FBH1 Catalyzes Regression of Stalled Replication Forks
|
|
- Blaze Hamilton
- 6 years ago
- Views:
Transcription
1 Cell Reports Supplemental Information FBH1 Catalyzes Regression of Stalled Replication Forks Kasper Fugger, Martin Mistrik, Kai J. Neelsen, Qi Yao, Ralph Zellweger, Arne Nedergaard Kousholt, Peter Haahr, Wai Kit Chu, Jiri Bartek, Massimo Lopes, Ian D. Hickson, and Claus Storgaard Sørensen
2 Supplementary Figure 1 BLM (nm) FBH1 (nm) a FBH1 WT RF AMP ATP PNP RF bp b bp EcoRI (86bp) ssdna Regressed fork 50 EcoRI (86bp) ssdna Regressed fork 50 c d % of regressed forks siunc HU sifbh1 HU No signal Signal
3 Supplementary Figure b a HU CPT (low) Thym HU (hrs) sifbh1 S4/8 S4/8 CHK T68 CtIP CHK CHK T68 CHK FBH1 c PFGE CPT (high) Hrs DNA breaks S4/8 CtIP d CHK T68 HU CHK 1 CPT Hrs CtIP PFGE DNA breaks e UOS/shFbh1HU siunc sirad51 DOX RAD51
4 Supplementary Figure 3 a Release from HU (hrs) UCN01 Count PI shfbh1 DOX shfbh1 DOX b UOS/shFBH Release (hrs) DOX FBH1 c Normalized p intensity d Cyclin A HU release (hrs) DAPI
5 Supplementary Figure 1. a. FBH1 wildtype (WT) or helicase dead (HL) were incubated with 5 pm replication fork substrate at 37 C for 30 mins, and then digested with EcoRI. The reaction products were separated by native PAGE. Gels were dried, and processed by PhosphorImaging. Referring to Figure 1. b. Either FBH1 or BLM helicase were incubated with 5 pm replication fork substrate at 37 C for 30 mins, and then digested with EcoRI. The reaction products were separated by native PAGE. Gels were dried, and processed by PhosphorImaging. Referring to Figure 1. c. EM samples from Fig. a were analysed and quantified for the presence of ssdna on the regressed arm (siunc N=44; sifbh1 N=3). Graphs were made using Graphpad Prism 6 software. Referring to Figure. d. Graphical illustration of BrdUbased assay for detection of exposed nascent strands (see Experimental Procedures section). Referring to Figure. Supplementary Figure. a. UOS cells were transfected with UNC or FBH1 sirna for 48 hours. Cells were treated with either mm HU, 4 mm thymidine, or 100 nm CPT for 4 hours, collected and subjected to immunoblotting with the indicated antibodies. Referring to Figure 3. b. (Top) UOS were treated with mm HU for for the indicated durations. Cells were collected and subjected to immunoblotting with the indicated antibodies. (Bottom) Cells werew treated as above and subjected to PFGE analysis. Referring to Figure 3. 1
6 c. (Top) UOS were treated with 1 µm CPT for for the indicated durations. Cells were collected and subjected to immunoblotting with the indicated antibodies. (Bottom) Cells werew treated as above and subjected to PFGE analysis. Referring to Figure 3. d. UOS were treated with either mm HU or 1 µm CPT for for the indicated durations. Cells were collected and subjected to immunoblotting with the indicated antibodies. Referring to Figure 3. e. UOS/shFBH1 were transfected with either UNC or RAD51 sirna and then induced or not with doxycyclin for 48 hours. Cells were treated with mm HU for 4 hours and subjected to immunoblotting with the indicated antibodies. Referring to Figure 3. Supplementary Figure 3. a. UOS/shFBH1 were either induced (green) or not (red) with doxycyclin for 48 hours before treatment with mm HU for 4 hours. Cells were released from the HU block into fresh media containing nocodazole (100 ng/ml), collected at the indicated timepoints, stained with PI and analyzed by flow cytometry. Referring to Figure 4. b. UOS/shFBH1 were either induced or not with doxycyclin for 48 hours before treatment with mm HU for 16 hours. Cells were released from the HU block into fresh media, collected at the indicated timepoints and subjected to immunoblotting with the indicated antibodies. Referring to Figure 4.
