Next Generation Sequencing. Josef K Vogt Slides by: Simon Rasmussen
|
|
- Augusta Atkinson
- 6 years ago
- Views:
Transcription
1 Next eneration Sequencing Josef K Vogt Slides by: Simon Rasmussen 2017
2 Second generation sequencing 454 Illumina % market share SOLiD Ion Torrent (PM)
3 Library preparation 1.reate library molecules 2.Amplification (PR) 3.Massive parallel sequencing DNA from extract Library ragment & polish DNA Adapters Library molecule
4 Amplification and immobilization Emulsion PR (454, Solid, IonTorrent): Water, oil, beads, one DNA template/droplet Bridge PR (Illumina): One DNA template/cluster, primers on surface, grow by bridging primers Bridge PR Metzker, Naten Rev. 2010
5 luorescence detection REVIEWS Illumina - yclic reversible termination Pyrosequencing a Illumina/Solexa Reversible terminators A T A T c Helicos BioSciences Reversible terminators Add all dntps Incorporate all four nucleotides, each label with a different dye labelled w. diff dye T A A T Incorporate single, dye-labelled nucleotides Load template beads into wells reate fourcolor image Wash, fourcolour imaging T A T Wash, onecolour imaging low one dntp across wells Polymerase incorporates nucleotide leave dye and repeat next cycle leave dye and terminating groups, wash T A T leave dye and inhibiting groups, cap, wash Release of PPi leads to light b Repeat cycles d Imaging, next Repeat cycles dntp Metzker, Naten Rev T A
6 groups, wash groups, cap, wash 2: Imaging handout Repeat cycles Repeat b d Illumina 1: T A Illumina 2: T A T A Top: ATT Bottom: Top: Bottom: TAT ATA One-base-encoded probe An oligonucleotide sequence in which one interrogation base is associated with a particular igure 2 our-colour and one-colour cyclic reversible termination methods. a The four-colour cyclic termination (RT) method uses Illumina/Solexa s 3 -O-azidomethyl reversible terminator chemistry 23,101 (B solid-phase-amplified template clusters (I. 1b, shown as single templates for illustrative purposes). ollo imaging, a cleavage step removes the fluorescent dyes and regenerates the 3 -OH group using the reduci tris(2-carboxyethyl)phosphine (TEP) 23. b The four-colour images highlight the sequencing data from tw amplified templates. c Unlike Illumina/Solexa s terminators, 454: the Helicos Virtual Terminators 33 are labelled same dye and dispensed individually in a predetermined order, analogous to a single-nucleotide addition ollowing total internal reflection fluorescence imaging, a cleavage step removes the fluorescent dye and groups using TEP to permit the addition of the next y5-2 -deoxyribonucleoside triphosphate (dntp) an free sulphhydryl groups are then capped with iodoacetamide before the next nucleotide addition 33 (step d The one-colour images highlight the sequencing data from two single-molecule templates. Metzker, Naten Rev. 2010
7 groups, wash groups, cap, wash 2: Imaging handout - answers Repeat cycles Repeat b d T A Quality of base call deteriorates after many T A cycles T A Top: ATT Bottom: Top: Bottom: TAT ATA One-base-encoded probe An oligonucleotide sequence in which one interrogation base is associated with a particular igure 2 our-colour and one-colour cyclic reversible termination methods. a The four-colour cyclic termination (RT) method uses Illumina/Solexa s 3 -O-azidomethyl reversible terminator chemistry 23,101 (B solid-phase-amplified template clusters (I. 1b, shown as single templates for illustrative purposes). ollo imaging, a cleavage step removes the fluorescent dyes and regenerates the 3 -OH group using the reduci tris(2-carboxyethyl)phosphine (TEP) 23. b The four-colour images highlight the sequencing data from tw Homopolymer runs are amplified templates. c Unlike Illumina/Solexa s terminators, the Helicos Virtual Terminators 33 labelled same dye and dispensed individually in a predetermined problematic, order, analogous to a gives single-nucleotide rise to addition ollowing total internal reflection fluorescence imaging, a cleavage step removes the fluorescent dye and groups using TEP to permit the addition of the next y5-2 -deoxyribonucleoside indels triphosphate (dntp) an free sulphhydryl groups are then capped with iodoacetamide before the next nucleotide addition 33 (step d The one-colour images highlight the sequencing data from two single-molecule templates. Metzker, Naten Rev. 2010
8 Illumina: Quality deterioration an you think of why? Efficiency of incorporation: Polymerase incorporation of base Enzyme that cleaves the dye
9 NextSeq/HiSeq3000/4000 hemistry is not based 4 dyes (as before) but 2 dyes T (red), (green), A (both) and (none = dark ) aster processing rate and cheaper reagents Slightly increases error rate Problem with stretches because is not dyed
10 Similar principle to 454 Ion Torrent Library: Emulsion PR Based on semiconductors Ion Torrent Detection is based on H ions (ph) changes
11 Solid
12 Solid example Double-base encoding olorspace Low error rate Errors solid0420_ _ra/1 T !=:369A?:.<9=.-5=%3-:6%3&<2%(169%,0.3%&'&(&.'%%%&&, AAT...
