done on transgenic flies revealed that slower mobility band in evident transgenic flies with mael-fl (full length). A possible theory for the observed difference in mobility bands could be due to differences in phosphorylation state. If phosphorylation is indeed the key in mael shuttling into nucleus, S138 of mael sequence could potentially be the site of phosphorylation Based on results obtained, it is hypothesized that phosphorylation process might potentially be the regulating mechanism for mael entry into the nucleus. Possible functions of mael in the germ cell nucleus could be related to its involvement in mediating piwi proteins in nucleus to form piwi-pirna complexes for silencing of mobile elements. Reference Aravin, A.A., Lagos-Quintana, M., Yalcin, A., Zavolan, M., Marks, D., Snyder, B., Gaasterland, T., Meyer, J., Tuschl, T The Small RNA Profile during Drosophila melanogaster Development. Dev. Cell 5: Brennecke, J., Aravin, A.A., Stark, A., Dus, M., Kellis, M., Sachidanandam, R. and Hannon, G.J. (2007). Discrete small RNA-generating loci as master regulators of transposon acitivity in Drosophila. Cell 128: Findley, S.D., Tamanaha, M., Clegg N.J. and Ruohola-Baker (2003). Maelstrom, a Drosophila spindle-class gene, encodes a protein that colocalizes with Vasa and RDE1/AGO1 homologu, Aubergine, in nuage. Development 130: Klattenhoff, C. and Theurkauf, W. (2008). Biogenesis and germline functions of pirnas. Development 135: 3-9.
4 Kotaja, N. and Sassone-Corsi, P. (2007). The chromotoid body: a germ-cell-specific RNA- processing center. Nature Reviews Molecular Cell Biology 8: Han SJ et al, (1998). Molecular cloning and characterization of a Drosophila p38 mitogen-activated protein kinase. J Bio Chem 273: Lim, A.K. and Kai, T. (2007). Unique germ-line organelle, nuage, functions to repress selfish genetic elements in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 104: Mahowald, AP, (1971). Polar granules of Drosophila. III. The continuity of polar granules during the life cycle of Drosophila. J Exp Zool, 176: O Donelle and Boeke, (2007). Mighty piwis defend the germline against genomic intruders. Cell 129: Pek, Lim and Kai, (2009). Maelstrom differentially regulates micrornas and pirnas to control germline proliferation and differentiation in Drosophila Soper SF, van der Heijden GW, Hardiman TC, Goodheart M, Martin SL, de Boer P, Bortvin A, (2008) Mouse maelstrom, a component of nuage, is essential for spermatogenesis and transposon repression in meiosis. Dev Cell Aug;15(2):
5
A novel organelle, the ping-body, in the nuage of Drosophila male germ cells is associated with pirna-mediated gene silencing
MBoC ARTICLE A novel organelle, the ping-body, in the nuage of Drosophila male germ cells is associated with pirna-mediated gene silencing Mikhail V. Kibanov a, Ksenia S. Egorova a, Sergei S. Ryazansky
More informationpirna Function and Biogenesis in the Drosophila Female Germline: A Dissertation
University of Massachusetts Medical School escholarship@umms GSBS Dissertations and Theses Graduate School of Biomedical Sciences 11-20-2008 pirna Function and Biogenesis in the Drosophila Female Germline:
More informationHHS Public Access Author manuscript Mol Cell. Author manuscript; available in PMC 2016 August 20.
Aub and Ago3 are recruited to nuage through two mechanisms to form a ping-pong complex assembled by Krimper Alexandre Webster 1, Sisi Li 2, Junho K. Hur 1, Malte Wachsmuth 3, Justin S. Bois 1, Edward M.
More informationSarah F.C. Soper, Godfried W. van der Heijden, Tara C. Hardiman, Mary Goodheart, Sandra L. Martin, Peter de Boer, and Alex Bortvin
Developmental Cell 15 Supplemental Data Mouse Maelstrom, a Component of Nuage, Is Essential for Spermatogenesis and Transposon Repression in Meiosis Sarah F.C. Soper, Godfried W. van der Heijden, Tara
More informationpirna function in germline development
pirna function in germline development Jaspreet S. Khurana and William E. Theurkauf, Program in Molecular Medicine and Program in Cell Dynamics, University of Massachusetts Medical School, Worcester, MA
More informationNew Tool for Late Stage Visualization of Oskar Protein in Drosophila melanogaster. Oocytes. Kathleen Harnois. Supervised by Paul Macdonald
New Tool for Late Stage Visualization of Oskar Protein in Drosophila melanogaster Oocytes Kathleen Harnois Supervised by Paul Macdonald Institute of Cellular and Molecular Biology, The University of Texas
More informationRNA Structure and the Versatility of RNA. Mitesh Shrestha
RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis
More information2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.
AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing
More informationComparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
More informationMISSION shrna Library: Next Generation RNA Interference
Page 1 of 6 Page 1 of 6 Return to Web Version MISSION shrna Library: Next Generation RNA Interference By: Stephanie Uder, Henry George, Betsy Boedeker, LSI Volume 6 Article 2 Introduction The technology
More informationGeneral Education Learning Outcomes
BOROUGH OF MANHATTAN COMMUNITY COLLEGE City University of New York Department of Science Title of Course: Cell Biology Class hours 3 BIO Section: 260 Lab hours 3 Semester Spring 2018 Credits 4 Schedule:
More informationRNA Clamping by Vasa Assembles a pirna Amplifier Complex on Transposon Transcripts
RNA Clamping by Vasa Assembles a pirna Amplifier Complex on Transposon Transcripts Jordi Xiol, 1,2,7 Pietro Spinelli, 1,2 Maike A. Laussmann, 1,2,3 David Homolka, 1,2 Zhaolin Yang, 1,2 Elisa Cora, 1,2
More informationSiRNA transfection, northern blotting and RT-qPCR analysis were performed as
Supplemental Material: Supplemental Materials and Methods Supplemental Figures S1 to S7 Supplemental Tables S1 and S Additional References Supplemental Materials and Methods Knockdown, northern blotting
More informationSupplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the
More informationChapter 11: Regulation of Gene Expression
Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found
More informationSupplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
More informationTdrkh is essential for spermatogenesis and participates in primary pirna biogenesis in the germline
The EMBO Journal (2013) 32, 1869 1885 www.embojournal.org Tdrkh is essential for spermatogenesis and participates in primary pirna biogenesis in the germline THE EMBO JOURNAL Jonathan P Saxe 1,2, Mengjie
More informationOne Loop to Rule Them All: The Ping-Pong Cycle and pirna-guided Silencing
Review One Loop to Rule Them All: The Ping-Pong Cycle and pirna-guided Silencing Benjamin Czech 1, * and Gregory J. Hannon 1, * The PIWI-interacting RNA (pirna) pathway is a conserved defense mechanism
More informationThe TDRD9-MIWI2 Complex Is Essential for pirna-mediated Retrotransposon Silencing in the Mouse Male Germline
Article The TDRD9-MIWI2 Complex Is Essential for pirna-mediated Retrotransposon Silencing in the Mouse Male Germline Masanobu Shoji, 1,12 Takashi Tanaka, 1,12 Mihoko Hosokawa, 1,2 Michael Reuter, 3 Alexander
More informationConcepts and Methods in Developmental Biology
Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation
More informationPlant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter
Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter 9/16/2008 1 Learning Objectives 1. List and explain how DNA
More informationDistinct features of the pirna pathway in somatic and germ cells: from pirna cluster transcription to pirna processing and amplification
Théron et al. Mobile DNA 2014, 5:28 REVIEW Open Access Distinct features of the pirna pathway in somatic and germ cells: from pirna cluster transcription to pirna processing and amplification Emmanuelle
More informationTrasposable elements: Uses of P elements Problem set B at the end
Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches
More informationRegulatory RNAs in the light of Drosophila genomics Antonio Marco
BRIEFINGS IN FUNCTIONAL GENOMICS. VOL 11. NO 5. 356^365 doi:10.1093/bfgp/els033 Regulatory RNAs in the light of Drosophila genomics Antonio Marco Advance Access publication date 5 September 2012 Abstract
More informationGenome research in eukaryotes
Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics
More informationRelationship of Gene s Types and Introns
Chi To BME 230 Final Project Relationship of Gene s Types and Introns Abstract: The relationship in gene ontology classification and the modification of the length of introns through out the evolution
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationComputational aspects of ncrna research. Mihaela Zavolan Biozentrum, Basel Swiss Institute of Bioinformatics
Computational aspects of ncrna research Mihaela Zavolan Biozentrum, Basel Swiss Institute of Bioinformatics Computational aspects on ncrna Bacterial ncrnas research Gene discovery Target discovery Discovery
More informationGenetic Basis of Development & Biotechnologies
Genetic Basis of Development & Biotechnologies 1. Steps of embryonic development: cell division, morphogenesis, differentiation Totipotency and pluripotency 2. Plant cloning 3. Animal cloning Reproductive
More informationUnit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
More informationLearning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance
Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression
More informationParamutation in Drosophila requires both nuclear and cytoplasmic actors of the pirna pathway and induces cis-spreading of pirna production.
