Supplementary Data. Plasmid -2486CAT containing the 2.5 kb fragment of VE-cadherin promoter region (-2486

Size: px
Start display at page:

Download "Supplementary Data. Plasmid -2486CAT containing the 2.5 kb fragment of VE-cadherin promoter region (-2486"

Transcription

1 Supplementary Data Materials and Methods Generation and Genotyping of Transgenic Mice Plasmid -2486CAT containing the 2.5 kb fragment of VE-cadherin promoter region (-2486 to +24) was a gift from P. Huber. 1 The VE-cadherin promoter DNA followed by Cre recombinase cdna, and polyadenylation signal from SV40 were inserted into pbluescriptskii (Stratagene) and a resultant plasmid was named as pbs-ve-cad-cre. The 4.2 kb VE-cad-Cre transgene (Figure 1A) excised from pbs-ve-cad-cre was microinjected into fertilized C57BL/6J eggs. VE-cad-Cre transgenic founders were confirmed by both PCR and Southern analyses using tail DNA. We obtained three lines of VE-cad-Cre mice and crossed with either EGFP reporter mice or LacZ reporter mice. Since β galactosidase is fused with nuclear localization sequence, LacZ expression was found in the nucleus when examined by histochemical analysis. There was no obvious difference for reporter expression among the offspring of three lines. Therefore, line1 containing an estimated two copies of VE-cad-Cre gene (Supplementary Figure 1C) was used for all the following experiments. Tie2/EG mice were obtained by crossing Tie2-Cre mice (a gift from M. Yanagisawa, Texas Southwestern University) with CAG-CAT-EGFP. 2 In Vivo GFP imaging The GFP fluorescence from VE/EG mice were observed using SZX12 stereo-fluorescent microscope (Olympus, Japan). EGFP images were obtained through an XF2043 dichroic 1

2 filter (Omega Optical) and a set of an S484/15 excitation filter and an S515/30 emission filter (Chroma Technology) with a 75-W Xenon arc lamp. Histochemistry, Immunostaining, Immunofluorescence, and in Situ Hybridization X-gal staining of embryo of VE/Z was performed as described previously. 3 Wild type mouse embryos (E9.5) and heart tissue sections obtained from 5-week -old mice were immunostained with anti-ve-cadherin (BD Biosciences). Immunoreaction was visualized with horseradish peroxidase-conjugated secondary antibody. The frozen sections obtained from VE/Z mice were immunostained with anti-cd31 (BD Bioscience) and anti-α-smooth muscle actin (SMA) (Sigma). Those from VE/EG mice were immunostained with anti-cd31, anti-α-sma, and anti-gfp developed in our laboratory, followed by incubation with fluorescence-conjugated secondary antibodies. Frozen sections obtained from wild type sham-operated and infarcted were immunostained with anti-mouse VE-cadherin (A kind gift from Dr. Vestweber, University of Munster, Germany). Immunoreaction was detected with avidin-biotin-peroxidase comlex method followed by visualization with diaminobenzidin. X-gal stained embryo tissue sections were counter-stained with hematoxylin. Tissue sections were imaged on an Axiovert 25 inverted universal microscope equipped with an Axiocam HR color CCD camera (Zeiss) after immunostaining or histochemistry. Confocal imges were obtained by a LSM 510 META microscope (Carl Zeiss). Preparation of embryos or frozen sections and in situ hybridization with digoxigenin-labeled RNA probes were performed following manufacturer s instruction 2

