PSNE Days
|
|
|
- Kevin McKenzie
- 6 years ago
- Views:
Transcription
1 K132 F132 Cumulative population doubling escence plateau Exponential growth PSNE Days Cumulative population doubling Exponential growth escence plateau Days K67FA1 F67FA1 Cumulative population doubling Exponential growth Days PSNE escence plateau Cumulative population doubling Exponential growth Days escence plateau 2F1958 2F1966 Cumulative population doubling Exponential growth escence plateau Days PSNE Cumulative population doubling Exponential growth Days escence plateau Supplementary Figure 1: Growth curves of the three NHDFs-NHEKs couples used in this study. See supplemental table 1 for the characteristics of each donor.
2 A NHEKs NHDFs ExpG 4.1 PDs 12 PDs PSNE 14.3 PDs ExpG 7PDs 55 PDs SA- -Gal 5%±4% 39%±7% 13%±5% 4%±2% 59%±7% BrdU %±1% 5%±6% 32%±7% 31%±3% 2%±4% T- test NHEKs ExpG/ NHEKs /PSNE NHDFs ExpG/ SA- -Gal P= E-5 P= E-5 P= E-5 BrdU staining P= P= E-5 P= E-7 B NHEKs (K1MC Donor) NHDFs (F1MC Donor) ExpG BrdU - Alexa488 S G1: 46% S: 43% G2/M:11% BrdU - Alexa488 S G1: 66% S: 29% G2/M: 7% G1 G2/M G1 G2/M DNA content - IP DNA content - IP BrdU - Alexa488 S G1 G2/M G1: 77% S: 2% G2/M: 21% BrdU - Alexa488 S G1 G2/M G1: 88% S: 2% G2/M:1% DNA content - IP DNA content - IP Supplementary Figure 2: Characteristics of senescent NHEKs and NHDFs (complements to Figure 1). (A) Upper panels: images of SA-β-Gal-stained NHEKs and NHDFs (donor 1MC). Scale bar=5µm. The means ± SD of SA- -Gal-positive cells are indicated as inserts. Lower panels: BrdU incorporation assays with quantification of BrdU-positive cells. Scale bar=1µm. Positive cells were counted in 5 independent microscopic fields for a total of at least 1 cells for each case. The results given as inserts are the mean +/- SD of all counts. The statistical analyses are given in the table below. (B) Dot plots of cell cycle distribution of exponentially growing and senescent NHEKs and NHDFs (donor 1MC) analyzed by flow cytometry (F1MC (ExpG: 11 PDs : 58 PDs), K1MC (ExpG: 3 PDs : 12.4 PDs)). Percentages of cells in G/G1, S, and G2/M phases are indicated. The experiment was performed with 3 couples of NHDFs-NHEKs from 3 different donors. The statistical analysis of the 3 experiments is given in Fig.1B. ExpG=exponentially growing cells; =cells at the senescence plateau. The exact PDs at which cells were taken is indicated.
3 A NHEKs NHDFs ExpG (4 PDs) (11 PDs) ExpG (18 PDs) (6 PDs) Hoechst 1% INK4a positive cells 8% 6% % 2% B % ExpG ExpG NHEKs NHDFs NHEKs senescence plateau - (12 PDs) si-ctr si-#pool Supplementary Figure 3: NHEKs but not NHDFs upregulate at senescence (complements to Figure 1). (A) Immunofluorescence detection of in exponentially growing and senescent NHEKs and NHDFs (donor 1MC). Upper panels: Representative ApoTome microscopy images. Scale bar=1µm. Lower panel: Quantification of -positive cells. Positive cells were automatically counted with ImageJ in 5 independent microscopic fields for a total of at least 5 cells. The bar chart represents the mean ± SD of each 1 counts. (B) Checking for the specificity of the antibody. escent NHEKs (donor 1MC) were transfected by a pool of control or sirnas and processed for immunofluorescence with the anti- antibody (55834, BD Pharmingen). Representative ApoTome microscopy images, scale bar=2µm. ExpG=exponentially growing cells; =cells at the senescence plateau. The exact PDs at which cells were taken is indicated.
4 escent NHEKs (12 PDs) 32% Sorting, plating 5 days PSNE PSNE PSNE PSNE Supplementary Figure 4: PSNE cells are generated from fully senescent cells (complements to Figure 1). escent NHEKs (donor 1MC) at 12 PDs were analyzed by flow cytometry according to their size (FSC-A) and granularity (SSC-A). Thirty-two percent of the largest and most granular cells were sorted, plated at low density and monitored for PSNE which occurred 5 days later. Representative images by phase contrast microscopy of PSNE clones clearly showing the remaining links between PSNE cells and their senescent mother cell. Scale bar= 5µm.
