SUPPLEMENTARY INFORMATION. Integrin alpha 11 in regulation of myofibroblasts phenotype: Implication for fibrotic diseases

Integrin alpha 11 in the regulation. of the myofibroblast phenotype: implications for fibrotic diseases.

Integrin alpha 11 in the regulation of the myofibroblast phenotype: implications for fibrotic diseases The Harvard community has made this article openly available. Please share how this access benefits

Supplemental Tables Supplemental Table 1. Phenotypic profile of different HSC lines. Marker d0 mhsc d7 mhsc 8B LX2 CD11b 3.61% 2.21% 2.16% 3.77% F4/80 4.54% 2.05% 0.127% 1.44% Elastin 3.90% 2.95% 4.23%

Resveratrol inhibits epithelial-mesenchymal transition of retinal. pigment epithelium and development of proliferative vitreoretinopathy

Resveratrol inhibits epithelial-mesenchymal transition of retinal pigment epithelium and development of proliferative vitreoretinopathy Keijiro Ishikawa, 1,2 Shikun He, 2, 3 Hiroto Terasaki, 1 Hossein

0.9 5 H M L E R -C tr l in T w is t1 C M

a. b. c. d. e. f. g. h. 2.5 C elltiter-g lo A ssay 1.1 5 M T S a s s a y Lum inescence (A.U.) 2.0 1.5 1.0 0.5 n s H M L E R -C tr l in C tr l C M H M L E R -C tr l in S n a il1 C M A bsorbance (@ 490nm

Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number

Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Stock Concentration Final concentration Volume used Advanced DMEM/F12 Invitrogen 12634010-78%

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of NSCs from hpscs in SDC medium.

Supplementary Figure 1 Generation of NSCs from hpscs in SDC medium. (a) Q-PCR of pluripotent markers (OCT4, NANOG), neural markers (SOX1, PAX6, N-Cadherin), markers for the other germ layers (T, EOMES,

Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy

Supplementary Material Levels of protein drive the reparative process in acute muscle injury and muscular dystrophy Francesca Riuzzi 1,4 *, Sara Beccafico 1,4 *, Roberta Sagheddu 1,4, Sara Chiappalupi

A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity

A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity Peng Li 1,2, Fang Du 1, Larra W. Yuelling 1, Tiffany Lin 3, Renata E. Muradimova 1, Rossella Tricarico

SUPPLEMENTARY INFORMATION

VOLUME: 1 ARTICLE NUMBER: 0011 In the format provided by the authors and unedited. In situ Activation of Platelets with Checkpoint Inhibitors for Post-Surgical Cancer Immunotherapy Chao Wang 1, 2, Wujin

Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites

Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells in the injured sites Yunyuan Li, Reza Baradar Jalili, Aziz Ghahary Department of Surgery, University of British Columbia,

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and

Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For

Supplementary Information for Transient and Local Expression of Chemokine and Immune Checkpoint Traps to Treat Pancreatic Cancer

Supplementary Information for Transient and Local Expression of Chemokine and Immune Checkpoint Traps to Treat Pancreatic Cancer Lei Miao 1, Jingjing Li 2, Qi Liu 1,4, Richard Feng 2, Manisit Das 1, C.

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans

Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,

Online Supporting Material for. The Bisecting GlcNAc on N-Glycans Inhibits Growth. Factor Signaling and Retards Mammary Tumor

Online Supporting Material for The Bisecting GlcNAc on N-Glycans Inhibits Growth Factor Signaling and Retards Mammary Tumor Progression Yinghui Song 1, Jason A. Aglipay 1, Joshua D. Bernstein 2, Sumanta

Figure S1. Specificity of immunofluorescence staining in STC-1 cells. STC-1 cells

Supplementary Figures and Tables Figure S1. Figure S1. Specificity of immunofluorescence staining in STC-1 cells. STC-1 cells were treated with donkey-anti rabbit antibody conjugated with Dylight488 or

Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by

Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by down-regulating PKA and CREB activation Sudha Saryu Malhotra 1, Pankaj Suman 2 and Satish Kumar Gupta 1 * 1 Reproductive