3 (Roche Diagnostics). The probe was derived from the 1.7 kb amino-terminal fragment of mouse VE-cadherin cdna amplified by PCR using E13.5 mouse cdna library as a template. Sections were imaged as described above. Genomic PCR Analysis and Southern Analysis VE-cad-Cre transgenic founders were confirmed by both PCR and Southern analyses using tail DNA. The 5 and 3 primers, Cre-f, 5 -gttcgcaagaacctgatggaca-3 and Cre-r, 5 -ctagagcctgttttgcaggttc-3, respectively were chosen within the Cre cdna (Supplementary Figure 1A). For Southern analyses, genomic DNA digested with BglII were electrophoresed and transferred to the Hybond-N+ membrane (Amersham Biosciences). The membrane was hybridized with a radio-labeled probe produced by 0.6 kb EcoRV/BglII fragment of Cre transgene using random prime methods (Roche Diagnostics). Neovascularization Models (Corneal Assay and Myocardial Infarction Model) A pellet containing recombinant mouse VEGF165 (R & D Systems) was implanted into a corneal micro pocket. Neovascularization marked by EGFP in living mice was observed with a fluorescent microscope (SZX12, Olympus). 8-week-old VE/EG or VE/Z mice were anesthetized and ventilated by cannulating the trachea. The chest was opened by a left thoracotomy, and the left anterior descending coronary artery was permanently ligated. Infarcted mice were sacrificed 3 days after ligation and their organs were subjected to histological examination. The number of the capillary vessels that were positive for CD31 were counted in the at least 10 undamaged area of 5 sections of sham-operated or infarcted 3

4 mice. Ten undamaged area in which capillaries were observed as rings were used for the analysis. Mononuclear Cell Preparation Mononuclear cells in bone marrow cells and peripheral blood cells were prepared by density separation in Ficoll-Paque PLUS (Amersham Biosciences) and hemolysed with ammonium chloride buffer. Mononuclear cells were filtered through a 35 μm cell strainer. Real-Time PCR for quantitative analysis of VE-cadherin mrna CD45-posive bone marrow cells from wild type infarcted B57/BL6J or sham-operated mice were obtained by cell sorting (FACS Aria, BD Biosciences). One μg of total RNA prepared using Trizol was subejectred to reverse-transcription PCR (Invitrogen). VE-cadherin mrna was quantitated by real-time PCR (SYBR Green,Qiagen) using forward primer 5'- TCAACGCATCTGTGCCAGAGAT-3', reverse primer 5'-CACGATTTGGTACAAGACAGTG-3'. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mrna was also quantitated simultaneously. Supplementary Figure 1. Genotyping of VE-cad-Cre mouse. A, Schematic illustration of the transgene of VE-cadherin promoter followed by Cre recombinase cdna (VE-cad-Cre) and a primer set for detection of Cre recombinase gene (Cre-f and Cre-r). B, VE-cad-Cre transgene was examined by PCR using tail DNA of transgenic mice. The expected size for the partial DNA derived from the transgene is 350 bp. p, positive control 4

5 (PCR using pbs-ve-cad-cre DNA as a template). n, negative control (PCR using pbluescript as a template. C, Southern blot analysis of VE-cad-Cre transgene. Tail DNA digested with BglII was electrophoresed along with pbs-ve-cad-cre DNA equivalent to a single copy (1c) and 10 copies (10c). VE-cad-Cre transgene was detected at 2.4 kb. Cre-, the mouse without VE-cad-Cre transgene; Cre+, the mouse with VE-cad-Cre transgene. Supplementary Figure 2. Sustained EGFP expression after birth in Tie2/EG mice. Similar to Figure 2, EGFP expression in the heart and lung of Tie2/EG were examined under a stereo-fluorescent microscope (A, C, E, and G). Tissue sections obtained from Tie2/EG mice were immunostained with anti-gfp (green) and anti-cd31 (red) (B, D, F, and H). Macroscopically EGFP expression in the heart and lung was observed both at neonatal stage (3 d) and 5 weeks (5 w) after birth. EGFP-positive cells are also CD31-positve in both heart and lung (arrows). I, LacZ-expression driven VE-cadherin promoter was examined in the heart of a littermate lacking Cre gene (Cre-), neonate VE/Z mouse heart (3 d), and 5-week-old VE/Z mouse heart (5 w). The arrow and the arrowheads indicate LacZ-stained endothelial cells of a coronary artery and capillary, respectively. Bar = 50 μm. Supplementary Figure 3. Cardiac vessel-specific activation of VE-cadherin promoter by circulating factors. Para biotic pairs of a wild type mouse (gray) and a VE/Z mouse (blue) was created as indicated. Tissues were examined for LacZ expression from the mouse indicated by the broken line box. A, Paradises itself does not activate VE-cadherin 5