7 c. Quantification of phosphorylation from b using ImageJ and Prism software. Referring to Figure 4. d. Gating of G1 phase cells in Fig. 4c based on DAPI and Cyclin A negative staining. Referring to Figure 4. 3
Coleman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2579 Figure S1 Incorporation of heavy isotope-labeled amino acids and enrichment of di-glycine modified peptides. The incorporation of isotopelabeled amino acids in peptides was calculated
More informationSUPPLEMENTAL MATERIAL. Supplemental material contains Supplemental Figure Legends and Supplemental Figures 1 to
SUPPLEMENTAL MATERIAL Supplemental material contains Supplemental Figure Legends and Supplemental Figures 1 to 6. SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Overview of the mechanisms by which
More informationDOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
More informationSupplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494
Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting
More informationEmanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera
SUPPLEMENTARY INFORMATION Roles of human POLD1 and POLD3 in genome stability Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY METHODS Cell proliferation After sirna
More informationSupplemental Figure Legends:
Supplemental Figure Legends: Fig S1. GFP-ABRO1 localization. U2OS cells were infected with retrovirus expressing GFP- ABRO1. The cells were fixed with 3.6% formaldehyde and stained with antibodies against
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationSupplementary Information
Supplementary Information stability is regulated by CK2-dependent interaction with R2TP complex Patrick von Morgen 1,2, Kamila Burdova 1, Thomas G. Flower 3, Nicola J. O'Reilly 4, Simon J. Boulton 5, Stephen
More informationSupplemental Material
Supplemental Material Figure S1.(A) Immuno-staining of freshly isolated Myf5-Cre:ROSA-YFP fiber (B) Satellite cell enumeration in WT and cko mice from resting hind limb muscles. Bulk hind limb muscles
More informationTopoisomerase I poisoning results in PARP-mediated replication fork reversal (A. Ray Chaudhuri et al.)
Topoisomerase I poisoning results in PARP-mediated replication fork reversal (A. Ray Chaudhuri et al.) Supplementary Figures and Tables Supplementary Figure 1 Supplementary Figure 1. Effect of CPT on genome
More informationSupplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after
Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for
More informationSupplementary Materials
Supplementary Materials Supplementary Figure 1. PKM2 interacts with MLC2 in cytokinesis. a, U87, U87/EGFRvIII, and HeLa cells in cytokinesis were immunostained with DAPI and an anti-pkm2 antibody. Thirty
More informationSupplemental Materials and Methods
Supplemental Materials and Methods Proteins and reagents Proteins were purified as described previously: RecA, RecQ, and SSB proteins (Harmon and Kowalczykowski 1998); RecF protein (Morimatsu and Kowalczykowski
More informationpt7ht vector and over-expressed in E. coli as inclusion bodies. Cells were lysed in 6 M
Supplementary Methods MIG6 production, purification, inhibition, and kinase assays MIG6 segment 1 (30mer, residues 334 364) peptide was synthesized using standard solid-phase peptide synthesis as described
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More informationSUPPLEMENTARY INFORMATION FIGURE LEGENDS
SUPPLEMENTARY INFORMATION FIGURE LEGENDS Fig. S1. Radiation-induced phosphorylation of Rad50 at a specific site. A. Rad50 is an in vitro substrate for ATM. A series of Rad50-GSTs covering the entire molecule
More informationCytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of
Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,
More informationHossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
More informationMasayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies
Molecular Cell, Volume 35 Supplemental Data Single-Molecule Analysis Reveals Differential Effect of ssdna-binding Proteins on DNA Translocation by XPD Helicase Masayoshi Honda, Jeehae Park, Robert A. Pugh,
More informationSupplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11988 Supplementary Figure 1. Digestion of model DNA substrates. a, Linearized plasmid DNA (pik31- PstI, lanes 1 and 2), supercoiled plasmid (pik31, lanes 3 and 4), singly nicked plasmid
More informationBreast cell lines with Combination Index (CI) and p53 mutation status
Supplementary Table 1 Breast cell lines with Combination Index (CI) and p53 mutation status Cell Line CI p53 status a BT20 0.44 K132Q BT549 0.53 R249S CAL120 0.61 c.672+2t>g CAL51 0.73 wild-type CAMA1
More informationSupplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.