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1. Functional assays of hepatocyte-like cells induced from H1 hescs (a) P450 and AAT staining, PAS staining, LDL uptake assay, and ICG uptake and release assay

a KYSE270-CON KYSE270-Id1

a KYSE27-CON KYSE27- shcon shcon sh b Human Mouse CD31 Relative MVD 3.5 3 2.5 2 1.5 1.5 *** *** c KYSE15 KYSE27 sirna (nm) 5 1 Id2 Id2 sirna 5 1 sirna (nm) 5 1 Id2 sirna 5 1 Id2 [h] (pg per ml) d 3 2 1

CD1a-autoreactive T cells are a normal component of the human αβ T cell repertoire

CDa-autoreactive T cells are a normal component of the human αβ T cell repertoire Annemieke de Jong, Victor Peña-Cruz, Tan-Yun Cheng, Rachael A. Clark, Ildiko Van Rhijn,, D. Branch Moody Division of Rheumatology,

Table S1. List of antibodies used including isotype controls, biotinylated. secondaries, and fluorophore conjugated tertiary antibodies.

Table S1. List of antibodies used including isotype controls, biotinylated secondaries, and fluorophore conjugated tertiary antibodies. Antibody Description Distributor Catalogue number Working Concentration

Title. CitationThe Journal of clinical investigation, 124(5): Issue Date Doc URL. Type. Additional There Information

Title Laminins affect T cell trafficking and allograft fat Author(s)Warren, Kristi J.; Iwami, Daiki; Harris, Donald G.; CitationThe Journal of clinical investigation, 124(): 224- Issue Date 214--1 Doc

immunofluorescence. Name of antibodies Manufacturer Catalog Number Rabbit anti-pdyn Rabbit anti-kor-1

Supplemental Tables Table S1. List of primary antibodies used for immunohistochemistry, FACS, and immunofluorescence. Name of antibodies Manufacturer Catalog Number Rabbit anti-pdyn Bioss USA bs-13041r

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis

Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding

Developmental Reprogramming in Mesenchymal Stromal Cells of Human Subjects with Idiopathic Pulmonary Fibrosis

Developmental Reprogramming in Mesenchymal Stromal Cells of Human Subjects with Idiopathic Pulmonary Fibrosis Diptiman Chanda 1*, Ashish Kurundkar 1, Sunad Rangarajan 1, Morgan Locy 1, Karen Bernard 1,

Supplementary Figures

Supplementary Figures Fig. S1. Specificity of perilipin antibody in SAT compared to various organs. (A) Images of SAT at E18.5 stained with perilipin and CD31 antibody. Scale bars: 100 μm. SAT stained

Supplementary Figure 1. Effect of FRC-specific ablation of Myd88 on PP and mln organization.

Supplementary Figure 1 Effect of FRC-specific ablation of Myd88 on PP and mln organization. (a) PP numbers in 8 10 week old Cre-negative littermate (Ctrl) and Myd88-cKO mice (n = 11 mice; each dot represents

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene

Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated

Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)

Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1

Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were

Tgfb1 ACTGATACGCCTGAGTGGCT CCCTGTATTCCGTCTCCTTG. Supplemental data. Supplemental Table 1: Sequences of qpcr primers

Supplemental data Supplemental Table 1: Sequences of qpcr primers Gene Forward primer Reverse primer B2m GTGACCCTGGTCTTTCTGGT GTATGTTCGGCTTCCCATTC Ppl TTGAGACAGCAACCAGAAGC TTCAGGGTCTGGATTTCCTC Evpl TGCTTCACCACCATGTTCAA

Supplementary Information

Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on

Isolation, culture, and transfection of primary mammary epithelial organoids

Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

A Simple Method for 3D Analysis of Immunolabeled Axonal Tracts in a Transparent Nervous System

Cell Reports, Volume 9 Supplemental Information A Simple Method for 3D Analysis of Immunolabeled Axonal Tracts in a Transparent Nervous System Morgane Belle, David Godefroy, Chloé Dominici, Céline Heitz-Marchaland,

SUPPLEMENTARY FIG. S9. Morphology and DNA staining of cipsc-differentiated trophoblast cell-like cell. Scale bar: 100 mm. SUPPLEMENTARY FIG. S10.