5 53BP1 TRF2 merge NHDFs ExpG (17 PDs) 1 (59 PDs) Mean number of foci / nucleus ExpG TIF Non-telomeric foci Supplementary Figure 5: DDR foci in senescent NHDFs are both telomeric and non telomeric (complements to Figure 2). Upper panels: Representative confocal microscopy images for 53BP1 (green) and TRF2 (red) double immunofluorescence performed on exponentially growing and senescent NHDFs (donor 1MC). Lower panel: Foci double positive for 53BP1 and TRF2 (TIF) and foci positive only for 53BP1 (non-telomeric foci) were counted amongst at least 15 cells. The given results are the mean +/- SD of all counts. ExpG=exponentially growing cells; =cells at the senescence plateau. The exact PDs at which cells were taken is indicated.
6 A Comet assay ph8 Comet assay ph12.3 ExpG ExpG NHEKs NHEKs 7 PDs 12 PDs 7 PDs 12 PDs NHDFs NHDFs 1 PDs 56 PDs 1 PDs 56 PDs B SantaCruz si#pool Number of foci / cell 2 si#pool SantaCruz Abcam Cell Signaling Anti- Abcam C Anti- SantaCruz Abcam Cell Signaling Cell Signaling Supplementary Figure 6: complements to Figure 3. (A) Representative ApoTome microscopy images of comet assays stained with SYBR Green whose quantitative analysis is given in Fig.3A. (B) Checking for the specificity of the antibodies. Three antibodies raised against three different immunogens were used: an antibody from Santa Cruz raised against the N-terminal 1-3 amino-acids, an antibody from Abcam raised against full length, and an antibody from Cell Signaling raised against a peptide made of amino-acids around Arg3. escent NHEKs (donor 1MC) at 12.5 PDs transfected by a pool of control or anti- sirnas were processed for immunofluorescence with the 3 antibodies. Left panel: Representative ApoTome microscopy images. Scale bar=1µm. Right panel: The number of foci per cell was counted in more than cells. The bar chart represents the mean +/- SD of all counts (C) Analysis of the same cells as in B by westernblotting with the same 3 antibodies. ExpG=exponentially growing cells; =cells at the senescence plateau. The exact PDs at which cells were taken is indicated.
7 A NHEKs (11 PDs) escence plateau NHDFs (59 PDs) Hoechst /hogg1 1% * hogg1 Positive cells 8% 6% % 2% % NHEKs NHDFs B ExpG (4 PDs) + H 2 O 2 ExpG (2.5 PDs) + H 2 O 2 ABT- 888 (µm) ExpG (2.5 PDs) + H 2 O AB (mm) PARs PARs PARs C PARs ExpG (5 PDs) NHEKs (12 PDs) +H 2 O 2 ExpG (15 PDs) NHDFs (6 PDs) Nucleus-positive cells 12% 1% 8% 6% % 2% * * % ExpG ExpG NHEKs NHDFs Supplementary Figure 7: complements to Figure 3 (A) /hogg1 double immunofluorescences performed on senescent NHEKs and NHDFs (donor 1MC). Left panel: Representative ApoTome microscopy images. Scale bar=1µm. Right panel: Positive cells were automatically quantified with ImageJ in 5 independent microscopic fields for a total of at least 1 cells for each case. The bar chart represents the means +/- SD of each 5 counts. (B) Checking for the specificity of anti- and anti-pars antibodies. Left and middle panels: western-blot analysis of, PARs and (loading control) levels in total extracts of exponentially growing NHEKs (donor 1MC) treated with 3-AB or ABT888 during 24hrs, then with 1µM H 2 O 2 at 4 C for 1min and then placed at 37 C for 5min. Right panel: western-blot analysis of, PARs and (loading control) levels in exponentially growing NHEKs (donor 1MC) transfected with a pool of control or sirna. Four days after transfection, cells were treated by H 2 O 2 as above. (C) and PARs immunofluorescences performed on exponentially growing and senescent NHEKs and NHDFs (donor 1MC) treated as in Fig.3D. Left panel: Representative ApoTome microscopy images. Scale bar=1µm. Right panel: and PARs positive cells were counted in 1 independent microscopic fields for a total of at least 1 cells for each case. The bar chart represents the means ± SD of each ten counts. The results are representative of 2 independent experiments. ExpG=exponentially growing cells; =cells at the senescence plateau. The exact PDs at which cells were taken is indicated. PARs
8 A ExpG (5 PDs) 2 min after H 2 O 2 si#pool 2 min after H 2 O 2 p p 1 sick2 #pool 2 min after H 2 O 2 CK2 CK2 sipnkp#pool 2 min after H 2 O 2 PNKP PNKP 55 B (1 PDs) AdGFP Ad Hrs post-infection 1 p 7 7 C (11.8 PDs) NI Ad NT 3AB ABT-888 Merge foci-positive cells 1% 8% 6% % 2% % NI AdGFP Ad NT 3AB ABT-888
9 Supplementary Figure 8: The activity is necessary for the resolution of the foci (complements to Figure 4) (A) Checking for the specificity of the p, CK2 and PNKP antibodies. Exponentially growing NHEKs (donor 67FA1) were transfected with a pool of control,, CK2 or PNKP sirna. Two days after transfection, cells were treated by 1µM H 2 O 2 at 4 C for 1min, placed at 37 C for 2min. Immunofluorescence and western-blot with the 3 antibodies were performed. Left: Representative ApoTome microscopy images. Scale bar = 2µm. Right: western-blot analysis. (B) escent NHEKs (donor 67FA1) were infected with AdGFP or Ad. Western-blot analysis of, phosphorylated, total and (loading control) at, 6, 12, 24 and 48hrs post-infection. (C) escent NHEKs at 11.8 PDs (donor 67FA1) were infected with Ad, AdGFP or kept non infected (NI) and treated or not with 5mM 3AB or 1µM ABT-888. Twenty four hours after infection, cells were processed for and immunofluorescence. Left panel: representative photomicrographs. Scale bar=1µm. Right panel: Quantification of cells displaying foci. At least 1 cells were counted for each condition with image J. The bar chart represents the mean +/- SD. The results are representative of two independent experiments. ExpG=exponentially growing cells; =cells at the senescence plateau. The exact PDs at which cells were taken is indicated.