More informationSupplementary Figure 1
Supplementary Figure 1 A basic residue of BARD1 promotes Ub-transfer from BRCA1-E2~Ub. A. Scan of external facing BARD1 residues 91-99 for impact on Ub chain formation catalysed by the BRCA1- BARD1 ligase.
More informationSUPPLEMENTARY INFORMATION
DOI: 1.1/ncb2918 Supplementary Figure 1 (a) Biotin-dUTP labelling does not affect S phase progression. Cells synchronized in mid-s phase were labelled with biotindutp during a 5 min hypotonic shift (red)
More informationB. C. Staurosporine BEZ235 DMSO. -actin. Suppl. Fig. 1 BEZ235 and BGT226 inhibit phosphorylation of Akt and downstream targets of PI3K and mtor.
DMSO Staurosporine BGT226 A. B. C. BGT226 P-Akt 0 1 2 4 8 hrs. P-Akt 0 5 10 25 50 100 nm PS6 P-4E-BP1 -actin C-Caspase3 -actin PS6 P-4E-BP1 -actin Suppl. Fig. 1 and BGT226 inhibit phosphorylation of Akt
More informationSupplementary methods Shoc2 In Vitro Ubiquitination Assay
Supplementary methods Shoc2 In Vitro Ubiquitination Assay 35 S-labelled Shoc2 was prepared using a TNT quick Coupled transcription/ translation System (Promega) as recommended by manufacturer. For the
More informationSupplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1
Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded
More informationNature Structural and Molecular Biology: doi: /nsmb.2937
Supplementary Figure 1 Multiple sequence alignment of the CtIP N-terminal domain, purified CtIP protein constructs and details of the 2F o F c electron density map of CtIP-NTD. (a) Multiple sequence alignment,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Ono et al., http://www.jcb.org/cgi/content/full/jcb.201208008/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Chromatin-binding properties of MCM2 and condensin II during
More informationSingle cell resolution in vivo imaging of DNA damage following PARP inhibition. Supplementary Data
Single cell resolution in vivo imaging of DNA damage following PARP inhibition Katherine S. Yang, Rainer H. Kohler, Matthieu Landon, Randy Giedt, and Ralph Weissleder Supplementary Data Supplementary Figures
More informationSupplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids.
Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids. The cells were harvested 72 h after transfection. FLAG-tagged deubiquitinases
More informationSupplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy
Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy of various tumor type TRCs, including H22 (murine hepatocarcinoma) and CT26 (murine colon cancer). Bar, 50 µm. b, B16 cells
More informationSUPPLEMENTARY INFORMATION
Figure S1 The effect of T198A mutation on p27 stability. a, Hoechst 33342 staining for nuclei (see Fig 1d). Scale bar, 100 μm. b, Densitometric analysis of wild type and mutant p27 protein levels represented
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3209 Supplementary Figure 1 IR induces the association of FH with chromatin. a, U2OS cells synchronized by thymidine double block (2 mm) underwent no release (G1 phase) or release for 2
More informationSupporting Online Material for
Supporting Online Material for Spatiotemporal dynamics of Aurora B-PLK1-MCAK signaling axis orchestrates kinetochore bi-orientation and faithful chromosome segregation Hengyi Shao, Yuejia Huang, Liangyu
More informationImmunofluorescence images of different core histones and different histone exchange assay.