6 promoter of heart vessels in the VE/Z mouse. B, C, and D, The wild type mouse of a Para biotic pair was coronary-legated (cross). Sections were stained with X-gal. B, Note that LacZ-positive cells are observed exclusively in the coronary arteries. C and D, No LacZ stained cell in the vasculature of other organs. Bars (in A and B) =20 μm; Bars ( in C and D) = 50 μm. Cardiac ischemia may produces heart vessel-specific factors that activate VE-cadherin promoter. This notion is supported by the data that in the mouse without infarction connected to the mice with infarction, VE-cadherin promoter is only activated in the heart vessels of the mice without infarction and is not activated in other organs. Thus, cardiac ischemia is crucial for inducing VE-cadherin promoter in both pre-existing cells and mobilized cells to the ischemic heart. Supplementary Figure 4. The capillary vessels are increased in the infarcted mice. Capillary vessels detected by CD31-positive ring were counted as described in Materials and Methods of Supplementary data. Supplementary Figure 5. VE-cadherin mrna was increased two times greater in CD45-positive bone marrow cells upon cardiac ischemia than in CD45-positive bome marrow cells in sham-operated mice. VE-cadherin mrna is analyzed by real-time PCR by comparing the amount of VE-cadherin mrna products with that of GAPDH mrna products. Reference 6

7 1. Gory S, Vernet M, Laurent M, Dejana E, Dalmon J, Huber P. The vascular endothelial-cadherin promoter directs endothelial-specific expression in transgenic mice. Blood. 1999;93: Kisanuki YY, Hammer RE, Miyazaki J, Williams SC, Richardson JA, Yanagisawa M. Tie2-Cre transgenic mice: a new model for endothelial cell-lineage analysis in vivo. Dev Biol. 2001;230: Schlaeger TM, Qin Y, Fujiwara Y, Magram J, Sato TN. Vascular endothelial cell lineage-specific promoter in transgenic mice. Development. 1995;121:

8 Supplementary Figure 1 8

9 Supplementary Figure 2 9

10 Supplementary Figure 3 10

11 Supplementary Figure 4 11

12 VE-cadherin/GAPDH CD45-Sham CD45-AMI1 Supplementary Figure 5 12

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,

More information

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab. / 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

More information

Modulation of the anti-tumor immune response by complement. Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K.

Modulation of the anti-tumor immune response by complement. Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K. Modulation of the anti-tumor immune response by complement Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K. Ricklin- Lichtsteiner, Anna Koutoulaki, Craig Gerard, George Coukos & John

More information

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin

More information

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

Supplemental Information. Role of phosphatase of regenerating liver 1 (PRL1) in spermatogenesis

Supplemental Information. Role of phosphatase of regenerating liver 1 (PRL1) in spermatogenesis Supplemental Information Role of phosphatase of regenerating liver 1 (PRL1) in spermatogenesis Yunpeng Bai ;, Lujuan Zhang #, Hongming Zhou #, Yuanshu Dong #, Qi Zeng, Weinian Shou, and Zhong-Yin Zhang

More information

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang

More information

Fatchiyah

Fatchiyah Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Supplementary Materials and Methods:

Supplementary Materials and Methods: Supplementary Materials and Methods: Preclinical chemoprevention experimental design Mice were weighed and each mammary tumor was manually palpated and measured with digital calipers once a week from 4

