T H E J O U R N A L O F C E L L B I O L O G Y
|
|
- Kelly Burke
- 6 years ago
- Views:
Transcription
1 T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Feng et al., Figure S1. A modest elevation of disulfide-bonded K14 in primary mouse keratinocytes upon calcium switch. (A and B) The global disulfide bond staining in primary cultures of newborn mouse skin keratinocytes (A) and the localization of ER lumen (labeled using an antibody to recognize the marker protein disulfide isomerase [PDI]), where disulfide formation and isomerization of nascent proteins are catalyzed, thereby contributing to the perinuclear staining of disulfides labeled by maleimide (B). S-S, disulfide bonds; IgG, goat anti-rabbit IgG. Bar, 10 µm. (C) Disulfide-bonded K14 in primary mouse keratinocytes is modestly elevated upon calcium switch. Quantification of the total amount of disulfide-bonded K14 and K5 under low versus high calcium culture conditions achieved by densitometry-based analysis of disulfide-bonded versus monomeric keratins as reported in Fig. 1 A. Data were obtained from three independent experiments. Error bars represent standard deviations. Disulfide bonding and keratin filaments Feng and Coulombe S1
2 Figure S2. Intermolecular disulfide bonds involving K14WT, K14CF-C367, and K5WT. Keratin assemblies were subjected to high-speed sedimentation (150,000 g, 30 min), and pellet (Pel) and supernatant (Sup) fractions were loaded on nonreducing SDS-PAGE gels with or without being pretreated with a reducing agent followed by immunoblotting analysis. M, keratin monomer. Black lines indicate that intervening lanes have been spliced out. S2
3 Figure S3. Criteria used to assign keratin filament network organization to one of three categories: peripheral, pan-cytoplasmic, and perinuclear-concentrated networks. Using ImageJ, we determined the relative intensity of the fluorescence signal for keratin IFs (FI%) across the relative distance (RD) extending from the outer cell membrane (set as 0) to the nuclear envelope (set as 1), using transfected GFP-K14WT as an example. If keratin filaments (FI% > 50%) are distributed relatively evenly across the cytoplasm (RD = 0 1), such a network is designated pan-cytoplasmic (see A); if keratin filaments (FI% > 50%) are mainly concentrated in the perinuclear region (RD > 0.7), it is called perinuclear-concentrated (see B); finally, if keratin filaments (FI% > 50%) appear concentrated at the cell periphery (RD < 0.4), such a network is called peripheral (see C). For each graph, the 10 different color tracings represent 10 individual GFP-K14WT expressing keratinocytes. Disulfide bonding and keratin filaments Feng and Coulombe S3
4 Figure S4. Evidence that the existence of different phenotypes in Krt14 / cells expressing either K14WT or cysteine variants is not related to differences in transgene expression levels among individual cells. (A C) The K14 cysteine variants used in this study, e.g., K14CF, K14C367A, and K14CF-C367 (A), and fluorescence intensity comparison of GFP-K14WT versus GFP-K14CF (B), and GFP-K14CF-C367 expressing keratinocytes with (w/perin) or without (w/o pern) perinuclear-concentrated networks (C). Each symbol represents the mean fluorescence intensity of individual keratinocytes at seven time points (from 0 to 6 h) during movie recordings from a single experiment. n = 22 cells for GFP-K14WT, n = 22 cells for GFP-K14CF, n = 13 cells for GFP-K14CF- C367 w/perin, and n = 15 cells for GFP-K14CF-C367 w/o perin. S4
5 Figure S5. Enhanced nuclear and cellular movements manifested by GFP-K14CF-expressing keratinocytes. (A and B) Still images (A) and 2.5-dimentional views of z stacks of mobile GFP-K14CF expressing keratinocytes, derived from live movie recordings (B). Bar, 10 µm. (C F) Comparison of nuclear and whole cell movements obtained by tracking the position of the nucleus in GFP-K14WT (C), GFP-K14CF (D), and GFP-K14CF-C367 expressing (E) cells, as well as speed (F). More than 20 transfected cells were analyzed for each sample. Each color in C E and each symbol in F denote individual cells. Disulfide bonding and keratin filaments Feng and Coulombe S5