Molecular Cell, Volume 51 Supplemental Information Enhanced Chromatin Dynamics by FACT Promotes Transcriptional Restart after UV-Induced DNA Damage Christoffel Dinant, Giannis Ampatziadis-Michailidis,
More informationSupplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
More informationSupplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells
Molecular Cell, Volume 68 Supplemental Information Mitophagy Controls the Activities of Tumor Suppressor to Regulate Hepatic Cancer Stem Cells Kai Liu, Jiyoung Lee, Ja Yeon Kim, Linya Wang, Yongjun Tian,
More informationSupplemental Information: Phosphorylation of CLIP-170 by Both Plk1 and CK2 Is Involved in the Timely Formation of Kinetochore-microtubule Attachments
Supplemental Information: Phosphorylation of CLIP-170 by Both Plk1 and CK2 Is Involved in the Timely Formation of Kinetochore-microtubule Attachments Hongchang Li, X. Shawn Liu, Xiaoming Yang, Yingmin
More informationNature Immunology: doi: /ni Supplementary Figure 1. Control experiments for Figure 1.
Supplementary Figure 1 Control experiments for Figure 1. (a) Localization of SETX in untreated or PR8ΔNS1 virus infected A549 cells (4hours). Nuclear (DAPI) and Tubulin staining are shown. SETX antibody
More informationsupplementary information
DOI: 10.1038/ncb2017 Figure S1 53BP1 sirna results in a heterochromatic DSB repair defect. Panel A: NIH3T3 cells were transfected with murine 53BP1 sirna. 48 hrs later, cells were irradiated with 3 Gy
More informationPhenotypic lentivirus screens to identify functional single domain antibodies
ARTICLE NUMBER: 16080 DOI: 10.1038/NMICROBIOL.2016.80 Phenotypic lentivirus screens to identify functional single domain antibodies Florian I. Schmidt, Leo Hanke, Benjamin Morin, Rebeccah Brewer, Vesna
More informationSupplementary Figure 1. Additional RNAi screen data
Supplementary Figure 1. Additional RNAi screen data A. Cisplatin induced ATR autophosphorylation. Western blot illustrating ATR and phospho-atr (T1989) in cells exposed to 1 µm cisplatin for 24 hours prior
More informationSupplementary Figure Legends
Supplementary Figure Legends Figure S1 gene targeting strategy for disruption of chicken gene, related to Figure 1 (f)-(i). (a) The locus and the targeting constructs showing HpaI restriction sites. The
More informationSupplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4
SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase
More informationSUPPLEMENTARY INFORMATION
Figure S1: Activation of the ATM pathway by I-PpoI. A. HEK293T cells were either untransfected, vector transfected, transfected with an I-PpoI expression vector, or subjected to 2Gy γ-irradiation. 24 hrs
More informationSupplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Ricke et al., http://www.jcb.org/cgi/content/full/jcb.201205115/dc1 Figure S1. Kinetochore localization of mitotic regulators in wild-type
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationCircLigase II ssdna Ligase
Cat. Nos. CL9021K and CL9025K www.lucigen.com MA298E-CircLigase II ssdna Ligase 2/2018 1 1. Introduction CircLigase II ssdna Ligase is a thermostable ligase that catalyzes iintramolecular ligation (i.e.,
More informationSupplementary Information
Supplementary Information Fisetin stimulates autophagic degradation of phosphorylated tau via the activation of TFEB and Nrf2 transcription factors Sunhyo Kim 1, Ki Ju Choi 2, Sun-Jung Cho 1, Sang-Moon
More informationJournal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
More informationp53 increases MHC class I expression by upregulating the endoplasmic reticulum aminopeptidase ERAP1
Supplementary Information p53 increases MHC class I expression by upregulating the endoplasmic reticulum aminopeptidase ERAP1 Bei Wang 1, Dandan Niu 1, Liyun Lai 1, & Ee Chee Ren 1,2 1 Singapore Immunology
More informationCell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More informationSupplementary Figure 1: MYCER protein expressed from the transgene can enhance
Relative luciferase activity Relative luciferase activity MYC is a critical target FBXW7 MYC Supplementary is a critical Figures target 1-7. FBXW7 Supplementary Material A E-box sequences 1 2 3 4 5 6 HSV-TK
More informationSupplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the
Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Analyses of ECTRs by C-circle and T-circle assays.