13 omplete enomics ssdna -> DNA nanoballs Use silicon chips with sticky spots Place DNBs into each spot Sequence using ligase and flourescent labeled probes You cant buy the machine - Acquired by BI - delayed - Only humans!
14 3rd generation No amplification (PR introduces bias!) Simple sample preparation Helicos Pacific Biosciences Oxford Nanopore
15 Pacific Biosciences Slowed down DNA polymerase, measure light emission, Long reads > 10kb, high error rate (but random) Pacific Biosciences
16 Oxford Nanopore Nano-scale pores, with current across Drag DNA stretch through the pore Measure change in current (pentamers) Long reads (up to 200k), currently ~5k, some systematic errors Oxford Nanopore
17 Mean Signal (pa) PacBio o tp t A camera records the changing colours from all ZMWs; each colour change corresponds to one base O T o tp t (s iggles) ach current shi as DNA translocates through the pore corresponds to a particular k-mer Synthetic Long Reads (2nd gen) Time (seconds) B S nthetic long-read se encing Ba ll mina Bb Illumina Synthetic long-read sequencing (Moleculo) D ragment DNA is fragmented and selected to ~10 kb n matic clea age DNA is barcoded and fragmented to ~350 bp ~3,000 molecules per well Based on Illumina sequencing 10X enomics A1 A2 enomics m lsion P R Arbitrarily long DNA is mixed with beads loaded with barcoded primers, enzyme and dntps EMs Each micelle has 1 barcode out of 750,000 mplification Long fragments are amplified such that the product is a barcoded fragment ~350 bp Pooling The emulsion is broken and DNA is pooled, then it undergoes a standard library preparation Barcodes DNA from the same well shares the same barcode Using barcode system to create linked reads / read clouds Pooling DNA from each well is pooled and undergoes a standard library preparation Se encing DNA is sequenced on a standard short-read sequencer Lin ed reads All reads from the same EM derive from the long fragment, thus they are linked Reads are dispersed across the long fragment and no EM achieves full coverage of a fragment Stacking of linked reads from the same loci achieves continuous coverage at re Re iews enetics 344 JUNE 2016 VOLUME 17
18 Machine overview - I ompany/technology urrent machine, key characterstics 454 S LX+, 7-800bp length, 1M reads Illumina Solid (Life) PM (Life) omplete enomics (BISEQ) PacBio Oxford Nanopore Illumina synthetic 10X enomics HiSeq400/HiSeqX Ten, bp length, up to 2-4B reads 5500XL, 50/75bp length, 1.5B reads Ion Proton, 200/400bp length, 80M reads BISEQ-500, bp, 200b in total Sequel, 8-12kb length, 350k reads ridion, up to 200kb, >100k reads up to 100kb synthetic length, 1000$ pr. b up to 100kb synthetic length, +500$ per sample Excellent overview at oodwin et al., Nature Reviews (2016)
19 Machine overview - II Benchtop machines ompany/technology urrent machine, key characterstics 454 S Junior, 4-500bp length, 100k reads Illumina MiSeq, 300bp length, 50M reads PM (Life) Ion Torrent, 400bp length, 5M reads Oxford Nanopore MinION, up to 200kb, 100k reads Excellent overview at oodwin et al., Nature Reviews (2016)
20 More NS material Elaine Mardis on NS technology Youtube has many more Excellent review on NS technologies: oodwin et al., Nature Reviews (2016) On ampusnet together with many other papers!