Genetics: Early Online, published on October 19, 215 as 1.1534/genetics.115.1837 Paramutation in Drosophila requires both nuclear and cytoplasmic actors of the pirna pathway and induces cis-spreading of
More information1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?
Problem Set 5 answers 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive
More informationThermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationZool 3200: Cell Biology Exam 3 3/6/15
Name: Trask Zool 3200: Cell Biology Exam 3 3/6/15 Answer each of the following questions in the space provided; circle the correct answer or answers for each multiple choice question and circle either
More informationSmall silencing RNAs: an expanding universe
Small silencing RNAs: an expanding universe Megha Ghildiyal and Phillip D. Zamore Abstract Since the discovery in 1993 of the first small silencing RNA, a dizzying number of small RNA classes have been
More informationWesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits
WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse
More informationLecture 20: Drosophila melanogaster
Lecture 20: Drosophila melanogaster Model organisms Polytene chromosome Life cycle P elements and transformation Embryogenesis Read textbook: 732-744; Fig. 20.4; 20.10; 20.15-26 www.mhhe.com/hartwell3
More informationA 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells
Plant Cell, Tissue and Organ Culture (PCTOC) A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells Anna Týcová a,b, Rajen J. J. Piernikarczyk c, Michael
More informationJournal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
More informationsirna Overview and Technical Tips
1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION
More informationDNA Binding Domains: Structural Motifs. Effector Domain. Zinc Fingers. Zinc Fingers, continued. Zif268
DNA Binding Domains: Structural Motifs Studies of known transcription factors have found several motifs of protein design to allow sequence-specific binding of DNA. We will cover only three of these motifs:
More informationThe Chemistry of Genes
The Chemistry of Genes Adapted from Success in Science: Basic Biology Key Words Codon: Group of three bases on a strand of DNA Gene: Portion of DNA that contains the information needed to make a specific
More informationTheoretische Biologie
Theoretische Biologie Prof. Computational EvoDevo, University of Leipzig SS 2017 Two Gene Concepts in Comparison Gerstein-Snyder gene definition Gerstein MB, Bruce C, Rozowsky JS, Zheng D, Du J, Korbel
More informationCytomics in Action: Cytokine Network Cytometry
Cytomics in Action: Cytokine Network Cytometry Jonni S. Moore, Ph.D. Director, Clinical and Research Flow Cytometry and PathBioResource Associate Professor of Pathology & Laboratory Medicine University
More informationCambridge University Press
Figure 1.1. Model of RNAi pathway in C. elegans. Transmembrane protein SID-1 allows dsrna to enter the cell. In the cytoplasm,dsrna gets processed by DCR-1,existing in a complex with RDE-4,RDE-1 and DRH-1.
More informationReview Quizzes Chapters 11-16
Review Quizzes Chapters 11-16 1. In pea plants, the allele for smooth seeds (S) is dominant over the allele for wrinkled seeds (s). In an experiment, when two hybrids are crossed, what percent of the offspring
More informationEpigenetics, Environment and Human Health
Epigenetics, Environment and Human Health A. Karim Ahmed National Council for Science and the Environment Washington, DC May, 2015 Epigenetics A New Biological Paradigm A Question about Cells: All cells
More informationa Award Number: W81XWH TITLE:
AD Award Number: W81XWH-04-1-0138 TITLE: Imaging Metastatic Prostate Cancer After Genetic Manipulation of Transcriptional Memory Regulators EZH2 and EED PRINCIPAL INVESTIGATOR: Lily Wu, M.D., Ph.D. CONTRACTING
More informationDicer-1 and R3D1-L catalyze microrna maturation in Drosophila
RESEARCH COMMUNICATION Dicer-1 and R3D1-L catalyze microrna maturation in Drosophila Feng Jiang, 1,3 Xuecheng Ye, 1,3 Xiang Liu, 1 Lauren Fincher, 1 Dennis McKearin, 2 and Qinghua Liu 1,4 1 Department
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationEnhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
More informationSupplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
More informationFunctional characterisation
Me Me Ac Ac Functional characterisation How can we know if measured changes in DNA methylation and function (phenotype) and linked, and in what way? DNMT Dianne Ford Professor of Molecular Nutritional
More informationHossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
More information7.17: Writing Up Results and Creating Illustrations
7.17: Writing Up Results and Creating Illustrations A Results Exercise: Kansas and Pancakes Write a 5-sentence paragraph describing the results illustrated in this figure: - Describe the figure: highlights?