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter

More information

A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet

A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet A Low salt diet GV [AU]:. [mmhg]: 0..... 09 9 7 B High salt diet GV [AU]:. [mmhg]: 7 8...0. 7.8 8.. 0 8 7 C Low salt diet + mf-c GV [AU]:. [mmhg]:.0.9 8.7.7. 7 8 0 D High salt diet + mf-c E Lymph capillary

More information

Peter Dy, Weihuan Wang, Pallavi Bhattaram, Qiuqing Wang, Lai Wang, R. Tracy Ballock, and Véronique Lefebvre

Peter Dy, Weihuan Wang, Pallavi Bhattaram, Qiuqing Wang, Lai Wang, R. Tracy Ballock, and Véronique Lefebvre Developmental Cell, Volume 22 Supplemental Information Sox9 Directs Hypertrophic Maturation and Blocks Osteoblast Differentiation of Growth Plate Chondrocytes Peter Dy, Weihuan Wang, Pallavi Bhattaram,

More information

Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by. Regulating Occludin

Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by. Regulating Occludin Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by Regulating Occludin Chaithanya Chelakkot 1,ǂ, Jaewang Ghim 2,3,ǂ, Nirmal Rajasekaran 4, Jong-Sun Choi 5, Jung-Hwan

More information

Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney

Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney 1 Supplementary text and data for: 2 3 4 5 Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney Authors: David A. D. Munro 1*, Peter Hohenstein 2, and Jamie A.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm

More information

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFPHigh cells. Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon

More information

ingenio electroporation kits & solution

ingenio electroporation kits & solution ingenio electroporation kits & solution Electroporation x DEFINITION and OPTIMIZATION What is ELECTROPORATION? Electroporation is a physical method of nucleic acid transfer wherein the cells and nucleic

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on

More information

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying

More information

Initial genotyping of all new litters was performed by Transnetyx (Memphis,

Initial genotyping of all new litters was performed by Transnetyx (Memphis, SUPPLEMENTAL INFORMATION MURILLO ET AL. SUPPLEMENTAL EXPERIMENTAL PROCEDURES Mouse Genotyping Initial genotyping of all new litters was performed by Transnetyx (Memphis, USA). Assessment of LoxPpα recombination

More information

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Svegliati Baroni S, Santillo M, Bevilacqua F, et al. Stimulatory

More information

ADP, 5-Hydroxytryptamine (5-HT), EDTA and ethidium bromide were from Sigma.

ADP, 5-Hydroxytryptamine (5-HT), EDTA and ethidium bromide were from Sigma. SUPPLEMENTAL MATERIAL Expanded Materials and Methods Materials ADP, 5-Hydroxytryptamine (5-HT), EDTA and ethidium bromide were from Sigma. PAR-4 TRAP (AYPGKF) was custom synthesised by AnaSpec, USA. The

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss

Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss SUPPLEMENTARY INFORMATION Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss Yunjong Lee, Senthilkumar S. Karuppagounder, Joo-Ho Shin, Yun-Il Lee, Han Seok Ko, Debbie Swing,

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for

More information

Roche Molecular Biochemicals Technical Note No. LC 9/2000

Roche Molecular Biochemicals Technical Note No. LC 9/2000 Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

Theoretical cloning project

Theoretical cloning project Theoretical cloning project Needed to get credits Make it up yourself, don't copy Possible to do in groups of 2-4 students If you need help or an idea, ask! If you have no idea what to clone, I can give

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Fluorescent in-situ Hybridization

Fluorescent in-situ Hybridization Fluorescent in-situ Hybridization Presented for: Presented by: Date: 2 Definition In situ hybridization is the method of localizing/ detecting specific nucleotide sequences in morphologically preserved

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

Color-Switch CRE recombinase stable cell line

Color-Switch CRE recombinase stable cell line Color-Switch CRE recombinase stable cell line Catalog Number Product Name / Description Amount SC018-Bsd CRE reporter cell line (Bsd): HEK293-loxP-GFP- RFP (Bsd). RFP" cassette with blasticidin antibiotic