Next Generation Sequencing. Simon Rasmussen Assistant Professor Center for Biological Sequence analysis Technical University of Denmark
Next eneration Sequencing Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark DNA Sequencing DNA sequencing Reading the order of bases in DNA fragments
More informationIntroduction to Next Generation Sequencing (NGS)
Introduction to Next eneration Sequencing (NS) Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark 2012 Today 9.00-9.45: Introduction to NS, How it
More informationChIP-seq data analysis
hip-seq data analysis Harri Lähdesmäki Department of omputer Science Aalto University January 8, 2015 Motivation: transcription factor binding site (TBS) prediction Last time we studied computational methods
More informationNext Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
More informationHuman genome sequence
NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationFunctional Genomics Research Stream. Research Meetings: November 2 & 3, 2009 Next Generation Sequencing
Functional Genomics Research Stream Research Meetings: November 2 & 3, 2009 Next Generation Sequencing Current Issues Research Meetings: Meet with me this Thursday or Friday. (bring laboratory notebook
More informationThird Generation Sequencing
Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence
More informationHigh Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015
High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationNext Generation Sequencing Technologies
Next Generation Sequencing Technologies What is first generation? Sanger Sequencing DNA Polymerase Base-adding reaction +H + http://chemwiki.ucdavis.edu/organic_chemistry/organic_chemistry_with_a_biological_emphasis/chapter_10%3a_phosphoryl_transfer_reactions/section_10.4%3a_phosphate_diesters
More informationDNA-Sequencing. Technologies & Devices
DNA-Sequencing Technologies & Devices Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day, 850 nt reads 2 Mb/day, 550 nt reads Roche/454 GS FLX 12/2006 800 Mb/23h, 800 nt reads
More informationNext Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017
Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA
More informationNEXT-GENERATION SEQUENCING AND BIOINFORMATICS
NEXT-GENERATION SEQUENCING AND BIOINFORMATICS Moore's law: the number of transistors in a dense integrated circuit doubles every two years Moore's law calculates and predicts the pace of improvement of
More informationBIOINFORMATICS 1 SEQUENCING TECHNOLOGY. DNA story. DNA story. Sequencing: infancy. Sequencing: beginnings 26/10/16. bioinformatic challenges
BIOINFORMATICS 1 or why biologists need computers SEQUENCING TECHNOLOGY bioinformatic challenges http://www.bioinformatics.uni-muenster.de/teaching/courses-2012/bioinf1/index.hbi Prof. Dr. Wojciech Makałowski"
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationNext Generation Sequencing (NGS)
Next Generation Sequencing (NGS) Fernando Alvarez Sección Biomatemática, Facultad de Ciencias, UdelaR 1 Uruguay Montevide o 3 TANGO World Champ 1930 1950 (Maraca 4 Next Generation Sequencing module Next
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationGenome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias
Genome Sequencing I: Methods MMG 835, SPRING 2016 Eukaryotic Molecular Genetics George I. Mias Department of Biochemistry and Molecular Biology gmias@msu.edu Sequencing Methods Cost of Sequencing Wetterstrand
More informationNGS technologies approaches, applications and challenges!
www.supagro.fr NGS technologies approaches, applications and challenges! Jean-François Martin Centre de Biologie pour la Gestion des Populations Centre international d études supérieures en sciences agronomiques
More informationResearch school methods seminar Genomics and Transcriptomics
Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence
More informationDNA-Sequenzierung. Technologien & Geräte
DNA-Sequenzierung Technologien & Geräte Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day, 850 nt reads 2 Mb/day, 550 nt reads Roche/454 GS FLX 12/2006 400 Mb/7h, 350 nt reads
More informationSequencing techniques and applications
I519 Introduction to Bioinformatics Sequencing techniques and applications Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Sequencing techniques Sanger sequencing Next generation
More informationIntroductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology
Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as
More informationNEXT GENERATION SEQUENCING: A REVOLUTION IN GENE SEQUENCING
NEXT GENERATION SEQUENCING: A REVOLUTION IN GENE SEQUENCING Ritesh Kaur and *Chander Parkash Malik School of Life Sciences, Jaipur National University, Jaipur, Rajasthan 302017, India *Author for Correspondence
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationMHC Region. MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells
DNA based HLA typing methods By: Yadollah Shakiba, MD, PhD MHC Region MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells Nomenclature of HLA Alleles Assigned
More informationHLA-Typing Strategies
HLA-Typing Strategies Cologne, 13.5.2017 Joannis Mytilineos MD, PhD Department of Transplantation Immunology Institute for Clinical Transfusion Medicine and Immunogenetics German Red Cross Blood Transfusion
More information2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?
