Aurora Kinase-A Inactivates DNA Damage-Induced
|
|
- Gwen Hutchinson
- 6 years ago
- Views:
Transcription
1 Cancer Cell, Volume 21 Supplemental Information Aurora Kinase-A Inactivates DNA Damage-Induced Apoptosis and Spindle Assembly Checkpoint Response Functions of p73 Hiroshi Katayama, Jin Wang, Warapen Treekitkarnmongkol, Hidehiko Kawai, Kaori Sasai, Hui Zhang, Hua Wang, Henry P. Adams, Shoulei Jiang, Sandip N. Chakraborty, Fumio Suzuki, Ralph B. Arlinghaus, Jinsong Liu, James A. Mobley, William E. Grizzle, Huamin Wang, and Subrata Sen Inventory of Supplemental Information Figure S1, related to Figure 1 Figure S2, related to Figure 3 Figure S3, related to Figure 4 Figure S4, related to Figure 5 Figure S5, related to Figure 7 Supplemental Experimental Procedures 1
2 Supplemental Data A 32 p- Np73 IB: Myc 32 p-aur-a Np73 TAp73 WT SA WT SA 32 p-tap73 IB: HA 32 p-aur-a B Myc- Np73: WT SA SD HA-p73: emp WT SA SD emp WT SA SD emp WT SA SD IB: Myc IP: HA IB: HA IB: Myc C Flag-AurA: HA-p73: IB: HA Direct IB: HA IP: Flag WT SA SD WT SA SD D MCF-10A IP: p73 NIG input IP: Aur-A NIG input E H1299 IP: p73 NIG input IP: Aur-A NIG input 1
3 Figure S1. Interaction between Aurora-A and p73, Related to Figure 1 A. Myc-ΔNp73 WT or Myc-ΔNp73 SA or HA-p73 WT or HA-p73 SA were transfected into Cos-1 cells. 24 hr after transfection, cells were subjected to immunoprecipitation with anti-myc or HA antibodies and immunoprecipitates were incubated with His-Aurora-A in the presence of [ 32P]- ATP. The reaction mixtures were subjected to immunoblotting with antibodies against Myc for Myc-ΔNp73, HA for HA-p73 and Aurora-A for His-Aurora-A (second and fourth) followed by [ 32 P]ATP incorporation visualized by autoradiography (top and third). B. Myc-ΔNp73 WT or mutants were co-transfected with either HA-p73 WT or mutants into Cos-1 cells. 24hr after transfection, cells were subjected to immunoprecipitation with anti-ha antibody followed by immunoblotting with the indicated antibodies (top and second). Expression level of Myc-ΔNp73 WT or mutants were analyzed by direct immunoblotting with anti-myc antibody (bottom). C. Empty vector or Flag-Aurora-A WT was co-transfected with HA-p73 WT, SA or SD into 293T cells. 24hr after transfection, cells were subjected to immunoprecipitation with anti-flag antibody followed by immunoblotting with the indicated antibodies. D. MCF-10A cells were immunoprecipitated with anti-p73 (left) or anti-aurora-a (right) antibodies or normal IgG (NIG). Immunoprecipitates were subjected to immunoblotting with anti-p73 and anti-aurora-a antibodies, respectively. Input indicates whole cell extracts. E. H1299 cells were analyzed as in (D). 2
4 A p53-wt p53-sd LMB: IB: GFP IB: -tub IB: PARP B interphase mitotic C interphase Noc treated IB: -tub IB: cycb IB: PARP IB: -actin Figure S2. Subcellular localization of p53 and p73 in the cells, Related to Figure 3 A. GFP-p53 WT or S215D mutant was transfected in H1299 cells. 24hr after transfection, cells were cultured in the presence (+) or absence (-) of leptomycin B for 6hr and then subjected to fractionation followed by immunoblotting with the indicated antibodies. B. MCF-7 cells were treated with nocodazole for 24 hr and then interphase cells and mitotic cells were separated by mechanical shake off. Cells were subjected to immunoblotting with the indicated antibodies. C. Cells prepared as in (B) were subjected to fractionations followed by immunoblotting with indicated antibodies. lear fraction in nocodazole treated cells (show in the panel with dotted line) expected to represent G2 phase cells prior to nuclear envelope breakdown. 3