6 Video 1. GFP-K14WT-transfected K14 / mouse keratinocytes in primary culture. K14 / mouse keratinocytes were transfected with GFP-K14WT (green) and H2B-mCherry (red). Images were recorded using a laser scanning confocal microscope (LSM780-FCS, Carl Zeiss). Recording intervals were 5 min and the whole recording time was 6 h. Video 2. GFP-K14CF-transfected K14 / mouse keratinocytes in primary culture showing a stationary behavior. K14 / mouse keratinocytes were transfected with GFP-K14CF (green) and H2B-mCherry (red). Images were recorded using a laser scanning confocal microscope (LSM780-FCS; Carl Zeiss). Recording intervals were 5 min and the whole recording time was 6 h. Video 3. GFP-K14CF transfected K14 / mouse keratinocytes in primary culture showing a motile behavior. K14 / mouse keratinocytes were transfected with GFP-K14CF (green) and H2B-mCherry (red). Images were recorded using a laser scanning confocal microscope (LSM780-FCS; Carl Zeiss). Recording intervals were 5 min and the whole recording time was 6 h. Video 4. GFP-K14CF-C367 transfected K14 / mouse keratinocytes in primary culture showing perinuclear-concentrated networks. K14 / mouse keratinocytes were transfected with GFP-K14CF-C367 (green) and H2B-mCherry (red). Images were recorded using a laser scanning confocal microscope (LSM780-FCS; Carl Zeiss). Recording intervals were 5 min and the whole recording time was 6 h. Video 5. GFP-K14CF-C367 transfected K14 / mouse keratinocytes in primary culture showing a lack of stable perinuclearconcentrated networks. K14 / mouse keratinocytes were transfected with GFP-K14CF-C367 (green) and H2B-mCherry (red). Images were recorded using a laser scanning confocal microscope (LSM780-FCS; Carl Zeiss). Recording intervals were 5 min and the whole recording time was 6 h. S6
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Kanaani et al., http://www.jcb.org/cgi/content/full/jcb.200912101/dc1 Figure S1. The K2 rabbit polyclonal antibody is specific for GAD67,
More informationDescription: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics
More informationJBC Papers in Press. Published on July 27, 2015 as Manuscript M
JBC Papers in Press. Published on July 27, 2015 as Manuscript M115.654749 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.m115.654749 MS ID#: JBC/2015/654749, revised Title: Complementary
More informationSupporting Information
Supporting Information Shao et al. 10.1073/pnas.1504837112 SI Materials and Methods Immunofluorescence and Immunoblotting. For immunofluorescence, cells were fixed with 4% paraformaldehyde and permeabilized
More informationSupplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility
Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,
More informationSupplementary Figure S1
Supplementary Figure S1 Figure S1. CENP- FP constructs target to centromeres irrespective of site of tagging. FP- CENP and CENP- FP constructs were transfected into U2OS cells and counterstained with anti-
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationSupplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge
Supplement Figure 1 Plin5 Plin2 Plin1 KDEL-DSRed Plin-YFP Merge Supplement Figure 2 A. Plin5-Ab MitoTracker Merge AML12 B. Plin5-YFP Cytochrome c-cfp merge Supplement Figure 3 Ad.GFP Ad.Plin5 Supplement
More informationSpectral Separation of Multifluorescence Labels with the LSM 510 META
Microscopy from Carl Zeiss Spectral Separation of Multifluorescence Labels with the LSM 510 META Indians living in the South American rain forest can distinguish between almost 200 hues of green in their
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationPHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
More informationSupplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with
Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More informationBeta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
More information42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)
SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca
More informationPost-expansion antibody delivery, after epitope-preserving homogenization.