10 A Day 3 Day 6 Day 9 Day 15 si#5 si#6 si#7 si#5 si#6 si#7 si#5 si#6 si#7 si#5 si#6 si#7 PCNA 1 B Day 6 Day 15 C si #5 SA- -Gal positive cells 8% 6% % 2% si#5 si#6 si#7 % Days D Day 6 E Day 6 si#pool 9% 29% 1 15 p-rb (S87-811) F Day Rb BrdU - Alexa488 S G1 G2/M G1: 43% S: 44% G2/M:14% BrdU - Alexa488 S G1 si#pool G2/M G1: 59% S: 24% G2/M:17% p53 p21 DNA content - IP DNA content - IP Supplementary Figure 9: complements to Figure 7. (A) Western-blot analysis of, PCNA (proliferative index) and (loading control) levels in total extracts of - and si-transfected NHEKs at the indicated time posttransfection. (B) Representative images of cell morphologies at days 6 and 15 post-transfection. Scale bar=5µm. (C) Percentage of SA-β-Gal-positive at days 3, 6, 9 and 15 post-transfection. The bar chart represents the means ± SD of each 4 counts. (D) Quantification of changes in cell morphology. - and si-transfected NHEKs were analyzed for size (FSC-A) and granularity (SSC-A) distribution by flow cytometry at day 6 post-transfection. (E) Western-blot analysis of, phosphorylated Rb (S87-811), Rb,, p53, p21, PCNA (proliferative index) and (loading control) levels in total cell extracts. (F) Analysis by flow cytometry of the distribution of - and si-transfected NHEKs in G/G1, S, and G2/M phases.
11 A B C F Cumulative Population Doublings CTR 1mM 5mM 3AB Days Day 15 CTR 3AB 1 mm 5 mm 15 p-rb 1 55 p53 PCNA Day 15 Day 24 Phase contrast SA- -Gal Phase contrast SA- -Gal CTR 16 ± 5% 5 ± 18% 1 mm 42 ± 1% 21 ± 9% 3AB 5 mm 6 ± 14% 14 ± 5% Positive cells D E CTR 8% 1mM 3AB 5mM 3AB 6% % 2% % 53BP1 Day 15 G Tail Moments CTR 1mM 3AB 5mM 3AB ph12.3 ph8 Day 15 PSNE frequency 1.E-3 1.2E-3 1.E-3 8.E-4 6.E-4 4.E-4 2.E-4 CTR Day 21 1mM 3AB Day 18 5mM 3AB Day CTR 3AB (1mM) 3AB (5mM) Day 5 Day 3 Day 5 Day 3 Day 5 Day 3 F2R MET.E+ Supplementary Figure 1: Inhibiting PARP activity using 3AB induces premature senescence followed by PSNE (A) Growth curve of NHEKs treated or not with 1 or 5mM 3AB every day. (B) Representative images of cell morphology and SA- -Gal staining at the indicated time after the beginning of the treatment. The percentage of SA- -Gal positive cells (means +/- SD) are given as inserts. (C) Western-blot analysis of, phosphorylated Rb, p53, PCNA (proliferation index) and (loading control) 15 days after the beginning of the treatment. (D) Immunodetection of and 53BP1 foci 15 days after the beginning of the treatment. Positive cells were counted in 5 independent microscopic fields for a total of at least 5 cells for each case. The bar chart represents the means ± SD of each ten counts. (E) Alkaline (ph12.3) and neutral (ph8) comet assays performed in tandem 15 days after the beginning of the treatment. Tail moments of 3 to 5 comet-positive cells were quantified. Scatter dot plots represent the mean ± SD. (F) Measure of PSNE frequency of NHEKs as described in Materials and Methods. Counts of PSNE clones performed in 4 independent culture dishes. The given results are the mean +/- SD of all counts. (G) Western-blot analysis of the transformation markers F2R and MET and as loading control in cells at the indicated time after the beginning of the treatment.