5 A (kda) well C IB: GFP Direct IB: GFP D 24hr 48hr emp WT KDemp WT KD IB: mortalin IB: -actin emp Full del-bd emp Full del-bd WT SD WT SD B IP: Flag Flag-Mot: Full del-bd GFP-p73-mortalin complex GFP-p53: WT SD WT SD GFP-p73 tetramer GFP-p73 monomer IB: GFP IB: mortalin IP: p73 Input Figure S3. Interaction between p73 and mortalin, Related to Figure 4 A. GFP-p73a WT or SD were transfected in Hela cells and cell extracts were subjected to native gel electrophoresis followed by immunoblotting with anti-gfp antibody (left) and anti-mortalin antibody (right). B. Full length Flag-mortalin (Full) or p53 binding domain deletion mutant of Flag-mortalin (del-bd) were co-transfected with GFP-p53 WT or with SD into cells. 24 hr after transfection, cells were subjected to immunoprecipitation with anti-flag antibody followed by immunoblotting with anti- GFP (top) and anti-flag (bottom) antibodies, respectively. Whole cell extracts were directly immunoblotted with anti-gfp antibody (middle). C. Empty vector (emp) or Flag mortalin full (Full) or deletion mutant (del-bd) were transfected into cells for 24 hr. Cell extracts were then subjected to immunoprecipitation with anti-p73 antibody followed by immunoblotting with the indicated antibodies. Whole cell extracts (Input) were also directly immunoblotted. D. Empty vector or Flag-Aurora-A WT or Flag-Aurora-A KD were transfected into cells for 24hr. Cell extracts were then subjected to immunoblotting with the indicated antibodies. 4
6 empty Flag-mot delta-bd IB: -tub IB: PARP Figure S4. Subcellular localization of Aurora-A in mortalin deletion mutant cells, Related to Figure 5 Panc-1 cells were transfected with empty vector or Flag-mortalin deletion mutant (Flag-mot del-bd). 24 hr after transfection, cells were subjected to protein fractionations followed by immunoblotting with the indicated antibodies. Arrow indicates Aurora-A. 5
7 A sirna-p73 B prophase metaphase ana/telophase IB: Cyc B IB: ß-actin IP: p73 IB: ppka paur-a Aur-A Direct IB: CycB Hsp90 Figure S5. The role of p73 in mitosis, Related to Figure 7 A. Hela/GFP-H2B cells were transfected with control or with p73 sirna for 48 hr and then grown in the presence of nocodazole for 18 hr. Then cells were subjected to immunoblotting with the indicated antibodies. B. MCF-10A cells were synchronized by double thymidine block and release method. The cells synchronized at G1/S boundary after second thymidine block were released in fresh culture media. 5 hr after release, monastrol (200mM) was added. At 9 hr after release, monastrol arrested prophase cells were collected by shake-off. For metaphase cells, shaken off were washed with warm PBS 3 times and cultured in media containing MG132 (20mM). 2 hr later, MG132 arrested metaphase cells were collected. Anaphase/telophase cells were collected 1.5 hr after MG132 arrested cells were washed and cultured in fresh media. The cells were subjected to immunoprecipitation with anti-p73 antibody followed by immunoblotting with the indicated antibodies (top and second). Whole cell extracts were also directly immunoblotted. 6
8 Supplemental Experimental Procedures Plasmids pegfp-tap73, pgl3-luc, pgl3-p21-luc, and pgl3-mdm2-luc vectors were kindly provided by Dr. Zhimin Yuan. HA-TAp73 and Myc- Np73 were kindly provided by Dr. Elsa Flores. pegfp- and pcdna3-flag-mortalin and mortalin deletion mutant of p53 binding domain (Mot delta-p53bd) were kindly provided by Dr. Kenji Fukasawa (Ma et al., 2006). S235A and S235D mutations were generated by using Quik mutagenesis kit (Stratagene) and mutations were confirmed by sequencing. p73 cdnas were subcloned into pgex4t vector to produce GST fusion protein and into pmcherry vector (kindly provided by Dr. Richard Behringer) for time-lapse microscopic analysis. Antibodies and chemicals Antibodies used in this study were rabbit polyclonal anti-aurora-a (Zhou et al., 1998, Genetax), mouse monoclonal anti-aurora-a (BD Biosciences), anti-p73 (IMG-246, IMGENEX), anti-p73 (Ab-4, NeoMarker), anti-p73 (S-20), anti- -actin, anti-cdc20, anti-cyclin B1, anti-gfp anti-ha, anti-hsp90, anti-mad2, anti-mortalin, control IgG (Santa Cruz Biotechnology), anti-p21, anti-parp, anti-phospho- PKA substrate, anti-phosphothreonine-288 Aurora-A (Cell Signaling Biotechnology), anti-bubr1 (MBL International), anti-mad2 (Covance Research Products), and anti-α-tubulin (EMD Biosciences). The specificities of anti-p73 antibodies against TA-p73 have been described (Sayan et al., 2005, Rosenbluth et al., 2009). Chemicals used in this study were Aurora-A inhibitor MLN8054 (Millennium Pharmaceuticals), cisplatin (Teva Parenteral Medicines), MG132 (A.G. Scientific), monastrol, and nocodazol (Sigma). Cell culture Cos-1, Hela, GFP-H2B stably expressing HeLa, H1299, MCF-7, and 293T cells were maintained in DMEM with 10% FBS and antibiotics. McCoy5A or DMEM/F-12 with the same supplements was used for Saos-2 cells or Panc-1 cells, respectively. GST- fusion protein GST fusion protein production and purification were performed as described earlier (Katayama et al., 2001). Native gel electrophoresis WT or mutant p73 transfected cells were lysed in native page sample buffer (Invitrogen) containing 1% n- dodecyl-β-d-maltoside and 1% Triton X-100. Cell extracts were subjected to native gel electrophoresis, followed by immunoblotting according to the manufacturer s protocol (Invitrogen). Immunohistochemical staining To retrieve antigenicity, we treated tissue sections at 100ºC in a steamer containing 10 mmol citrate buffer (ph 6.0) for 60 min. The sections were immersed in methanol containing 0.3% hydrogen peroxidase for 20 min to block endogenous peroxidase activity and incubated in 2.5% blocking serum to reduce nonspecific binding. The sections were incubated with antibodies against Aurora A (Genetax, 1:200 dilution), p53 (DAKO DO-7, 1:100 dilution), and p73 (IMG-246, 1:100 dilution) at 4 C overnight, washed, and incubated with secondary antibody at R.T. for 60 min. Standard avidin-biotin immunohistochemical analysis of the sections was performed according to the manufacturer s recommendations (Vector Laboratories). The staining results were evaluated by two pathologists (H.W. for MD Anderson samples and W.E.G. for UABCC samples) on the basis of the percentage of positive tumor cells (0, <5%; 1, 5%-20%; 2, 20%-50%; and 3, >50%) and staining intensity (0-negative, 1-weak, 2-moderate, and 3-strong). For the statistical analysis, Aurora-A and p73 expression levels were categorized as low (combined score 3) or high (combined score 4). 7
9 Supplemental References Katayama, H., Zhou, H., Li, Q., Tatsuka, M., and Sen, S. (2001). Interaction and feedback regulation between STK15/BTAK/Aurora-A kinase and protein phosphatase 1 through mitotic cell division cycle. J Biol. Chem. 276, Rosenbluth, J.M., Johnson, K., Tang, L., Triplett, T., and Pietenpol, J.A. (2009). Evaluation of p63 and p73 antibodies for cross-reactivity. Cell Cycle. 8, Sayan, A.E., Paradisi, A., Vojtesek, B., Knight, R.A., Melino, G., Candi, E. (2005). New antibodies recognizing p73: comparison with commercial antibodies. Biochem. Biophys. Res. Commun. 330,
Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationSupplemental Information
Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
More informationSupplemental Information: Phosphorylation of CLIP-170 by Both Plk1 and CK2 Is Involved in the Timely Formation of Kinetochore-microtubule Attachments
Supplemental Information: Phosphorylation of CLIP-170 by Both Plk1 and CK2 Is Involved in the Timely Formation of Kinetochore-microtubule Attachments Hongchang Li, X. Shawn Liu, Xiaoming Yang, Yingmin
More informationSupporting Online Material for