Supplementary Figure 1 Analyses of ECTRs by C-circle and T-circle assays. (a) C-circle and (b) T-circle amplification reactions using genomic DNA from different cell lines in the presence (+) or absence
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology
More informationSupplementary Figure 1
Supplementary Figure 1 Cell cycle distribution (%) 1 8 6 4 2 Cell Cycle G1 S G2 Viability (%) 5 4 3 2 1 Viability Supplementary Figure 1. Cell cycle distribution and viability during DSB repair measurements.
More informationHPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
More informationMultiplex Fluorescence Assays for Adherence Cells without Trypsinization
Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating
More informationWRNIP1 protects stalled forks from degradation and promotes fork restart after replication stress
Article WRNIP1 protects stalled forks from degradation and promotes fork restart after replication stress Giuseppe Leuzzi 1, Veronica Marabitti 1, Pietro Pichierri 2 & Annapaola Franchitto 1,* Abstract
More informationFIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and
Supplementary Figures FIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and mutant (mut) cells. Higher magnification is shown in Figure 1A. Arrows indicate cisplatin-induced
More informationSupplementary Figure 1 a
3 min PMA 45 min PMA AnnexinV-FITC Supplementary Figure 1 5 min PMA 15 min PMA a 9 min PMA 12 min PMA 5 min FGF7 15 min FGF7 3 min FGF7 6 min FGF7 9 min FGF7 12 min FGF7 5 min control 3 min control 6 min
More informationPDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ
PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ Supplementary Material Figure S1. PDIP46 is associated with Pol isolated by immunoaffinity chromatography.
More informationSupplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,
Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for
More informationDescription: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics
More informationNature Immunology: doi: /ni.3015
Supplementary Figure 1 Role of RIP1-RIP3 and PGAM5 in RNA virus induced inflammasome activation. (a) LDH release from LPS-primed BMDMs from wild-type mice (WT), Rip3 -/- or Nlrp3 -/- mice infected with
More informationFigure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO
Figure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO (epoecfc) or LacZ (laczecfc) under control of a cytomegalovirus
More informationSupplementary Figure 1. Adipogenic protein expression in WT and KO MEFs after 7 days of adipogenic differentiation.
Merkestein et al. Supplementary Figure 1 A PLIN WT FTO KO 72 kda FABP4 17 kda HSC70 72 kda B Supplementary Figure 1. Adipogenic protein expression in WT and KO MEFs after 7 days of adipogenic differentiation.
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationSupplementary information
Supplementary information The E3 ligase RNF8 regulates KU80 removal and NHEJ repair Lin Feng 1, Junjie Chen 1 1 Department of Experimental Radiation Oncology, The University of Texas M. D. Anderson Cancer
More informationMeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
More informationA RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1
A H2AX DAPI H2AX DAPI Merge Cont sirna Figure S1: Accumulation of RRM1 at DNA damage sites (A) HeLa cells were subjected to in situ detergent extraction without IR irradiation, and immunostained with the
More informationATR and ATM differently regulate WRN to prevent DSBs at stalled replication forks and promote replication fork recovery
The EMBO Journal (21) 29, 3156 3169 & 21 European Molecular Biology Organization All Rights Reserved 261-4189/1 www.embojournal.org ATR and ATM differently regulate WRN to prevent DSBs at stalled replication
More informationHoffmann et al., http ://www.jcb.org /cgi /content /full /jcb /DC1
Supplemental material JCB Hoffmann et al., http ://www.jcb.org /cgi /content /full /jcb.201506071 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. TRA IP harbors a PCNA-binding PIP box required for its recruitment
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationSUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
More informationFour different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and