2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics
More informationBiochemistry 412. New Strategies, Technologies, & Applications For DNA Sequencing. 12 February 2008
Biochemistry 412 New Strategies, Technologies, & Applications For DNA Sequencing 12 February 2008 Note: Scale is wrong!! (at least for sequences) 10 6 In 1980, the sequencing cost per finished bp $1.00
More informationBioanalytical chemistry. 6. DNA sequencing
123 Bioanalytical chemistry 6. DNA sequencing Some objectives for this section You will know how DNA was traditionally sequenced by 1 color, 4 lane methods You will know how DNA was traditionally sequenced
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationUltrasequencing: Methods and Applications of the New Generation Sequencing Platforms
Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms Laura Moya Andérico Master in Advanced Genetics Genomics Class December 16 th, 2015 Brief Overview First-generation
More informationOpportunities offered by new sequencing technologies
Opportunities offered by new sequencing technologies Pierre Taberlet Laboratoire d'ecologie Alpine CNRS UMR 5553 Université Joseph Fourier, Grenoble, France Nature Biotechnology, October 2008: special
More informationContact us for more information and a quotation
GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA
More informationCSC Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx By Anonymous. Similarity Index
Page 1 of 6 Document Viewer TurnitinUK Originality Report Processed on: 05-Dec-20 10:49 AM GMT ID: 13 Word Count: 1587 Submitted: 1 CSC8313-201 - Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationINTRODUCCIÓ A LES TECNOLOGIES DE 'NEXT GENERATION SEQUENCING'
INTRODUCCIÓ A LES TECNOLOGIES DE 'NEXT GENERATION SEQUENCING' Bioinformàtica per a la Recerca Biomèdica Ricardo Gonzalo Sanz ricardo.gonzalo@vhir.org 14/12/2016 1. Introduction to NGS 2. First Generation
More informationThema Gentechnologie. Erwin R. Schmidt Institut für Molekulargenetik Vorlesung #
Thema Gentechnologie Erwin R. Schmidt Institut für Molekulargenetik Vorlesung #10 01. 07. 2014 Pyrosequenzierung The Pyrosequencing technology is a relatively new DNA sequencing method originally
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationRIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)
Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information
More informationHiSeqTM 2000 Sequencing System
IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance
More informationNext-Generation Sequencing for Biomedical Applications
University of New Mexico UNM Digital Repository Biomedical Sciences ETDs Electronic Theses and Dissertations 7-1-2013 Next-Generation Sequencing for Biomedical Applications Mingyan Xu Follow this and additional
More informationMethods, Models & Techniques. High-throughput DNA sequencing concepts and limitations
High-throughput DNA sequencing concepts and limitations Martin Kircher and Janet Kelso Recent advances in DNA sequencing have revolutionized the field of genomics, making it possible for even single research
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-03 GENOMICS AND TRANSCRIPTOMICS: WHY PROTEOMICS? TRANSCRIPT Welcome to the proteomics course. Today, we will talk about Genomics and Transcriptomics and then we will talk about why to study proteomics?
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationIncorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits
Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing
More informationGenetic Fingerprinting
Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.
More informationAxygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand
Axygen AxyPrep Magnetic Bead Purification Kits A Corning Brand D Sample Prep Solutions for Genomics Obtaining Pure Nucleic Acids from Your Sample is Precious The purification of high quality DNA is the
More informationSequencing Theory. Brett E. Pickett, Ph.D. J. Craig Venter Institute
Sequencing Theory Brett E. Pickett, Ph.D. J. Craig Venter Institute Applications of Genomics and Bioinformatics to Infectious Diseases GABRIEL Network Agenda Sequencing Instruments Sanger Illumina Ion
More informationOutline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture
The use of new sequencing technologies for genome analysis Chris Mattocks National Genetics Reference Laboratory (Wessex) NGRL (Wessex) 2008 Outline General principles of clonal sequencing Analysis principles
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationIllumina (Solexa) Throughput: 4 Tbp in one run (5 days) Cheapest sequencing technology. Mismatch errors dominate. Cost: ~$1000 per human genme
Illumina (Solexa) Current market leader Based on sequencing by synthesis Current read length 100-150bp Paired-end easy, longer matepairs harder Error ~0.1% Mismatch errors dominate Throughput: 4 Tbp in
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationFGCZ NEWSLETTER FALL Next Generation Sequencing at the Functional Genomics Center Zurich
FGCZ NEWSLETTER FALL 2011 newsletter Technologies, Applications, and Access to Support Next Generation Sequencing at the Functional Genomics Center Zurich OVERVIEW 1 NGS AT THE FGCZ Technologies and organization
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationCM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION
CM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION Fall 2015 Instructors: Coordinator: Carol Wilusz, Associate Professor MIP, CMB Instructor: Dan Sloan, Assistant Professor, Biology,
More informationPublished in: Next Generation Sequencing - Advances, Applications and Challenges DOI: /61964