Supporting Online Material for Spatiotemporal dynamics of Aurora B-PLK1-MCAK signaling axis orchestrates kinetochore bi-orientation and faithful chromosome segregation Hengyi Shao, Yuejia Huang, Liangyu
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified
More informationSupplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after
Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for
More informationSupplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2
Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More informationSupporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
More informationThe Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
More informationSarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
More informationSupplementary Materials
Supplementary Materials Supplementary Figure 1. PKM2 interacts with MLC2 in cytokinesis. a, U87, U87/EGFRvIII, and HeLa cells in cytokinesis were immunostained with DAPI and an anti-pkm2 antibody. Thirty
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology
More informationSupplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.
Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Ono et al., http://www.jcb.org/cgi/content/full/jcb.201208008/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Chromatin-binding properties of MCM2 and condensin II during
More informationNature Structural & Molecular Biology: doi: /nsmb.1583
Acetylation by GCN5 regulates CDC6 phosphorylation in the S-phase of the cell cycle Roberta Paolinelli 1,2, Ramiro Mendoza-Maldonado 2, Anna Cereseto 1 and Mauro Giacca 2 1 Molecular Biology Laboratory,
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationSupplementary methods
Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into
More informationsupplementary information
DOI: 10.1038/ncb2172 Figure S1 p53 regulates cellular NADPH and lipid levels via inhibition of G6PD. (a) U2OS cells stably expressing p53 shrna or a control shrna were transfected with control sirna or
More informationUSP19 modulates autophagy and antiviral immune responses by. deubiquitinating Beclin-1
USP19 modulates autophagy and antiviral immune responses by deubiquitinating Beclin-1 Shouheng Jin 1,2,, Shuo Tian 1,, Yamei Chen 1,, Chuanxia Zhang 1,2, Weihong Xie, 1 Xiaojun Xia 3,4, Jun Cui 1,3* &
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More informationSupporting Information
Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased
More informationSupplemental Materials and Methods
Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled
More informationHPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationSupplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1
Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded
More informationMannen et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB Mannen et al., http ://www.jcb.org /cgi /content /full /jcb.201601024 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Characterization of SNB components. (A) SNB localization of Venus-tagged
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationSUPPLEMENTARY INFORMATION
The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were
More informationB. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.
A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationSupplementary Information (Aoki, K. et al., "Chromosomal instability by β-catenin/tcf transcription in APC or β-catenin mutant cells")
Supplementary Information (Aoki, K. et al., "Chromosomal instability by β-catenin/tcf transcription in APC or β-catenin mutant cells") Supplementary materials and methods ES cells and Mice The floxed β-catenin
More informationtranscription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,
Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected
More informationSupporting Information (Pabla et al.)