12 A B NHEKs (11 PDs) 1 2 SB2358 (µm) 2.E-3 1.6E-3 p38mapk 15 PSNE frequency 1.2E-3 8.E-4 µm 1 µm 2 µm SB E-4.E+ Supplementary Figure 11: Inhibiting the p38mapk activity partially reverts the upregulation of and increases the PSNE frequency escent NHEKs at 11 PDs (donor 67FA1) were treated daily with 1 or 2 µm of SB2358. (A) Western-blot analysis of, p38mapk and (loading control) 24hrs after the beginning of the treatment. (B) Measure of PSNE frequency of NHEKs as described in Materials and Methods. Counts of PSNE clones performed in 3 independent culture dishes. The given results are the mean +/- SD of all counts.
13 A B Positive cells 1% 8% 6% % 2% 53BP1 ROS Relative H 2 DCFDA fluorescence intensity H 2 DCFDA fluorescence intensity (AU) Control Catalase Catalase-PEG NAC C % (PDs) ExpG 8% Control Catalase Catalase-PEG NAC H2O2 SA- -Gal positive cells 6% % 2% % Days D Control Catalase Catalase-PEG NAC H 2 O 2 Days: p-rb p E Relative mrna level hrs Relative mrna level hrs H 2 O 2 (5 µm) NAC (1 mm) ExpG (6 PDs) (13 PDs)
14 Supplementary Figure 12: Complements to Figure 8 (A) Immunofluorescence detection of 53BP1 and foci in NHEKs (donor 1MC) all along their cultivation, and, in parallel, measure of ROS concentration using H 2 DCFDA as described in Materials and Methods. Positive cells were counted in 5 independent microscopic fields for a total of at least 1 cells for each case. Each point is the mean +/-SD of all counts (B) Verification of the efficacy of the anti-oxidant treatments performed in Fig.8. ROS concentration was measured 24hrs after the beginning of the treatment. The given results are means of triplicates ± SD. (C) Percentage of SA-β-Gal-positive cells (means ± SD) at days, 3, 6, 9, 12 and 18 of the experiment. (D) Western-blot analysis of, phosphorylated Rb, p53, PCNA (proliferative index) and (loading control) levels in total cell extracts of treated and non-treated NHEKs at the indicated time of the experiment. (E) Expression of is negatively regulated by oxidative stress. Exponentially growing or senescent NHEKs (donor 67FA1) were treated with 5µM H 2 O 2 or 1mM of NAC respectively. RNA extractions were performed 9hrs post-treatment and mrna levels were analyzed by RT-qPCR. Results are means of triplicates ± SD. Data are representative of 2 independent experiments.
15 Young Epidermis Old % of positive cells Supplementary Figure 13: Immunodetection of in sections of skin from young versus old donors (complements to Figure 9) P16 immunohistofluorescence performed in sections of skin samples from healthy human young (n=2) and old donors (n=2) (see sup table 2). Upper panels: Representative ApoTome microscopy images for epidermis of a young and an aged donor. Scale bar = 5µm. The square delimits the below image at higher magnification. Lower panels: Scatter dot plots indicating the percentage of positive epidermal cells in young and aged skin. Cells were counted in 1 independent microscopic fields for a total of at least 15 cells. The given results are the mean ± SD of the means in the 2 donors.
16 .25 Fig 1F ExpG -6TG O.D at A * * ExpG +6TG PSNE -6TG PSNE +6TG.5 Day Day 3 Day 6 Fig 7G O.D at A ExpG -6TG ExpG +6TG PSNE -6TG PSNE +6TG Day Day 3 Day 6 O.D at A ExpG -6TG ExpG +6TG PSNE -6TG PSNE +6TG si#5.1 Day Day 3 Day 6 Fig 8I O.D at A * ExpG -6TG ExpG +6TG PSNE -6TG PSNE +6TG H 2 O 2.2 Day Day 3 Day * Fig 1E ExpG -6TG O.D at A * ExpG +6TG PSNE -6TG PSNE +6TG.1 Day Day 3 Day 6 Supplementary Figure 14: Quantification of the hprt assays The optic density of each crystal violet solution was measured three times. The bar charts represent the mean +/- SD of the three counts.