Supplementary Figure 1 Post-expansion antibody delivery, after epitope-preserving homogenization. (a, b) Wide-field fluorescence images of Thy1-YFP-expressing mouse brain hemisphere slice before expansion
More informationCycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney
1 Supplementary text and data for: 2 3 4 5 Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney Authors: David A. D. Munro 1*, Peter Hohenstein 2, and Jamie A.
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationThe Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
More informationcell and tissue imaging by fluorescence microscopy
cell and tissue imaging by fluorescence microscopy Steven NEDELLEC Plateforme Micropicell SFR Santé François Bonamy Nantes 1 A matter of size Limit of resolution 0.15mm aims: building the image of an object
More informationSupplemental Data. Aung et al. (2011). Plant Cell /tpc
35S pro:pmd1-yfp 10 µm Supplemental Figure 1. -terminal YFP fusion of PMD1 (PMD1-YFP, in green) is localized to the cytosol. grobacterium cells harboring 35S pro :PMD1-YFP were infiltrated into tobacco
More informationSupplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching
More information(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.
SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic
More information3D Transfection System
3D Transfection System Why 3D Technology? Introduction to Three Dimensional (3D) Cell Culture The goal of three-dimensional (3D) cell culture is to eliminate the stress and artificial responses cells experience
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
More informationX2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP
FRET efficiency.7.6..4.3.2 X2-C/X1-Y X2-C/VCAM-Y.1 1 2 3 Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently
More informationover time using live cell microscopy. The time post infection is indicated in the lower left corner.
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected
More informationNodes of regulation in cellular systems
Nodes of regulation in cellular systems cell membrane signal transduction ligands receptors oligomerization transport signal transduction modified protein Golgi transcription factor transport ER transport
More informationSupplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat
Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat pups at P6, P14, P22, P30 and adult (A) rats were subjected
More informationSUPPLEMENTARY INFORMATION
a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm
More informationConfocal Microscopy Analyzes Cells
Choosing Filters for Fluorescence A Laurin Publication Photonic Solutions for Biotechnology and Medicine November 2002 Confocal Microscopy Analyzes Cells Reprinted from the November 2002 issue of Biophotonics
More informationSupplemental information
Supplemental information - Control samples (200 subjects) - Immunohistochemistry of rat brain - Immunocytochemistry on neuronal cultures - Immunocompetition assay - Immunoprecipitation - Immunocytochemistry
More informationSupplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
More informationIntermediate Filaments in Motion: Observations of Intermediate Filaments in Cells Using Green Fluorescent Protein-Vimentin V
Molecular Biology of the Cell Vol. 10, 1289 1295, May 1999 Intermediate Filaments in Motion: Observations of Intermediate Filaments in Cells Using Green Fluorescent Protein-Vimentin V Jayme L. Martys,
More informationab Ran Activation Assay Kit
ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last
More informationab G alpha i Activation Assay Kit
ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version
More informationmcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details
More informationActive targeting of the nucleus using non-peptidic boronate tags
Supporting Information Active targeting of the nucleus using non-peptidic boronate tags Rui Tang 1, Ming Wang 2, Moumita Ray 1, Ying Jiang 1, Ziwen Jiang 1, Qiaobing Xu 2 *, Vincent M. Rotello 1 * 1 Department
More informationvector company modification/annotation insert
Supplemental information Plasmids Table 1. List of constructs used in the study. vector company modification/annotation insert pegfp-c1 Mikhaylova et al. 2009 Caln1 (NM_001077201.1) pegfp-c1 Caln1 ΔC (aa
More informationPurification of Lactate Dehydrogenase
Dominican University of California Dominican Scholar Scholarly & Creative Works Conference 2018 Scholarly and Creative Works Conference 2016 Apr 15th, 1:30 PM - 2:00 PM Purification of Lactate Dehydrogenase
More informationSupplementary material
Supplementary material Tracking mesenchymal stem cell contributions to regeneration in an immunocompetent cartilage regeneration model Daniela Zwolanek, María Satué, Verena Proell, Josè R. Godoy, Kathrin
More informationSupplementary Figure 1: Two modes of low concentration of BsSMC on a DNA (a) Protein staining (left) and fluorescent imaging of Cy3 (right) confirm
Supplementary Figure 1: Two modes of low concentration of BsSMC on a DNA (a) Protein staining (left) and fluorescent imaging of Cy3 (right) confirm that BsSMC was labeled with Cy3 NHS-Ester. In each panel,
More informationSupplemental Movie Legend.