Supplementary Data SUPPLEMENTARY FIG. S1. Lentivirus-infected canine fibroblasts show YFP expression. (A, B) Uninfected canine skin fibroblasts (CSFs); (C, D) infected CSFs; (E, F) uninfected CTFs; (G,

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα

We performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma. cell lines and melanocytic tumors from RET-mice in accordance with the method

Supplementary Material and Methods Quantitative RT-PCR (qrt-pcr) We performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma cell lines and melanocytic tumors from RET-mice in accordance with

Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs.

kda 65 45 45 35 Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs. H9 hescs were differentiated with or without BMP4+BMP8A and cell lysates were collected for Western analysis

WT Day 90 after injections

Supplementary Figure 1 a Day 1 after injections Day 9 after injections Klf5 +/- Day 1 after injections Klf5 +/- Day 9 after injections BLM PBS b Day 1 after injections Dermal thickness (μm) 3 1 Day 9 after

somatic transition to was evident into airways in the

Supplementary Fig. 1. A. Activation of an oncogenic K-Ras allele by recombination in somatic cells leads to spontaneous lung cancer in LA1 mice (ref. 20). In this mouse model, subpleural precancerous adenomas

Supplementary Figures

Supplementary Figures Supplementary Figure 1. Effect of timing of DE dissociation and RA concentration on lung field specification in hpscs. (a) Effect of duration of endoderm induction on expression of

Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer

SUPPLEMENTAL METHODS Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer For Celigo experiments, 0.1 ml containing 5 x 10 4 cells was seeded into 96 well plates for 30 min

Yoshida et al. Extra-hepatic PDGFB, Delivered by Platelets, Promotes Activation of Hepatic Stellate Cells and Biliary Fibrosis in Mice

Yoshida et al. Extra-hepatic PDGFB, Delivered by Platelets, Promotes Activation of Hepatic Stellate Cells and Biliary Fibrosis in Mice SUPPLEMENTARY MATERIAL PDGF receptor β is upregulated across experimental

Vandetanib was kindly provided by AstraZeneca (Macclesfield, United Kingdom).

Supplemental Experimental Procedures Reagents Vandetanib was kindly provided by AstraZeneca (Macclesfield, United Kingdom). Erlotinib and BV were both obtained from the institutional pharmacy. For in vivo

MiR-150 promotes cellular metastasis in non-small cell lung cancer by targeting

MiR-150 promotes cellular metastasis in non-small cell lung cancer by targeting FOXO4 Hui Li 1, #, Ruoyun Ouyang 2, #, Zi Wang 1, #, Weihua Zhou 1, Huiyong Chen 1, Yawen Jiang 1, Yibin Zhang 1, Hui Li

Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney

1 Supplementary text and data for: 2 3 4 5 Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney Authors: David A. D. Munro 1*, Peter Hohenstein 2, and Jamie A.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/NMAT3777 Biophysical regulation of epigenetic state and cell reprogramming Authors: Timothy L. Downing 1,2, Jennifer Soto 1,2, Constant Morez 2,3,, Timothee Houssin

bronchial epithelial cells (I). Bronchi are outlined with dashed line. Scale bars = 25 µm, if not

Supplemental Figure S1: ronchial epithelial cell polarity and integrity is maintained in bronchi. (A-E) Staining for selected markers of bronchial cell differentiation and intracellular compartments is

Firefly luciferase mutants as sensors of proteome stress

Nature Methods Firefly luciferase mutants as sensors of proteome stress Rajat Gupta, Prasad Kasturi, Andreas Bracher, Christian Loew, Min Zheng, Adriana Villella, Dan Garza, F Ulrich Hartl & Swasti Raychaudhuri

Figure legend. The expression of BAFF and its receptors in macrophages was detected at lesion areas of atherosclerosis and arthritis.

Data supplement #1 Figure legend. The expression of BAFF and its receptors in macrophages was detected at lesion areas of atherosclerosis and arthritis. A. Consecutive sections of an atherosclerotic plaque

AIP1 functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis

SUPPLEMENTAL MATERIALS functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis Haifeng Zhang 1*, Yun He 1*, Shengchuan Dai 1*, Zhe Xu 2*, Yan Luo 2, Ting Wan 2,

Supplementary Table 1. PCR amplification conditions for each primer pair. Primer sequence

- 1 - Supplementary Tables Supplementary Table 1. PCR amplification conditions for each primer pair Primer sequence FN1 S - CAAAGCAAGCCCGGTTGT AS - CGCTCCCACTGTTGATTTATCTG ITGα2 S - TTAGGTTACTCTGTGGCTGCAATT