More informationSupplementary Materials
Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran
More informationINTRODUCTION TO PLANT MOLECULAR BIOLOGY
INTRODUCTION TO PLANT MOLECULAR BIOLOGY SYLLABUS I. Course and Instructor Information. Course: HOS 3305 Section: 3831 Credit Hours: 3 Period 2-3: T 8:30-9:20 am & 9:35-10:25 am R 8:30-9:20 pm Room: 2318
More informationBlot: a spot or stain, especially of ink on paper.
Blotting technique Blot: a spot or stain, especially of ink on paper. 2/27 In molecular biology and genetics, a blot is a method of transferring proteins, DNA or RNA, onto a carrier (for example, a nitrocellulose,pvdf
More informationParamutation in Drosophila Requires Both Nuclear and Cytoplasmic Actors of the pirna Pathway and Induces Cis-spreading of pirna Production
HIGHLIGHTED ARTICLE GENETICS INVESTIGATION Paramutation in Drosophila Requires Both Nuclear and Cytoplasmic Actors of the pirna Pathway and Induces Cis-spreading of pirna Production Catherine Hermant,*,
More informationGFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
More information7.06 Cell Biology EXAM #2 March 20, 2003
7.06 Cell Biology EXAM #2 March 20, 2003 This is an open book exam, and you are allowed access to books, a calculator, and notes but not computers or any other types of electronic devices. Please write
More informationEnhancer genetics Problem set E
Enhancer genetics Problem set E How are specific cell types generated during development? There are thought to be 10,000 different types of neurons in the human nervous system. How are all of these neural
More informationNature Protocols: doi: /nprot Supplementary Figure 1. Efficient genome editing in human pluripotent stem cells.
Supplementary Figure 1 Efficient genome editing in human pluripotent stem cells. Our genome editing protocol was highly efficient in an additional pluripotent human cell line (CHB10) and at several different
More informationSUPPLEMENTAL MATERIAL SUPPLEMANTAL METHODS SUPPLEMENTAL RESULTS
SUPPLEMENTAL MATERIAL SUPPLEMANTAL METHODS hubb and hubb +1 constructs. To create the hubb construct, intermediate PCR products (named UBBwt-1 and UBBwt-2) were obtained using a pcdna3 vector containing
More informationDEPARTMENT OF BIOCHEMISTRY AND MOLECULAR BIOLOGY
Department of Biochemistry and Molecular Biology 1 DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR BIOLOGY Office in Molecular and Radiological Biosciences Building, Room 111 (970) 491-5602 bmb.colostate.edu
More informationEukaryotic Transcription
Eukaryotic Transcription I. Differences between eukaryotic versus prokaryotic transcription. II. (core vs holoenzyme): RNA polymerase II - Promotor elements. - General Pol II transcription factors (GTF).
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationBIOSCI 0351: GENETICS LABORATORY COURSE INFORMATION- SPRING TERM 2016
BioSci 0351, Spring, 2016 BIOSCI 0351: GENETICS LABORATORY COURSE INFORMATION- SPRING TERM 2016 GENERAL INFORMATION Time: Location: INSTRUCTORS: Office hours: Phone Numbers: Email: Mondays, 8:30AM 12:20PM
More informationFundamentals of Genetics. 4. Name the 7 characteristics, giving both dominant and recessive forms of the pea plants, in Mendel s experiments.
Fundamentals of Genetics 1. What scientist is responsible for our study of heredity? 2. Define heredity. 3. What plant did Mendel use for his hereditary experiments? 4. Name the 7 characteristics, giving
More informationBiology Lecture 2 Genes
Genes Definitions o Gene: DNA that codes for a single polypeptide/mrna/rrna/trna o Euchromatin: region of DNA containing genes being actively transcribed o Heterochromatin: region of DNA containing genes
More informationXfect Protein Transfection Reagent
Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection
More informationGenetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination
More informationIntroduction State the objectives of the work and provide adequate background, avoiding a detailed literature survey or a summary of the results.