Supplemental Movie Legend. Transfected T cells were dropped onto SEE superantigen-pulsed Raji B cells (approximate location indicated by circle). Maximum-intensity projections from Z-stacks (17 slices,
More informationFig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin
Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin (WGA-Alexa555) was injected into the extracellular perivitteline
More informationSupplementary Figures
Supplementary Figures a HindIII XbaI pcdna3.1/v5-his A_Nfluc-VVD 1-398 37-186 Nfluc Linker 1 VVD HindIII XhoI pcdna3.1/v5-his A_VVD-Nfluc 37-186 1-398 VVD Linker 2 Nfluc HindIII XbaI pcdna3.1/v5-his A_Cfluc-VVD
More informationAzure Biosystems Western Blotting Workflow
Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for
More informationNEW! CHOgro Expression System
NEW! CHOgro Expression System At Mirus Bio, we know it s all about expression. Introducing the new CHOgro Expression System, a transient transfection platform that finally gets high protein titers with
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationBIO 315 Lab Exam I. Section #: Name:
Section #: Name: Also provide this information on the computer grid sheet given to you. (Section # in special code box) BIO 315 Lab Exam I 1. In labeling the parts of a standard compound light microscope
More informationTo isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well
Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at
More informationFigure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9
Supplementary Information Ultrasensitive antibody detection by agglutination-pcr (ADAP) Cheng-ting Tsai 1 *, Peter V. Robinson 1 *, Carole A. Spencer 2 and Carolyn R. Bertozzi 3,4ǂ Department of 1 Chemistry,
More information1. Introduction. T. Zavašnik-Bergant 1
Application of monoclonal and ultrathin cryosections in immunogold electron microscopy: a study on recombinant human inhibitor expressed in bacterial cells T. Zavašnik-Bergant 1 1 Department of Biochemistry,
More informationGM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts
Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan
More informationCHOgro Expression System
CHOgro Expression System At Mirus Bio, we know it s all about expression. Introducing the new CHOgro Expression System, a transient transfection platform that finally gets high protein titers with robust
More informationQImaging Camera Application Notes Multicolor Immunofluorescence Imaging
QImaging Camera Application Notes Multicolor Immunofluorescence Imaging In order to image localization of intracellular proteins with high specificity, it is frequently necessary to multiplex antibody
More informationGFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
More informationResolution of Microscopes Visible light is nm Dry lens(0.5na), green(530nm light)=0.65µm=650nm for oil lens (1.4NA) UV light (300nm) = 0.13µm f
Microscopes and Microscopy MCB 380 Good information sources: Alberts-Molecular Biology of the Cell http://micro.magnet.fsu.edu/primer/ http://www.microscopyu.com/ Approaches to Problems in Cell Biology
More informationOverview of Solulink Products. June 2011
Overview of Solulink Products June 2011 1 Who we are Established in 2003, Solulink develops, patents, manufactures, and sells consumables to over 1,000 customers in life science, diagnostic, and pharmaceutical
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationImmunohistochemistry: Basics and Methods
Immunohistochemistry: Basics and Methods Bearbeitet von Igor B Buchwalow, Werner Böcker 1st Edition. 2010. Buch. x, 153 S. Hardcover ISBN 978 3 642 04608 7 Format (B x L): 15,5 x 23,5 cm Gewicht: 445 g
More informationM X 500 µl. M X 1000 µl
GeneGlide TM sirna Transfection Reagent (Catalog # M1081-300, -500, -1000; Store at 4 C) I. Introduction: BioVision s GeneGlide TM sirna Transfection reagent is a cationic proprietary polymer/lipid formulation,
More informationFLUORESCENT PEPTIDES. Outstanding Performance and Wide Application Range
FLUORESCENT PEPTIDES Peptides and amino acids labeled with and Tide Quencher TM We offer peptides and amino acids tagged with fluorescent dyes. They meet highest demands in fluorescence intensity and photo-stability,
More informationSupplemental Material for
Supplemental Material for TXI TELNGIECTSI MUTTED (TM)-MEDITED DN DMGE RESPONSE IN OXIDTIVE STRESS-INDUCED VSCULR ENDOTHELIL CELL SENESCENCE Hong Zhan 1, Toru Suzuki 1,2, Kenichi izawa 1, Kiyoshi Miyagawa,
More information7.17: Writing Up Results and Creating Illustrations
7.17: Writing Up Results and Creating Illustrations A Results Exercise: Kansas and Pancakes Write a 5-sentence paragraph describing the results illustrated in this figure: - Describe the figure: highlights?
More informationIgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only
IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective
More informationSUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal
More informationTF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting
Supplemental Material Supplemental Methods TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting In order to determine if the multi-parameter FACS approach would be successful
More informationSONOMA STATE UNIVERSITY DEPARTMENT OF BIOLOGY BIOLOGY 344: CELL BIOLOGY Fall 2013
SONOMA STATE UNIVERSITY DEPARTMENT OF BIOLOGY BIOLOGY 344: CELL BIOLOGY Fall 2013 Instructor Murali C. Pillai, PhD Office 214 Darwin Hall Telephone (707) 664-2981 E-mail pillai@sonoma.edu Website www.sonoma.edu/users/p/pillai
More informationab Ubiquitylation Assay Kit
ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.
More informationCell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK)
SUPPLEMENTAL MATERIAL Supplemental Methods Flow cytometry Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK) and anti-human CD68 (Dako, Denmark), anti-human smooth muscle cell α-actin
More informationGenetically targeted all-optical electrophysiology with a transgenic Credependent
Genetically targeted all-optical electrophysiology with a transgenic Credependent Optopatch mouse Short title: Transgenic Optopatch mouse Shan Lou 1, Yoav Adam 1, Eli N. Weinstein 1,4, Erika Williams 2,
More informationVisualizing Cells Molecular Biology of the Cell - Chapter 9
Visualizing Cells Molecular Biology of the Cell - Chapter 9 Resolution, Detection Magnification Interaction of Light with matter: Absorbtion, Refraction, Reflection, Fluorescence Light Microscopy Absorbtion
More informationIn-Gel Western Detection Using Near-Infrared Fluorescence
In-Gel Western Detection Using Near-Infrared Fluorescence Developed for: Aerius, and Odyssey Family of Imagers Please refer to your manual to confirm that this protocol is appropriate for the applications
More informationNature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX.
Supplementary Figure 1 Retention of RNA with LabelX. (a) Epi-fluorescence image of single molecule FISH (smfish) against GAPDH on HeLa cells expanded without LabelX treatment. (b) Epi-fluorescence image
More informationStaining Techniques. Staining Techniques. There are many dyes. Histochemical Stains: chemical reactions. Feulgen reaction -DNA
Staining Techniques There are many dyes. http://medinfo.ufl.edu/~dental/denhisto/stains.html Examples: Sudan black -Lipids Myelinated axons- blue ihcworld.com/imagegallery/displayimage.php?al... Weigert
More informationAmersham Western blotting
Amersham Western blotting Selection guide www.gelifesciences.com Innovative solutions designed to meet your specific protein analysis needs Since 1990 when we first launched Amersham ECL we have continued
More informationSupplementary Table 1. Oligonucleotide sequences used in the study
Supplementary Table 1. Oligonucleotide sequences used in the study Oligonucleotides Sequences (5 3 ) Substrate strand Lock -4 Lock -5 Lock -6 Lock -7 Free control DNAzyme DNAzyme strand linked to AuNP
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationAssays for studying mitochondrial health and function
APPLICATION NOTE Fluorescence labeling and detection Assays for studying mitochondrial health and function Introduction Mitochondria play a critical role in maintaining normal cellular activities. Mitochondria
More informationPlasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System
Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,
More informationCationic Vector Intercalation into the Lipid Membrane Enables Intact Polyplex DNA Escape from Endosomes for Gene Delivery
Cationic Vector Intercalation into the Lipid Membrane Enables Intact Polyplex DNA Escape from Endosomes for Gene Delivery Sriram Vaidyanathan, 1 Junjie Chen, 2 Bradford G. Orr, 3 Mark M. Banaszak Holl