Title: Stromal Cell Subsets Directing Neonatal Spleen Regeneration

Title: Stromal Cell Subsets Directing Neonatal Spleen Regeneration Authors: Jonathan K.H. Tan and Takeshi Watanabe SUPPLEMENTAL INFORMATION Supplemental Tables 1-4 Supplemental Figure 1 Table S1. Marker

64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl

Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)

Supplementary Information. A novel human endogenous retroviral protein inhibits cell-cell fusion. Supplementary Figures:

Supplementary Information A novel human endogenous retroviral protein inhibits cell-cell fusion Jun Sugimoto, Makiko Sugimoto, Helene Bernstein, Yoshihiro Jinno and Danny J. Schust Supplementary Figures:

Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3

Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3 antibody. HCT116 cells were reverse transfected with sicontrol

Yalin Emre, Magali Irla, Isabelle Dunand- Sauthier, Romain Ballet, Mehdi Meguenani, Stephane Jemelin, Christian Vesin, Walter Reith and Beat A.

Supplementary information Thymic epithelial cell expansion through matricellular protein CYR61 boosts progenitor homing and T- cell output Yalin Emre, Magali Irla, Isabelle Dunand- Sauthier, Romain Ballet,

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12474 Supplementary Figure 1 Analysis of mtdna mutation loads in different types of mtdna mutator mice. a, PCR, cloning, and sequencing analysis of mtdna mutations

Supporting Information

Supporting Information Bian et al. 10.1073/pnas.1214100110 SI Materials and Methods Mechanical Analysis. At set time points, samples were removed from the culture and the bulk mechanical properties of

Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated. Antitumor Immunity to Promote Tumor Progression

Supplemental Information Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated Antitumor Immunity to Promote Tumor Progression Yu Wang, Sheng-Nan Sun, Qing Liu, Yang-Yang Yu, Jian Guo, Kun Wang,

Contribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis

Contribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis Yan Liu 1,*, Zhipeng Han 1,*, Yingying Jing 1,*, Xue Yang 1, Shanshan Zhang 1, Chen

Salvianolic Acid B Attenuates Experimental Pulmonary Fibrosis through. Inhibition of the TGF-β Signaling Pathway

Salvianolic Acid B Attenuates Experimental Pulmonary Fibrosis through Inhibition of the TGF-β Signaling Pathway Qingmei Liu 1, Haiyan Chu 1, Yanyun Ma 1, Ting Wu 1, Feng Qian 1, Xian Ren 2, Wenzhen Tu

The cell-cycle regulator c-myc is essential for the formation and maintenance of germinal centers

SUPPLEMENTARY INFORMATION The cell-cycle regulator c-myc is essential for the formation and maintenance of germinal centers Dinis Pedro Calado 1,2, Yoshiteru Sasaki 3, Susana A Godinho 4, Alex Pellerin

Supplementary Information

Supplementary Information Supplementary Figure S1 (a) P-cRAF colocalizes with LC3 puncta. Immunofluorescence (IF) depicting colocalization of P-cRAF (green) and LC3 puncta (red) in NIH/3T3 cells treated

Multiple layers of B cell memory with different effector functions. Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos,

Multiple layers of B cell memory with different effector functions Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos, Jérome Mégret, Sébastien Storck, Claude-Agnès Reynaud & Jean-Claude

Control + SDS + 2BME. Control + SDS. Control

Supplementary Figure 1 2BME:2-mercaptoethanol Control Control + SDS Control + SDS + 2BME Control Control + SDS Control + SDS + 2BME Control Control + SDS Control + SDS + 2BME Ephrin-B2 Oligomers Ephrin-B2

Supplementary Figure 1.

Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate

Supporting Information. Engineering PD-1-Presenting Platelets for Cancer Immunotherapy

Supporting Information Engineering PD-1-Presenting Platelets for Cancer Immunotherapy Xudong Zhang,,, #, Jinqiang Wang,, #, Zhaowei Chen, Quanyin Hu, Chao Wang, Junjie Yan, Gianpietro Dotti, Peng Huang,

promote ROS production and metastasis of HCC cells

MCU-dependent mitochondrial Ca 2+ inhibits NAD+/SIRT3/SOD2 pathway to promote ROS production and metastasis of HCC cells Tingting Ren 1#, Hui Zhang 2#, Jiaojiao Wang 1, Jianjun Zhu 1, Mingpeng Jin 1,Yousheng

Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and

SUPPLEMENTARY MATERIALS AND METHODS Chromatin Immunoprecipitation for qpcr analysis Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and IL24, all located on chromosome 1. Primer

a Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs

a Lamtor (gene) b Lamtor (mrna) c BMDMs: Φ WT Φ KO Lamtor flox 8 bp LysM-Cre 93 bp..5 p =.4 WT BMDMs: Φ WT Φ KO Lamtor (protein) BMDMs: Φ WT Φ KO Lamtor 8 kda Lamtor 4 kda Lamtor3 4 kda Lamtor4 kda Lamtor5.5

Initial genotyping of all new litters was performed by Transnetyx (Memphis,

SUPPLEMENTAL INFORMATION MURILLO ET AL. SUPPLEMENTAL EXPERIMENTAL PROCEDURES Mouse Genotyping Initial genotyping of all new litters was performed by Transnetyx (Memphis, USA). Assessment of LoxPpα recombination

Description of supplementary material file

Description of supplementary material file In the supplementary results we show that the VHL-fibronectin interaction is indirect, mediated by fibronectin binding to COL4A2. This provides additional information

IGF-1 promotes the development and cytotoxic activity of human NK cells regulated

Supplementary Information for IGF-1 promotes the development and cytotoxic activity of human NK cells regulated by mir-483-3p Fang Ni 1, 2, Rui Sun 1, Binqing Fu 1, Fuyan Wang 1, Chuang Guo 1, Zhigang

Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP)

Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP) in the cortex (area 1 as defined in Fig. 2a), and corpus

Supplementary Methods

Supplementary Methods Antibodies Rabbit polyclonal VEGFR-1, VEGFR-2, Angiopoietin-1, Angiopoietin- 2 and GAPDH specific antibodies were from Santa Cruz Biotechnology. Rabbit polyclonal Akt1, Akt2, ps473

Online Supplement ALVEOLAR CELL SENESCENCE IN PATIENTS WITH PULMONARY EMPHYSEMA. Takao Tsuji, Kazutetsu Aoshiba, and Atsushi Nagai

Online Supplement ALVEOLAR CELL SENESCENCE IN PATIENTS WITH PULMONARY EMPHYSEMA Takao Tsuji, Kazutetsu Aoshiba, and Atsushi Nagai MATERIALS AND METHODS Immunohistochemistry Deparaffinized tissue sections

Supplemental Figure 1. The parthenogenetic activation of oocytes recovered from oviducts of gcnrg1 KO mice and wild type mice.

% (a) MII AII Pronucleus (b) 3 F-Actin / Tubulin / DAPI 1 WT KO Supplemental Figure 1. The parthenogenetic activation of oocytes recovered from oviducts of gcnrg1 KO mice and wild type mice. (a) Triple

Supplemental material

Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.

Supplementary material

Supplementary material Tracking mesenchymal stem cell contributions to regeneration in an immunocompetent cartilage regeneration model Daniela Zwolanek, María Satué, Verena Proell, Josè R. Godoy, Kathrin

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

amplify the conditional allele (2-lox) and recombined allele (1-lox) following tamoxifen

Supplementary data Supplementary Table 1. Real-time PCR primer sequences Supplementary Fig. 1. (A) Genomic map of the Vhl (2-lox) conditional allele. Numbered boxes represent exon 1, which is targeted

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang

Supplementary Figure 1 a. d 0.8 CON LPS PAN. 2nd ab nephrin podocin CON LPS PAN. upar. -tubulin. upar. upar / -tubulin CON LPS PAN

Supplementary Figure 1 a Efferent arteriole Podocytes Afferent arteriole FP Endothelium GBM Glomerular filtration barrier b 188kD HEK + GFP HEK + GFP-Nphs1 Differentiated Podocytes HEK + GFP HEK + GFP-Nphs2

F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated

SDC MATERIALS AND METHODS Flow Cytometric Detection of A-Antigen Expression Single cell suspensions were prepared from bone marrow, lymph node and spleen. Peripheral blood was obtained and erythrocytes

isolated from ctr and pictreated mice. Activation of effector CD4 +

Supplementary Figure 1 Bystander inflammation conditioned T reg cells have normal functional suppressive activity and ex vivo phenotype. WT Balb/c mice were treated with polyi:c (pic) or PBS (ctr) via