17 Fig 1C Fig 2D p-rb Rb p-atm (Ser1981) ATM p-chk1 (Ser345) p-atr (Ser428) Chk1 p53 p21 ATR p-53bp1 (Ser25) p-p53 (S15) Fig 3D 53BP1 p-chk2 (Thr68) Chk2 p53 PCNA PARs Fig 1E F2R PCNA ADAM1 E-cadherin c-met Supplementary Figure 15: Original scans of western blots
18 Fig 4A Fig 4B Fig 4C p p GFP CK2 p CK2 PCNA Fig 5B CK2 GFP Fig 5F Fig 4G PCNA V5 p p-rb (S87-811) V5 PCNA p21 Supplementary Figure 16: Original scans of western blots
19 Fig 6A Fig 6B Fig 6C p38mapk p-p38mapk p-p38mapk Rb p38mapk p-rb (S87-811) p53 p-erk1/2 ERK1/2 Supplementary Figure 17: Original scans of western blots
20 Fig 7F Fig 8H Fig 1B F2R F2R MET p-rb MET p53 Fig 1D Fig 1F TR PCNA Vimentin PARs PCNA E- Cadherin c-met Supplementary Figure 18: Original scans of western blots
21 Supplementary Table 1: The different batches of primary cells used in the study Donor Company Donor age / Race /Sex / location Denomination Cell type / Lot number PDs at senescence plateau 1MC Promocell 1 / Caucasian / male / foreskin K1MC F1MC Human epidermal keratinocytes / Human dermal fibroblasts / > Tebu - bio 5 / Caucasian / female / facial skin K132 Human epidermal keratinocytes / F132 Human dermal fibroblasts / 132 >38 67FA1 GIBCO Invitrogen cell culture 67 / Asiatic / Female / breast skin K67FA1 F67FA1 Human epidermal keratinocytes / Human dermal fibroblasts / >38 2F19 Cambrex Bio Science 37 / Caucasian / Female / not communicated K2F1958 F2F1966 Human epidermal keratinocytes / 2F1958 Human dermal fibroblasts / 2F >45 Bio-Whittaker 58 / Black / Female HMEC F1331 Human Mammary Epithelial Cells / F
22 Supplementary Table 2: The different samples of human skin used in the study Skin biopsies from healthy young donors N donor Age Sex 53BP1 MnSOD INK4a 11391/9 29 male x x x x x 32645/9 34 male x x x x 35968/1 38 female x x x 3341/1 38 female x x Skin biopsies from healthy old donors N donor Age Sex 53BP1 MnSOD INK4a 39853/1 65 male x x 9238/9 75 male x x x 1768/8 8 female x x x 12745/9 85 female x x x x 281/9 89 male x x x x x
23 Supplementary Table 3: Primary antibodies used in this study Antibodies Compagny Cat# WB dilution IF dilution IHF dilution PCNA Dako M879 1:1 PCNA Santa Cruz sc :5 H2AX Novus Biologicals NB :1 1:1 53BP1 Santa Cruz sc :5 1:2 1:5 53BP1 Novus Biologicals NBP :1 p-53bp1 (S25) Bethyl Labroratories A3-652A 1:1 1:1 ATM Santa Cruz sc723 1:5 1:1 p-atm (S1981) Santa Cruz sc :5 1:1 ATR Santa Cruz sc :5 1:1 p-atr (S428) Santa Cruz sc :5 1:1 CHK2 Cell Signaling 34 1:1 p-chk2 (T68) Cell Signaling :1 CHK1 Santa Cruz sc-88 1:1 p-chk1 (S345) Abcam ab :1 p53 Santa Cruz sc126 1:1 1:2 p-p53 (S15) Abcam ab1431 1:1 1:2 p21 Santa Cruz sc :5 p38mapk Cell Signaling :1 p-p38mapk (T18/T182) Cell Signaling :1 Santa Cruz sc1661 1:5 BD Pharmingen :1 1:5 Rb Cell Signaling 939 1:1 p-rb (S87-811) Cell Signaling 938 1:1 PAR Merck Chemicals AM8, clone 1H 1:1 Abcam ab679 1: 1:1 Trevigen 4338-MC-5 1:1 1:1 Abcam ab4792 1:1 1:1 1:1 Cell Signaling :1 1:1 Santa Cruz sc :5 1:2 1:5 p- (S518/T519/T523) Bethyl Laboratories A3-59A 1:1 1:3 CK2 Abcam ab :1 1:1 PNKP Abcam ab :1 1:1 DNA ligase3 GeneTex GTX7147 1:1 DNA ligase1 Medical and Biological Laboratories K19-3 1:1 V5 Invitrogen :5 GFP Santa Cruz sc :5 F2R Santa Cruz sc :5 MET Invitrogen :1 Vimentin Santa Cruz sc-626 1:5 Cadherin Santa Cruz sc-787 1:5 ADAM1 Santa Cruz sc-48 1:5 Santa Cruz sc :1 MnSOD Calbiochem :1 1:1
Supplementary Information
Supplementary Information stability is regulated by CK2-dependent interaction with R2TP complex Patrick von Morgen 1,2, Kamila Burdova 1, Thomas G. Flower 3, Nicola J. O'Reilly 4, Simon J. Boulton 5, Stephen
Supplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
DOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000
Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4
SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase
Single cell resolution in vivo imaging of DNA damage following PARP inhibition. Supplementary Data
Single cell resolution in vivo imaging of DNA damage following PARP inhibition Katherine S. Yang, Rainer H. Kohler, Matthieu Landon, Randy Giedt, and Ralph Weissleder Supplementary Data Supplementary Figures
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.