More information

To assess the localization of Citrine fusion proteins, we performed antibody staining to

To assess the localization of Citrine fusion proteins, we performed antibody staining to Trinh et al 1 SUPPLEMENTAL MATERIAL FlipTraps recapitulate endogenous protein localization To assess the localization of Citrine fusion proteins, we performed antibody staining to compare the expression

More information

A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish

A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Developmental Cell Supplemental Information A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Julien Ablain, Ellen M. Durand, Song Yang, Yi Zhou, and Leonard I. Zon % larvae

More information

Supporting Information

Supporting Information Supporting Information Narni-Mancinelli et al. 10.1073/pnas.1112064108 SI Materials and Methods Cell Preparation. Mice were anesthetized and immediately perfused with PBS before organs were collected.

More information

REAL TIME PCR USING SYBR GREEN

REAL TIME PCR USING SYBR GREEN REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/317/5837/477/dc1 Supporting Online Material for AAV Vector Integration Sites in Mouse Hepatocellular Carcinoma Anthony Donsante, Daniel G. Miller, Yi Li, Carole Vogler,

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of

More information

Restriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner.

Restriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner. Enzymes Restriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner. Generally recognize an inverted repeat sequence 4, 6, or 8 base pairs

More information

An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues

An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues Yoshikazu Nishiguchi 1*, Koichi Kitamura 1, Naoko Watanabe 2, Anna Kozaki 3, Hayato Otani

More information

Supplemental Information

Supplemental Information Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

Supporting Information

Supporting Information Supporting Information van Rooij et al. 10.1073/pnas.0805038105 SI Materials and Methods Surgical Procedures. All animal protocols were approved by the Institutional Animal Care and Use Committee of the

More information

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

Microarrays: since we use probes we obviously must know the sequences we are looking at!

Microarrays: since we use probes we obviously must know the sequences we are looking at! These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression

More information

Materials and Methods

Materials and Methods Materials and Methods Construction of noxa / mice and genotyping The targeting vector (see Fig. S) was prepared from a C57BL/6 DNA λ phage library (Stratagene) by replacing a 2.7 kb region encompassing

More information

To construct a mammary gland specific, E6-AP-expressing transgenic vector, MMTV-

To construct a mammary gland specific, E6-AP-expressing transgenic vector, MMTV- Supplemental Methods: Plasmid Construction To construct a mammary gland specific, E6-AP-expressing transgenic vector, MMTV- E6-AP, we used MMTVkBpA expression vector obtained from Dr. Sophia Tsai, Baylor

More information

Chapter 3. Enzyme manipulation of DNA and RNA

Chapter 3. Enzyme manipulation of DNA and RNA Chapter 3 Enzyme manipulation of DNA and RNA To measure incorporation of radioactivity (to see if the probe is good or not for hybridization) Acid precipitation method: - Add sonicated salmon sperm DNA

More information

Problem Set 4

Problem Set 4 7.016- Problem Set 4 Question 1 Arginine biosynthesis is an example of multi-step biochemical pathway where each step is catalyzed by a specific enzyme (E1, E2 and E3) as is outlined below. E1 E2 E3 A

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Chapter 20: Biotechnology 1. DNA Sequencing 2. DNA Cloning 3. Studying Gene Expression 4. Manipulating Genomes 5. herapeutic & Diagnostic echniques 1. DNA Sequencing Chapter Reading pp. 409-412 DNA Sequencing

More information

The V-ATPase B1-subunit promoter drives expression of Cre recombinase in intercalated cells of the kidney

The V-ATPase B1-subunit promoter drives expression of Cre recombinase in intercalated cells of the kidney http://www.kidney-international.org & 2009 International Society of Nephrology The V-ATPase B1-subunit promoter drives expression of Cre recombinase in intercalated cells of the kidney R. Lance Miller