SUPPLEMENTARY MATERIALS AND METHODS Chromatin Immunoprecipitation for qpcr analysis Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and IL24, all located on chromosome 1. Primer
More informationSupplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence
More informationGrb2-Mediated Alteration in the Trafficking of AβPP: Insights from Grb2-AICD Interaction
Journal of Alzheimer s Disease 20 (2010) 1 9 1 IOS Press Supplementary Material Grb2-Mediated Alteration in the Trafficking of AβPP: Insights from Grb2-AICD Interaction Mithu Raychaudhuri and Debashis
More informationhnrnp D/AUF1 Rabbit IgG hnrnp M
Mouse IgG Goat IgG Rabbit IgG Mouse IgG hnrnp F Goat IgG Mouse IgG Kb 6 4 3 2 15 5 Supplementary Figure S1. In vivo binding of TERRA-bound RBPs to target RNAs. Immunoprecipitation (IP) assay using 3 mg
More informationSupplementary Figure 1 A green: cytokeratin 8
Supplementary Figure 1 A green: cytokeratin 8 green: α-sma red: α-sma blue: DAPI blue: DAPI Panc-1 Panc-1 Panc-1+hPSC Panc-1+hPSC monoculture coculture B Suppl. Figure 1: A, Immunofluorescence staining
More informationSupplementary Figure 1. Related to Figure 1. Characterization of centrosome fragmentation in mitotically delayed RPE1 cells. (a) Cells transiently
Supplementary Figure 1. Related to Figure 1. Characterization of centrosome fragmentation in mitotically delayed RPE1 cells. (a) Cells transiently transfected with EGFP centrin-2 (Green), synchronized
More informationSupplementary Figure 1. (A) Cell proliferative ability and (B) the invasiveness of
LEGEND FOR SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Cell proliferative ability and (B) the invasiveness of LLC-1, LLC-3, and LLC-5 cell line series were quantified by BrdU assay after 72 h of
More informationPI3 Kinase Assay Kit. Catalog Number KA assays Version: 05. Intended for research use only.
PI3 Kinase Assay Kit Catalog Number KA0904 400 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials Supplied...
More informationSupplementary Figures
Supplementary Figures Wossidlo et al. S1 Supplementary Figure S1 5hmC (clone 63.3) immunostaining on mouse zygotes. a, Representative images of indirect immunostainings using antibodies against 5hmC (clone
More informationSupplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.
Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected
More informationHCT116 SW48 Nutlin: p53
Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates
More informationUniversity of Groningen
University of Groningen Coupling dttp Hydrolysis with DNA Unwinding by the DNA Helicase of Bacteriophage T7 Satapathy, Ajit K.; Kulczyk, Arkadiusz W.; Ghosh, Sharmistha; van Oijen, Antonius; Richardson,
More informationNew origin firing is inhibited by APC/C Cdh1 activation in S-phase after severe replication stress
Nucleic Acids Research Advance Access published March 2, 2016 Nucleic Acids Research, 2016 1 doi: 10.1093/nar/gkw132 New origin firing is inhibited by APC/C Cdh1 activation in S-phase after severe replication
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More informationHomologous recombination (HR) is essential for
Published Online: 7 September, 2009 Supp Info: http://doi.org/10.1083/jcb.200812138 Downloaded from jcb.rupress.org on July 24, 2018 JCB: REPORT Human Fbh1 helicase contributes to genome maintenance via
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Origin use and efficiency are similar among WT, rrm3, pif1-m2, and pif1-m2; rrm3 strains. A. Analysis of fork progression around confirmed and likely origins (from cerevisiae.oridb.org).
More informationSUPPLEMENTAL MATERIAL. Carvajal et al. Supplemental Table 1. List of quantitative PCR primers used for cdna analyses and
UPPLEMEAL MATERIAL Carvajal et al. upplemental Table 1. List of quantitative PCR primers used for cdna analyses and chromatin immunoprecipitation assays. Figure 1. DNA damage-induced transcriptional repression
More informationMulti-Amplified Sensing of MicroRNA by a Small DNA Fragment-Driven Enzymatic Cascade Reaction
Supporting Information for Multi-Amplified Sensing of MicroRNA by a Small DNA Fragment-Driven Enzymatic Cascade Reaction Eunjung Kim, Philip D. Howes, Spencer W. Crowder, and Molly M. Stevens* Department
More information