A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200
Supporting Information
Supporting Information Stavru et al. 0.073/pnas.357840 SI Materials and Methods Immunofluorescence. For immunofluorescence, cells were fixed for 0 min in 4% (wt/vol) paraformaldehyde (Electron Microscopy
At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
Inhibition of Twist1 mediated invasion by Chk2 promotes premature senescence in p53 defective cancer cells
Inhibition of Twist1 mediated invasion by Chk2 promotes premature senescence in p53 defective cancer cells Debasis Nayak, a,1 Anmol Kumar, b Souneek Chakraborty, a,1 Reyaz ur Rasool, a,1 Hina Amin, a Archana
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
Supplemental Material
Supplemental Material Figure S1.(A) Immuno-staining of freshly isolated Myf5-Cre:ROSA-YFP fiber (B) Satellite cell enumeration in WT and cko mice from resting hind limb muscles. Bulk hind limb muscles
Supplementary Fig S1 Nutlin-3a treatment does not affect cell cycle progression in the absence
Supplementary Figure Legends Supplementary Fig S1 Nutlin-3a treatment does not affect cell cycle progression in the absence of p53 or p21. HCT116 cells which were null for either p53 (A) or p21 (B) were
Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics
Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene
Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,
FIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and
Supplementary Figures FIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and mutant (mut) cells. Higher magnification is shown in Figure 1A. Arrows indicate cisplatin-induced
Supplementary Figure 1, Wiel et al
Supplementary Figure 1, Wiel et al Supplementary Figure 1 ITPR2 increases in benign tumors and decreases in aggressive ones (a-b) According to the Oncomine database, expression of ITPR2 increases in renal
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.
0.9 5 H M L E R -C tr l in T w is t1 C M
a. b. c. d. e. f. g. h. 2.5 C elltiter-g lo A ssay 1.1 5 M T S a s s a y Lum inescence (A.U.) 2.0 1.5 1.0 0.5 n s H M L E R -C tr l in C tr l C M H M L E R -C tr l in S n a il1 C M A bsorbance (@ 490nm
Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera
SUPPLEMENTARY INFORMATION Roles of human POLD1 and POLD3 in genome stability Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY METHODS Cell proliferation After sirna
Supplementary Figure Legends
Supplementary Figure Legends Figure S1 gene targeting strategy for disruption of chicken gene, related to Figure 1 (f)-(i). (a) The locus and the targeting constructs showing HpaI restriction sites. The
(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
Online Supporting Material for. The Bisecting GlcNAc on N-Glycans Inhibits Growth. Factor Signaling and Retards Mammary Tumor
Online Supporting Material for The Bisecting GlcNAc on N-Glycans Inhibits Growth Factor Signaling and Retards Mammary Tumor Progression Yinghui Song 1, Jason A. Aglipay 1, Joshua D. Bernstein 2, Sumanta
Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides
Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides targeting RCP (SMARTPool (RCP) or two individual oligos (RCP#1
Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).
Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Suppl. Fig. 1. Notch and myostatin expression is unaffected in the absence of p65 during postnatal development. A & B. Myostatin and Notch-1 expression levels were determined
p53 is activated in response to disruption of the pre-mrna splicing machinery.
p53 is activated in response to disruption of the pre-mrna splicing machinery. Nerea Allende-Vega, Saurabh Dayal, Usha Agarwala, Alison Sparks, Christophe Bourdon and Mark K. Saville. Jean- Supplementary
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION DOI: 1.138/NMAT3777 Biophysical regulation of epigenetic state and cell reprogramming Authors: Timothy L. Downing 1,2, Jennifer Soto 1,2, Constant Morez 2,3,, Timothee Houssin
SUPPLEMENTARY INFORMATION
Figure S1: Activation of the ATM pathway by I-PpoI. A. HEK293T cells were either untransfected, vector transfected, transfected with an I-PpoI expression vector, or subjected to 2Gy γ-irradiation. 24 hrs
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
Supporting Information
Supporting Information Tal et al. 10.1073/pnas.0807694106 SI Materials and Methods VSV Infection and Quantification. Infection was carried out by seeding 5 10 5 MEF cells per well in a 6-well plate and
SUPPLEMENTARY INFORMATION. Heterozygous mutations in PALB2 cause DNA replication and damage response defects
SUPPLEMENTARY INFORMATION Heterozygous mutations in PALB2 cause DNA replication and damage response defects Jenni Nikkilä # 1,, Ann Christin Parplys # 2, Katri Pylkäs # 1, Muthiah Bose 1,Yanying Huo 3,
Supplementary Figure S1: (A) Schematic representation of the Jarid2 Flox/Flox
Supplementary Figure S1: (A) Schematic representation of the Flox/Flox locus and the strategy used to visualize the wt and the Flox/Flox mrna by PCR from cdna. An example of the genotyping strategy is
Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after
Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3230 a GM13267(ZW) WCE C N M H 2 O 2 : p(s1981) 2 2 LDH Lamin A/C β-integrin c b d AT Flag- WT Flag- RQ H 2 O 2 IgG p (S1981) p (S1981) 2 IP: Flag N.S. 2 e f A: Untreated AT5 cells B: AT5
Mammosphere formation assay. Mammosphere culture was performed as previously described (13,
Supplemental Text Materials and Methods Mammosphere formation assay. Mammosphere culture was performed as previously described (13, 17). For co-culture with fibroblasts and treatment with CM or CCL2, fibroblasts
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rodríguez-Fraticelli et al., http://www.jcb.org/cgi/content/full/jcb.201203075/dc1 Figure S1. Cell spreading and lumen formation in confined
Mannen et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB Mannen et al., http ://www.jcb.org /cgi /content /full /jcb.201601024 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Characterization of SNB components. (A) SNB localization of Venus-tagged
Gene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG
Supplemental Data EXPERIMENTAL PROCEDURES Plasmids and Antibodies- Full length cdna of INT11 or INT12 were cloned into ps- Flag-SBP vector respectively. Anti-RNA pol II (RPB1) was purchased from Santa
Multiplex Fluorescence Assays for Adherence Cells without Trypsinization
Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating
Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,
Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for
Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence
1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for
Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by
Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by down-regulating PKA and CREB activation Sudha Saryu Malhotra 1, Pankaj Suman 2 and Satish Kumar Gupta 1 * 1 Reproductive
Supplemental Information Control of apico-basal epithelial polarity by the microtubule minus-end binding protein CAMSAP3 and spectraplakin ACF7
Supplemental Information Control of apico-basal epithelial polarity by the microtubule minus-end binding protein CAMSAP3 and spectraplakin ACF7 Ivar Noordstra, Qingyang Liu, Wilco Nijenhuis, Shasha Hua,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2743 Figure S1 stabilizes cellular protein level, post-transcriptionally. (a, b) and DDR1 were RNAi-depleted from HEK.293.-CBG cells. Western blots with indicated antibodies (a). RT-PCRs
CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration
/, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing
Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers
Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers T.R. Mereniuk et al. Supplemental tlmt Material: il Supplemental l Figures
HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
TRIM31 is recruited to mitochondria after infection with SeV.
Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker
Supplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.
Supplementary Figure 1
Supplementary Figure 1 Virus infection induces RNF128 expression. (a,b) RT-PCR analysis of Rnf128 (RNF128) mrna expression in mouse peritoneal macrophages (a) and THP-1 cells (b) upon stimulation with
Supplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1
Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded
Breast cell lines with Combination Index (CI) and p53 mutation status
Supplementary Table 1 Breast cell lines with Combination Index (CI) and p53 mutation status Cell Line CI p53 status a BT20 0.44 K132Q BT549 0.53 R249S CAL120 0.61 c.672+2t>g CAL51 0.73 wild-type CAMA1
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
Supplementary Protocol. sirna transfection methodology and performance
Supplementary Protocol sirna transfection methodology and performance sirna oligonucleotides, DNA construct and cell line. Chemically synthesized 21 nt RNA duplexes were obtained from Ambion Europe, Ltd.
Supplementary Figure 1. Additional RNAi screen data
Supplementary Figure 1. Additional RNAi screen data A. Cisplatin induced ATR autophosphorylation. Western blot illustrating ATR and phospho-atr (T1989) in cells exposed to 1 µm cisplatin for 24 hours prior
Appendix. Table of Contents: Appendix Table S1. Appendix Figure S1. Appendix Figure S2. Appendix Figure S3. Appendix Figure S4. Appendix Figure S5
Appendix Table of Contents: Appendix Table S1 Appendix Figure S1 Appendix Figure S2 Appendix Figure S3 Appendix Figure S4 Appendix Figure S5 Appendix Figure Legends 1 Cases Stain Intensity Multiple Lesions
SUPPLEMENTARY INFORMATION
DOI: 1.1/ncb2918 Supplementary Figure 1 (a) Biotin-dUTP labelling does not affect S phase progression. Cells synchronized in mid-s phase were labelled with biotindutp during a 5 min hypotonic shift (red)
Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494
Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting
SUPPLEMENTARY INFORMATION
SUPPLEMENTAY INOMATION igure S1 Knockdown of endogenous HI-1α by short-interference NA (sina) reverts EMT and metastatic phenotypes in H1299 cells and in ADU or MC-7 cells undergoing hypoxia. a. Western
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Functional assays of hepatocyte-like cells induced from H1 hescs (a) P450 and AAT staining, PAS staining, LDL uptake assay, and ICG uptake and release assay
Dual PI3K/ERK inhibition induces necroptotic cell death of Hodgkin Lymphoma cells through IER3 downregulation
Dual PI3K/ERK inhibition induces necroptotic cell death of Hodgkin Lymphoma cells through IER3 downregulation *Silvia Laura Locatelli, 1 Giuseppa Careddu, 1 Giuliano Giuseppe Stirparo, 1 Luca Castagna,
Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
Supplementary materials
Supplementary materials NADPH oxidase promotes Parkinsonian phenotypes by impairing autophagic flux in an mtorc1- independent fashion in a cellular model of Parkinson s disease Rituraj Pal 1, Lakshya Bajaj
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2774 Figure S1 TRF2 dosage modulates the tumorigenicity of mouse and human tumor cells. (a) Left: immunoblotting with antibodies directed against the Myc tag of the transduced TRF2 forms
Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information
Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information 1. Supplementary Figure S1-S10: Pages 2-11 2. Supplementary References:
Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs.