Supplementary Fig. 5

Supplementary Fig. 5 Supplemental Figures legends Supplementary Figure 1 (A) Additional dot plots from CyTOF analysis from untreated group. (B) Gating strategy for assessment of CD11c + NK cells frequency

Product Datasheet. Integrin alpha 3/CD49c Antibody NBP Unit Size: 0.1 ml

Product Datasheet Integrin alpha 3/CD49c Antibody NBP2-48514 Unit Size: 0.1 ml Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Protocols, Publications, Related Products,

Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK)

SUPPLEMENTAL MATERIAL Supplemental Methods Flow cytometry Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK) and anti-human CD68 (Dako, Denmark), anti-human smooth muscle cell α-actin

Supporting Information

Supramolecular Probes for Assessing Glutamine Uptake Enable Semi-Quantitative Metabolic Models in Single Cells Min Xue, Wei Wei, Yapeng Su, Dazy Johnson, and James R. Heath *,, Division of Chemistry and

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

AD Award Number: W81XWH-12-1-0516 TITLE: Cadherin-11 Regulation of Fibrosis through Modulation of Epithelial-to- Mesenchymal Transition: Implications for Pulmonary Fibrosis in Scleroderma PRINCIPAL INVESTIGATOR:

Day 7 Day 21 MNC CD14 + CD14- Depleted

Day 7 Day 21 A B MNC C D CD14 + E F CD14- Depleted Supplemental Figure 1. DUOC-01 cell product develops from CD14 + monocytes in cord blood. Cultures were established with cord blood mononuclear cells

Supplementary Information

Supplementary Information Tumour PDGF-BB expression levels determine dual effects of anti- PDGF drugs on vascular remodelling and metastasis Kayoko Hosaka 1, Yunlong Yang 1, Takahiro Seki 1, Masaki Nakanura

Supplemental material and methods

Supplemental material and methods Antibodies: Primary antibodies used for these stainings were 174/2 1 (migg1 against PV-1), PAL-E 2 (migg2a; Abcam, Cambridge, UK), anti-nrp-1 (monoclonal migg2a or polyclonal

Supplementary Information. Title BRD3 and BRD4 BET Bromodomain Proteins Differentially Regulate Skeletal Myogenesis

Supplementary Information Title BRD3 and BRD4 BET Bromodomain Proteins Differentially Regulate Skeletal Myogenesis Authors Thomas C. Roberts 1,2, Usue Etxaniz 1, Alessandra Dall Agnese 1, Shwu-Yuan Wu

Supporting Information

Supporting Information Fujii et al. 10.1073/pnas.1217563110 A Human Cen chromosome 4q ART3 NUP54 SCARB2 FAM47E CCDC8 Tel B Bac clones RP11-54D17 RP11-628A4 Exon 1 2 34 5 6 7 8 9 10 11 12 5 3 PCR region

Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # C Component Size Shipping Temperature

Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3K4D Histone H3K4me2 (H3K4 Dimethyl) Polyclonal Antibody

Supplementary Appendix

Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Svegliati Baroni S, Santillo M, Bevilacqua F, et al. Stimulatory

B Vehicle 1V270 (35 μg) 1V270 (100 μg) Days post tumor implantation. Vehicle 100μg 1V270 biweekly 100μg 1V270 daily

Supplemental Figure 1 A 1 1V7 (8 μg) 1 1V7 (16 μg) 8 6 4 B 1 1 8 6 4 1V7 (35 μg) 1V7 (1 μg) 5 1 15 5 1 15 C Biweekly 8 11 14 17 Days Implant SCC7 cells Daily 8 9 1 11 1 Implant SCC7 cells 1V7 i.t. treatment

Atherosclerotic Plaque Targeting Mechanism of Long- Circulating Nanoparticles Established by Multimodal Imaging

Atherosclerotic Plaque Targeting Mechanism of Long- Circulating Nanoparticles Established by Multimodal Imaging Mark E. Lobatto 1,2, Claudia Calcagno 1, Antoine Millon 1,3, Max L. Senders 1, Francois Fay