Next-Generation Sequencing An Overview of the History, Tools, and Omic Applications Kulski, J. (2016). Next-Generation Sequencing An Overview of the History, Tools, and Omic Applications. In J. K. Kulski
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationTargeted Sequencing in the NBS Laboratory
Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February
More informationChapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi
Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated
More informationMICRO$EC: Cost Effective, Whole-Genome Sequencing
University of Pennsylvania ScholarlyCommons Senior Design Reports (CBE) Department of Chemical & Biomolecular Engineering 4-2011 MICRO$EC: Cost Effective, Whole-Genome Sequencing Kulika Chomvong University
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationIntroduction Bioo Scientific
Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationProcedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing
Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Before You Begin This document describes methods for generating barcoded PCR products
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More information1. A brief overview of sequencing biochemistry
Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry
More informationWhat is a microarray
DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective
More informationPrecise quantification of Ion Torrent libraries on the QuantStudio 3D Digital PCR System
APPLICATION NOTE QuantStudio 3D Digital PCR System Precise quantification of Ion Torrent libraries on the QuantStudio 3D Digital PCR System Introduction The template preparation step in the next-generation
More informationComparative genomics on gene and single nucleotide level
Technische Fakultät Center for Biotechnology (CeBiTec) Computational Genomics Comparative genomics on gene and single nucleotide level Zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften
More informationFundamentals of Real Time PCR
Fundamentals of Real Time PCR Mohamed Abdel Fattah Senior Technical Specialist Scientific Support - Molecular Biology Dept. AnalysisAB Co. Mobile: 012 27 906 74 E-mail: analysis@analysis-ab.com What is
More informationProcedure & Checklist - Preparing Asymmetric SMRTbell Templates
Procedure & Checklist - Preparing Asymmetric SMRTbell Templates Before You Begin In this procedure, PCR products are generated using two rounds of amplification. The first round uses target specific primers
More informationA window into third-generation sequencing
Human Molecular Genetics, 2010, Vol. 19, Review Issue 2 doi:10.1093/hmg/ddq416 Advance Access published on September 21, 2010 A window into third-generation sequencing R227 R240 Eric E. Schadt, Steve Turner
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationSession 3 Cloning Overview & Polymerase Chain Reaction
Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful
More informationCHEM 4420 Exam I Spring 2013 Page 1 of 6
CHEM 4420 Exam I Spring 2013 Page 1 of 6 Name Use complete sentences when requested. There are 100 possible points on this exam. The multiple choice questions are worth 2 points each. All other questions
More informationTECHNICAL BULLETIN. SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies. Catalog Number SEQX Storage Temperature 20 C
SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies Catalog Number SEQX Storage Temperature 20 C TECHNICAL BULLETIN Product Description The SeqPlex DNA Amplification Kit
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationEcole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech
GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG
More informationTQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 5
www.smobio.com Product Information ExcelTaq series 2X Q-PCR Master Mix (SYBR, no ROX) TQ1100 200 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ1101 500 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationPreparing Samples for Analysis of Small RNA
Preparing Samples for Analysis of Small RNA Topics 3 Introduction 4 Kit Contents and Equipment Checklist 6 Isolate Small RNA by Denaturing PAGE Gel 9 Ligate 5' RNA Adapters 12 Ligate 3' RNA Adapters 15
More informationPureSpin DNA Clean Up Kit
PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage
More informationBioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
More informationSANGER SEQUENCING WHITE PAPER
AAAT T C SANGER SEQUENCING WHITE PAPER FACTORS AFFECTING SANGER SEQUENCING ROBUSTNESS AND DATA QUALITY PATRICK WARNER, SHEA ANDERSON, ARCHANA DESHPANDE, DARYL M. GOHL, KENNETH B. BECKMAN UNIVERSITY OF
More informationHiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
More information10 RXN 50 RXN 500 RXN
SeqPlex Enhanced DNA Amplification Kit for use with high throughput sequencing technologies Catalog Number SEQXE Storage Temperature 20 C TECHNICAL BULLETIN Product Description The SeqPlex DNA Amplification
More informationBST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data
BST227 Introduction to Statistical Genetics Lecture 8: Variant calling from high-throughput sequencing data 1 PC recap typical genome Differs from the reference genome at 4-5 million sites ~85% SNPs ~15%
More informationHuman genetic variation
Human genetic variation CHEW Fook Tim Human Genetic Variation Variants contribute to rare and common diseases Variants can be used to trace human origins Human Genetic Variation What types of variants
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More information