Format requirements for IJBCB articles For each article type, IJBCB has its own requirements regarding the article format. Please ensure you follow the exact guidelines (included below) for the specific
More informationName Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
More informationProblem Set 4
7.016- Problem Set 4 Question 1 Arginine biosynthesis is an example of multi-step biochemical pathway where each step is catalyzed by a specific enzyme (E1, E2 and E3) as is outlined below. E1 E2 E3 A
More informationActivation of a Floral Homeotic Gene in Arabidopsis
Activation of a Floral Homeotic Gene in Arabidopsis By Maximiliam A. Busch, Kirsten Bomblies, and Detlef Weigel Presentation by Lis Garrett and Andrea Stevenson http://ucsdnews.ucsd.edu/archive/graphics/images/image5.jpg
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationChapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More informationFig State the precise name of each of the parts of the DNA molecule labelled X, Y and Z. X... Y... Z... [3]
1 (a) Fig. 7.1 represents part of a DNA molecule. X G C A Y Z Fig. 7.1 State the precise name of each of the parts of the DNA molecule labelled X, Y and Z. X... Y... Z [3] (b) Describe how the DNA molecule
More informationExam 2 BIO200, Winter 2012
Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide
More informationRegulation of Gene Expression
CAMPBELL BIOLOGY IN FOCUS URRY CAIN WASSERMAN MINORSKY REECE 15 Regulation of Gene Expression Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge, Simon Fraser University SECOND EDITION
More information7.22 Example Problems for Exam 1 The exam will be of this format. It will consist of 2-3 sets scenarios.
Massachusetts Institute of Technology Department of Biology 7.22, Fall 2005 - Developmental Biology Instructors: Professor Hazel Sive, Professor Martha Constantine-Paton 1 of 10 7.22 Fall 2005 sample exam
More informationArgonaute proteins: key players in RNA silencing
Argonaute proteins: key players in RNA silencing Gyorgy Hutvagner 1 and Martin J. Simard 2 1: Division of Gene Regulation and Expression, College of Life Sciences, University of Dundee, Dundee DD1 5EH,
More informationThe Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
More informationThe MAP Kinase Family
The MAP Kinase Family Extracellular stimuli Classical MAP kinases Atypical MAP kinases MAPKKK MLK1/2/3/7; LZK RAF-1/A/B TAK1; TPL2 c-mos MEKK1-4; DLK ASK1/2; MLTK TAO1/2 ASK1 TAK1 MEKK1-4 MEKK2/3 TPL2???
More informationThe Molecular Basis of Bacterial Innate Immunity in Arabidopsis thaliana
The Molecular Basis of Bacterial Innate Immunity in Arabidopsis thaliana Brian Staskawicz Department of Plant and Microbial Biology University of California, Berkeley Rice Model Plant-Pathogen Systems
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationBarentsz is essential for the posterior localization of oskar mrna and colocalizes with it to the posterior pole
JCB Article Barentsz is essential for the posterior localization of oskar mrna and colocalizes with it to the posterior pole Fredericus J.M. van Eeden, Isabel M. Palacios, Mark Petronczki, Matthew J.D.
More informationMaking sense of chromatin states
Sorting out 717 Consistent measuring 718 Drilling down to function 719 Table 1: The many states of chromatin (so far) 715 Making sense of Monya Baker Researchers find new pieces in the puzzle of genome
More informationBIOLOGY. Chapter 16 GenesExpression
BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results
More informationMUT-16 promotes formation of perinuclear Mutator foci required for RNA silencing in the C. elegans germline
MUT-16 promotes formation of perinuclear Mutator foci required for RNA silencing in the C. elegans germline Carolyn M. Phillips, Taiowa A. Montgomery, Peter C. Breen, and Gary Ruvkun 1 Department of Molecular
More informationMolecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology
Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology Question No. 1 of 10 1. Which statement describes how an organism is organized from most simple to most complex? Question
More informationChapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics
Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps
More informationVir B. Singh, PhD
, PhD Vir.Singh@roswellpark.org vir777@gmail.com Current Position Postdoctoral Research Associate at Department of Molecular and Cellular Biology, Roswell Park Cancer Institute, Buffalo, NY, USA since
More informationParthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss
SUPPLEMENTARY INFORMATION Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss Yunjong Lee, Senthilkumar S. Karuppagounder, Joo-Ho Shin, Yun-Il Lee, Han Seok Ko, Debbie Swing,
More informationBIO 315 Lab Exam I. Section #: Name:
Section #: Name: Also provide this information on the computer grid sheet given to you. (Section # in special code box) BIO 315 Lab Exam I 1. In labeling the parts of a standard compound light microscope
More informationCourse Advisor: Prof Jane Farrar
Human Genetics TR073 Course Advisor: Prof Jane Farrar gjfarrar@tcd.ie http://www.tcd.ie/genetics/ Human Genetics is a four year moderatorship course run by the School of Genetics and Microbiology and located
More information