More informationDaughter-cell-specific modulation of nuclear pore complexes controls cell cycle entry during asymmetric division
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0056-9 In the format provided by the authors and unedited. Daughter-cell-specific modulation of nuclear pore complexes controls cell
More informationFRAUNHOFER IME SCREENINGPORT
FRAUNHOFER IME SCREENINGPORT Detection technologies used in drug discovery Introduction Detection technologies in drug discovery is unlimited only a biased snapshot can be presented Differences can presented
More informationProduct Guide SPL Red Kit for 40 Western Blots
Additional materials required: Smart Protein Layers Product Guide SPL Red Kit for 40 Western Blots Product No.: PR911-M, PR911-R, PR911-G; PR912-M, PR912-R, PR912-G Recommended combination product for
More informationHT Pico Protein Express LabChip Kit, Frequently Asked Questions
Protein Detection 1. How does the GXII determine protein concentration? Protein samples contain a single lower marker. Alignment to a single marker does not provide enough constraints to align large proteins,
More informationSupplementary Information
Supplementary Information Live imaging reveals the dynamics and regulation of mitochondrial nucleoids during the cell cycle in Fucci2-HeLa cells Taeko Sasaki 1, Yoshikatsu Sato 2, Tetsuya Higashiyama 1,2,
More informationTechnical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationMicroscopy from Carl Zeiss. DirectFRAP. News from the Cell. The New Class of Laser Manipulation for the Analysis of Cell Dynamics
Microscopy from Carl Zeiss DirectFRAP News from the Cell The New Class of Laser Manipulation for the Analysis of Cell Dynamics DirectFRAP. New Insights into Cell Dynamics. Fluorescence breaks new ground:
More informationWesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits
WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse
More informationCell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential
Supporting Online Material Materials and methods Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential Medium (Gibco BRL, Invitrogen Corporation, Carlsbad, CA, USA), supplemented
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationwestern blotting tech
western blotting tech note 6148 Transfer of High Molecular Weight Proteins to Membranes: A Comparison of Transfer Efficiency Between Blotting Systems Nik Chmiel, Bio-Rad Laboratories, Inc., 6000 James
More informationImmunohistochemistry: Basics and Methods
Immunohistochemistry: Basics and Methods Igor B. Buchwalow l Werner Böcker Immunohistochemistry: Basics and Methods Prof. Dr. Igor B. Buchwalow Prof. Dr. Werner Böcker Gerhard-Domagk-Institut für Pathologie
More informationSupplementary Materials
Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran
More informationOne-step split GFP staining for sensitive protein detection and localization in mammalian cells
Supplementary Materials For: One-step split GFP staining for sensitive protein detection and localization in mammalian cells Lara Kaddoum 1,3, Eddy Magdeleine 1,3, Geoffrey S. Waldo 4, Etienne Joly 1,3,
More informationCell Structure and Function
Cell Structure and Function Dead White Men Who Discovered (and were made of) Cells: Anton Van Leeuwenhoek Robert Hooke Where the Magic Happened Schleiden Cell Theory All plants are made of cells Schwann
More informationSupplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
More informationSupporting Figure 1: Meis2 and Pax6 transcripts in the adult murine brain detected by in situ
DEVELOP2013097295_supplementary figures Supporting Figure 1: Meis2 and Pax6 transcripts in the adult murine brain detected by in situ hybridization on vibratome sections. (A) Meis2-specific transcripts
More information