Supporting Information (Pabla et al.) Materials and Methods Antibodies and Immunoblot Analysis. The following antibodies were used for initial immunoblot analysis of Chk1: anti-n-terminus Chk1 (Epitomics-E250),
More informationColeman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
More informationFor Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab
Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab CODE No. M200-3 CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 1F2 Mouse IgG1 100 L,
More informationSupporting Information
Supporting Information Krieg et al. 10.1073/pnas.0907131106 SI Text Reagents. Recombinant human TNF- was from Peprotech. Monoclonal rat anti-rip2 was purchased from Alexis, whereas monoclonal mouse anti-xiap
More informationFlag-Rac Vector V12 V12 N17 C40. Vector C40 pakt (T308) Akt1. Myc-DN-PAK1 (N-SP)
a b FlagRac FlagRac V2 V2 N7 C4 V2 V2 N7 C4 p (T38) p (S99, S24) p Flag (Rac) NIH 3T3 COS c +Serum p (T38) MycDN (NSP) Mycp27 3 6 2 3 6 2 3 6 2 min p Myc ( or p27) Figure S (a) Effects of Rac mutants on
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationSupplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
More informationCheckpoint Kinase Activity Immunoblot Kit
Product Manual Checkpoint Kinase Activity Immunoblot Kit Catalog Number STA- 413 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cdc25C is a protein phosphatase responsible
More information8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and
1 Supplemental information 2 3 Materials and Methods 4 Reagents and animals 5 8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 6 Silencer Select Pre-designed sirna
More informationSupplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface.
Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface. (a) Human PDAC cell lines were treated as indicated in Figure 1 panel F. Cells were analyzed for FITC-rBAG3 binding
More informationWe performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma. cell lines and melanocytic tumors from RET-mice in accordance with the method
Supplementary Material and Methods Quantitative RT-PCR (qrt-pcr) We performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma cell lines and melanocytic tumors from RET-mice in accordance with
More informationRegulation of autophagic activity by ζ proteins associated with class III. phosphatidylinositol-3 kinase. Mercedes Pozuelo Rubio
ONLINE SUPPORTING INFORMATION Regulation of autophagic activity by 14-3-3ζ proteins associated with class III phosphatidylinositol-3 kinase Mercedes Pozuelo Rubio entro Andaluz de Biología Molecular y
More informationPrimers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al,
Supplementary METHODS Flow Cytometry (FACS) For FACS analysis, trypsinized cells were fixed in ethanol, rehydrated in PBS and treated with 40μg/ml propidium iodide and 10μ/ml RNase for 30 min at room temperature.
More informationOnline Supplementary Information
Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan
More informationFor Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab
Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab CODE No. M200-3 CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 1F2 Mouse IgG1 κ 100 µl,
More informationONE-HOUR Western TM Multiplex Kit II
ONE-HOUR Western TM Multiplex Kit II Technical Manual No. 0256 Version 06192009 I Description... 1 II Kit Contents.. 2 III Related Products 2 IV Key Features. 2 V Storage... 2 VI ONE-HOUR Multiplex Western
More informationDescription: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationAnti-HB-EGF (Human) mab
Page 1 For Research Use Only. Not for use in diagnostic procedures. CODE No. D308-3 Anti-HB-EGF (Human) mab CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 3H4 Mouse IgG1
More informationSUPPLEMENTARY MATERIALS AND METHODS
SUPPLEMENTARY MATERIALS AND METHODS Chemicals. All chemicals used in supplementary experiments were the same as in the manuscript except the following. Methyl-methanesulfonate (MMS) was from Fluka. NU1025
More informationSupplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
More informationSupplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationTable S1. Alteration of ZNF322A and FBXW7 protein expression levels in relation to clinicopathological parameters in 135 lung cancer patients.
SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A and FBXW7 protein expression levels in relation to clinicopathological parameters in 135 lung cancer patients. ZNF322A Normal Overexpression expression
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationSupplementary Figures 1-12
Supplementary Figures 1-12 Supplementary Figure 1. The specificity of anti-abi1 antibody. Total Proteins extracted from the wild type seedlings or abi1-3 null mutant seedlings were used for immunoblotting
More informationThanasoula et al. - Fig. S1
S HK1si G1 Thanasoula et al. - Fig. S1 G2/M HK2si 1 3 5 7 9 11 13 hours after double thymidine block release Figure S1. U2OS synchronous cell cycle progression. U2OS cells transfected with, POT1, HK1,
More informationTranscriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3
ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated
More informationSupplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17
Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,
More informationsupplementary information
DOI: 10.1038/ncb1862 Figure S1 Identification of SCAI as a Dia1 associating factor. (a) Identification of SCAI (Riken cdna 930041I02) as a Dia1-FH3 interacting protein. Mouse brain lysate was incubated
More informationSupplemental Material
Supplemental Material 1 Figure S1. Phylogenetic analysis of Cep72 and Lrrc36, comparative localization of Cep72 and Lrrc36 and Cep72 antibody characterization (A) Phylogenetic alignment of Cep72 and Lrrc36
More informationPhosphorylation of CLIP-170 by Plk1 and CK2 promotes timely formation of kinetochore microtubule attachments
The EMBO Journal (2010) 29, 2953 2965 & 2010 European Molecular Biology Organization All Rights Reserved 0261-4189/10 www.embojournal.org Phosphorylation of CLIP-170 by Plk1 and CK2 promotes timely formation
More informationb alternative classical none
Supplementary Figure. 1: Related to Figure.1 a d e b alternative classical none NIK P-IkBa Total IkBa Tubulin P52 (Lighter) P52 (Darker) RelB (Lighter) RelB (Darker) HDAC1 Control-Sh RelB-Sh NF-kB2-Sh
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3363 Supplementary Figure 1 Several WNTs bind to the extracellular domains of PKD1. (a) HEK293T cells were co-transfected with indicated plasmids. Flag-tagged proteins were immunoprecipiated
More informationVERIFY Tagged Antigen. Validation Data
VERIFY Tagged Antigen Validation Data Antibody Validation Figure 1. Over-expression cell lysate for human STAT3 (NM_139276) was used to test 3 commercial antibodies. Antibody A shows strong antigen binding.
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationSUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
More informationFig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
More informationHistone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # C Component Size Shipping Temperature
Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3K4D Histone H3K4me2 (H3K4 Dimethyl) Polyclonal Antibody
More informationSupplementary Figure 1. Localization of truncated Borealin co-transfected with Borealin shrna.
Supplementary Figure 1. Localization of truncated Borealin co-transfected with Borealin shrna. HeLa M cells were transfected with empty psuper or a vector producing a shrna targetingg the 3 UTR (missing
More informationDescription of supplementary material file
Description of supplementary material file In the supplementary results we show that the VHL-fibronectin interaction is indirect, mediated by fibronectin binding to COL4A2. This provides additional information
More informationHeLa cells, HeLa cells stably expressing ss-hrp, HeLa cells stably expressing
Supplementary Materials and methods Cell culture and transfection HeLa cells, HeLa cells stably expressing ss-hrp, HeLa cells stably expressing ManII-GFP, and HEK 293T cells were grown in complete medium
More informationFigure S1. Verification of ihog Mutation by Protein Immunoblotting Figure S2. Verification of ihog and boi
Figure S1. Verification of ihog Mutation by Protein Immunoblotting Extracts from S2R+ cells, embryos, and adults were analyzed by immunoprecipitation and immunoblotting with anti-ihog antibody. The Ihog
More informationDLD1 * cl OD 570nm. OD 570nm NEAA
Figure S A. ATF4 mrna levels.2.8.6.4.2 HT8 shatf4- cl3 shatf4- cl4 ATF4 mrna levels.2.8.6.4.2 DLD shatf4-cl3 B. C. OD 57nm.7.6.5.4.3 shatf4 cl3 shatf4 cl4 OD 57nm.6.5.4.3.2.2. 2 4 6 day.. NEAA - + - +
More informationFigure S1, related to Figure 1. Characterization of biosensor behavior in vivo.