kda 65 45 45 35 Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs. H9 hescs were differentiated with or without BMP4+BMP8A and cell lysates were collected for Western analysis
PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number
Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Stock Concentration Final concentration Volume used Advanced DMEM/F12 Invitrogen 12634010-78%
(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower
Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Characterization of Hi-C/CHi-C dynamics and enhancer identification. (a) Scatterplot of Hi-C read counts supporting contacts between domain boundaries. Contacts enclosing domains
Supplemental Figure Legends:
Supplemental Figure Legends: Fig S1. GFP-ABRO1 localization. U2OS cells were infected with retrovirus expressing GFP- ABRO1. The cells were fixed with 3.6% formaldehyde and stained with antibodies against
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and
SUPPLEMENTARY MATERIALS AND METHODS Chromatin Immunoprecipitation for qpcr analysis Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and IL24, all located on chromosome 1. Primer
Quantitative real-time RT-PCR analysis of the expression levels of E-cadherin
Supplementary Information 1 Quantitative real-time RT-PCR analysis of the expression levels of E-cadherin and ribosomal protein L19 (RPL19) mrna in cleft and bud epithelial cells of embryonic salivary
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Data 1 Description: Complete mass isotopomer distribution
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,
Sarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
Supplementary Information
Supplementary Information Supplementary Figures Supplementary Figure 1. qrt-pcr analysis of the expression of candidate factors including SOX2, MITF, PAX3, DLX5, FOXD3, LEF1, MSX1, PAX6, SOX2 and SOX9
BmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone
Generation and culture of bone marrow-derived dendritic cells (bmdcs) BmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone marrow cells from murine tibias and femurs
DLD1 * cl OD 570nm. OD 570nm NEAA
Figure S A. ATF4 mrna levels.2.8.6.4.2 HT8 shatf4- cl3 shatf4- cl4 ATF4 mrna levels.2.8.6.4.2 DLD shatf4-cl3 B. C. OD 57nm.7.6.5.4.3 shatf4 cl3 shatf4 cl4 OD 57nm.6.5.4.3.2.2. 2 4 6 day.. NEAA - + - +
Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr
Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then
p53 increases MHC class I expression by upregulating the endoplasmic reticulum aminopeptidase ERAP1
Supplementary Information p53 increases MHC class I expression by upregulating the endoplasmic reticulum aminopeptidase ERAP1 Bei Wang 1, Dandan Niu 1, Liyun Lai 1, & Ee Chee Ren 1,2 1 Singapore Immunology
Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining.
Supplementary materials and methods Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Cells were analyzed for phosphatidylserine exposure by an annexin-v FITC/propidium
Supplementary Figure 1: Sequence alignment of partial stem region of flaviviruses
Supplementary Figure 1: Sequence alignment of partial stem region of flaviviruses E prtoeins. Polyprotein sequences of viruses were downloaded from GenBank and aligned by CLC Sequence Viewer software.
Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of
Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,
of Medicine, Zhejiang University, Hangzhou, Zhejiang , China Michigan, 4424B MS-1, 1301 Catherine Street, Ann Arbor, MI 48109, USA.
Supplemental figure legends: Neddylation inhibitor MLN4924 suppresses growth and migration of human gastric cancer cells Huiyin Lan 1,2#, Zaiming Tang 1#, Hongchuan Jin 2, and Yi Sun 1,3,4* 1 Institute
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Analyses of ECTRs by C-circle and T-circle assays.
Supplementary Figure 1 Analyses of ECTRs by C-circle and T-circle assays. (a) C-circle and (b) T-circle amplification reactions using genomic DNA from different cell lines in the presence (+) or absence
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection
Supplementary methods Shoc2 In Vitro Ubiquitination Assay
Supplementary methods Shoc2 In Vitro Ubiquitination Assay 35 S-labelled Shoc2 was prepared using a TNT quick Coupled transcription/ translation System (Promega) as recommended by manufacturer. For the
Description of Supplementary Files. File name: Supplementary Information Description: Supplementary figures and supplementary tables.
Description of Supplementary Files File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Supplementary Data 1 Description: Differential expression
promote ROS production and metastasis of HCC cells
MCU-dependent mitochondrial Ca 2+ inhibits NAD+/SIRT3/SOD2 pathway to promote ROS production and metastasis of HCC cells Tingting Ren 1#, Hui Zhang 2#, Jiaojiao Wang 1, Jianjun Zhu 1, Mingpeng Jin 1,Yousheng
Hyper sensitive protein detection by Tandem-HTRF reveals Cyclin D1
Hyper sensitive protein detection by Tandem-HTRF reveals Cyclin D1 dynamics in adult mouse Alexandre Zampieri, Julien Champagne, Baptiste Auzemery, Ivanna Fuentes, Benjamin Maurel and Frédéric Bienvenu
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time
Supplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
Supplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge
Supplement Figure 1 Plin5 Plin2 Plin1 KDEL-DSRed Plin-YFP Merge Supplement Figure 2 A. Plin5-Ab MitoTracker Merge AML12 B. Plin5-YFP Cytochrome c-cfp merge Supplement Figure 3 Ad.GFP Ad.Plin5 Supplement
Table S1. Primer sequences
Table S1. Primer sequences Primers for quantitative PCR Tgf 1 Forward Tgf 1 Reverse Tgf 2Forward Tgf 2Reverse Tgf 3 Forward Tgf 3 Reverse Tgf r1 Forward Tgf r1 Reverse Tgf r2 Forward Tgf r2 Reverse Thbs1