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Non-Radioactive Southern Blot Reagents

Non-Radioactive Southern Blot Reagents Product Specifications Non-Radioactive Southern Blot Reagents Store as labeled. For research use only. Non-Radioactive Southern Blot Analysis, Electrophoresis Reagents Polymerase Chain Reaction Reagents,

More information

Visualizing Cells Molecular Biology of the Cell - Chapter 9

Visualizing Cells Molecular Biology of the Cell - Chapter 9 Visualizing Cells Molecular Biology of the Cell - Chapter 9 Resolution, Detection Magnification Interaction of Light with matter: Absorbtion, Refraction, Reflection, Fluorescence Light Microscopy Absorbtion

More information

in-situ PCR Presented for: Presented by: Date:

in-situ PCR Presented for: Presented by: Date: in-situ PCR Presented for: Presented by: Date: 2 in situ Hybridization - Definition in situ PCR is a method in which the polymerase chain reaction actually takes place in the cell on a slide, and the product

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1

More information

Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1

Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1 Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in Zebrafish Embryos 1 1. In vitro synthesis of capped Cas9 mrna The full length of humanized Cas9 cdnas with double NLS were cloned into pxt7

More information

Construction of plant complementation vector and generation of transgenic plants

Construction of plant complementation vector and generation of transgenic plants MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological

More information

Isolation, culture, and transfection of primary mammary epithelial organoids

Isolation, culture, and transfection of primary mammary epithelial organoids Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

More information

Premix Ex Taq (Probe qpcr)

Premix Ex Taq (Probe qpcr) For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.

More information

Supplementary Information

Supplementary Information Supplementary Information Live imaging reveals the dynamics and regulation of mitochondrial nucleoids during the cell cycle in Fucci2-HeLa cells Taeko Sasaki 1, Yoshikatsu Sato 2, Tetsuya Higashiyama 1,2,

More information

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

High Pure PCR Template Preparation Kit for preparation of 100 nucleic acid samples Cat. No

High Pure PCR Template Preparation Kit for preparation of 100 nucleic acid samples Cat. No for preparation of 100 nucleic acid samples Cat. No. 1 796 88 Principle Cells are lysed during a short incubation with Proteinase K in the presence of a chaotropic salt (guanidine HCl), which immediately

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

GFP CCD2 GFP IP:GFP

GFP CCD2 GFP IP:GFP D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant

More information

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic

More information

Impact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis

Impact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis Impact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis The mammalian system undergoes ~24 hour cycles known as circadian rhythms that temporally orchestrate metabolism, behavior,

More information

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

Bacterial DNA replication

Bacterial DNA replication Bacterial DNA replication Summary: What problems do these proteins solve? Tyr OH attacks PO4 and forms a covalent intermediate Structural changes in the protein open the gap by 20 Å! 1 Summary: What problems

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX.

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX. Supplementary Figure 1 Retention of RNA with LabelX. (a) Epi-fluorescence image of single molecule FISH (smfish) against GAPDH on HeLa cells expanded without LabelX treatment. (b) Epi-fluorescence image

More information

Quantitative Real Time PCR USING SYBR GREEN

Quantitative Real Time PCR USING SYBR GREEN Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to

More information

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion

More information

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated

More information

Supplemental Data. Lee et al. Plant Cell. (2010) /tpc Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2.

Supplemental Data. Lee et al. Plant Cell. (2010) /tpc Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2. Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2. (A) Protein structures of DWA1 and DWA2. WD40 region was determined based on the NCBI conserved domain databases (B, C) Schematic representation

More information

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?

More information

Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice

Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham

More information

Mouse Engineering Technology. Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology

Mouse Engineering Technology. Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology Mouse Engineering Technology Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology Core service and new technologies Mouse ES core Discussions

More information

AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants

AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse

Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp)

More information