Developmental Cell, Volume 23 Supplemental Information Separase Biosensor Reveals that Cohesin Cleavage Timing Depends on Phosphatase PP2A Cdc55 Regulation Gilad Yaakov, Kurt Thorn, and David O. Morgan
More informationRecombinant adenoviruses. A TRB3-expressing adenovirus was generated through
Materials and Methods Recombinant adenoviruses. A -expressing adenovirus was generated through homologous recombination between a linearized transfer vector pad-track and the adenoviral backbone vector
More informationmonoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in
Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal
More informationSupplementary Fig.1 Luton
Supplementary Fig.1 Luton a 175 Brain Thymus Spleen Small Intestine Kidney Testis HeLa b 250 Lung Kidney MDCK c EFA6B si Control si Mismatch #637 #1564 #1770 83 62 47.5 175 IB: anti-efa6b #B1 130 66 Lysates
More informationPHF20 is an effector protein of p53 double lysine methylation
SUPPLEMENTARY INFORMATION PHF20 is an effector protein of p53 double lysine methylation that stabilizes and activates p53 Gaofeng Cui 1, Sungman Park 2, Aimee I Badeaux 3, Donghwa Kim 2, Joseph Lee 1,
More informationMCF10A cells were trypsinized and attached onto fibronectin-coated petri dishes
Supplemental Information Supplemental figure legends Figure S. Supplemental figure for Fig... Different methods of cell detachment similarly induce YP phosphorylation. MCF0 cells were trypsinized and attached
More informationRegulation of transcription by the MLL2 complex and MLL complex-associated AKAP95
Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:
More informationHistone H3K27 Methylation Antibody Panel Pack Base Catalog # C Component Size Shipping Temperature
Histone H3K27 Methylation Antibody Panel Pack Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3K27M Histone H3K27me1 (H3K27 Monomethyl) Polyclonal Antibody 25 µg
More informationCdc42 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay
More informationXiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai
Cell, Volume 135 Supplemental Data Hypothalamic IKKβ/NF-κB and ER Stress Link Overnutrition to Energy Imbalance and Obesity Xiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2271 Supplementary Figure a! WM266.4 mock WM266.4 #7 sirna WM266.4 #10 sirna SKMEL28 mock SKMEL28 #7 sirna SKMEL28 #10 sirna WM1361 mock WM1361 #7 sirna WM1361 #10 sirna 9 WM266. WM136
More informationPolyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous
Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled
More informationDDA3 associates with microtubule plus ends and orchestrates microtubule dynamics and directional cell migration
DDA3 associates with microtubule plus ends and orchestrates microtubule dynamics and directional cell migration Liangyu Zhang 1,2,4, Hengyi Shao 1,4, Tongge Zhu, Peng Xia 1, Zhikai Wang 1,2, Lifang Liu
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection
More informationIKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
More informationFirefly luciferase mutants as sensors of proteome stress
Nature Methods Firefly luciferase mutants as sensors of proteome stress Rajat Gupta, Prasad Kasturi, Andreas Bracher, Christian Loew, Min Zheng, Adriana Villella, Dan Garza, F Ulrich Hartl & Swasti Raychaudhuri
More informationEstradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway
Estradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway Pelin Yaşar, Gamze Ayaz and Mesut Muyan SUPPLEMENTARY INFORMATION
More information96-well Checkpoint Kinase Activity Assay Kit
Product Manual 96-well Checkpoint Kinase Activity Assay Kit Catalog Number STA-414 STA-414-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cdc25C is a
More informationFor Research Use Only. Not for use in diagnostic procedures.
Printed December 13, 2011 Version 1.0 For Research Use Only. Not for use in diagnostic procedures. DDDDK-tagged Protein PURIFICATION GEL with Elution Peptide (MoAb. clone FLA-1) CODE No. 3326 / 3327 PURIFICATION
More informationPI Supplementary Figure-1. (kda) 200. In gel H1 kinase assay. Silver staining. rck2α. hck2α. dck2α
A (kda) 200 PI 4.5 5.1 7.0 In gel H1 kinase assay 116 97 66 45 Silver staining B rck2α hck2α dck2α Supplementary Figure-1 S 1. Circadian periodically fluctuating kinase, p45 PFK is CK2α. A) The 2D-gel
More informationSupplemental data. Supplemental Materials and Methods
Supplemental data Supplemental Materials and Methods Transfection of plasmid. Transfection of plasmids into FRTL5 cells was performed using Lipofectamine LTX with Plus reagent (Invitrogen) according to
More information