Supplemental Data. Fan et al. (2014). Plant Cell /tpc
|
|
|
- Abner Gervase Joseph
- 5 years ago
- Views:
Transcription
1 Supplemental Data. Fan et al. (). Plant Cell./tpc.. Cell wall EXP EXP EXP9 HLH/bHLH AIF HFR HBI PAR ABAR Atg778 At3g39 Atg38 Atg3 EXP EXP6 EXP8 Photosynthesis PSAD- PSAD- PSBY PSBO- PSAN LHCB6 PSBS LHCB EXPB EXLB XTH7 LHCB3 LHCB. FtSH8 IBH UPB PIF BIM AIF AIF3 AIF PAR XTH XTH3 XTH3 LHCB. PSAF PSAE- PSAK PSAL PSAP CESA7 CESA8 CSLB3 PSBQ PSBP- PSBW LHCA LHCA3 SIB BEE SPCH PYE SPT KDR Atg ORG Atg78 ORG3 Atg697 HEC Atg86 HEC At3g69 ATFIT Atg3 GASA family GASA3 GASA GASA6 GASA7 GASA Cytochrome P family protein CYP76A CYP79B CYP7A CYP7A CYP7A CYP79B3 CYP7A CYP7A7 CYP7A3 CYP8F CYP78A CYP76A CYP7B6 CYP8C CYP7B37 CYP73A CYP7B3 CYP8C3 CYP8F CYP7B BUS CYP76A6 CYP7B CYP8C REF CYP7A CYP8D AtG363 CYP7A9 CYP7A8 CYP8D HBI MAPK MPK WRKY WRKY3 WRKY33 WRKY Plant U-box PUB WRKY6 WRKY7 WRKY7 PUB3 WRKY9 VQ motif-containing protein VQ VQ VQ8 VQ3 Calmodulin-like family CML37 CML CML3 SIB/VQ3 PUB Disease resistance NBS-LRR family Atg89 Atg7 Atg Atg36 Atg76 Atg383 Extensin AtG7 At3G666 CML AtG6 AtG6 At3G667 AtG738 FAD-binding Berberine family protein Atg638 Atg6 Atg37 Atg86 Atg83 Atg Atg37 Atg373 Atg Glutathione-S-transferase GST GSTU GSTU GST GSTF3 GSTU8 GSTU7 GSTF GSTU GSTU GSTU -oxoglutarate (OG) and Fe(II)- dependent oxygenase superfamily At3g36 Atg8 At3g9 Atg939 Atg Atg866 Atg66 Atg Atg7733 Supplemental Figure. Representative HBI-binding and HBI-regulated genes with known functions in various developmental and cellular processes. Genes induced or repressed by HBI are in red or blue, respectively. Direct HBI-binding target genes are underlined. Genes induced or repressed by flg are in yellow or gray background, respectively.
2 Supplemental Data. Fan et al. (). Plant Cell./tpc.. A B 3 8 Col HBI-Ox PRE KDR IBH AIF PAR PAR 7 Relative HBI enrichment 6 3 PPA PRE KDR IBH PAR PAR Supplemental Figure. Growth-promoting and growth-inhibiting HLH factors are directly repressed and induced by HBI, respectively. (A) Quantitative RT-PCR analysis of the expression of PRE, KDR, IBH, AIF, PAR and PAR. PPA was used as the internal control. The wild-type and HBI-Ox plants were grown in half-strength MS medium under constant light for five days. Error bars indicate SD from three biological repeats. Asterisk indicates significant difference from wild-type (t test; P<.). (B) Quantitative ChIP-PCR analysis of HBI binding to the promoter of selected genes. The chromatin of phbi::hbi-yfp and 3S::YFP transgenic plants was immunoprecipitated with anti-yfp antibody, and the precipitated DNA was quantified by qpcr. Enrichment of DNA was calculated as the ratio between phbi::hbi-yfp and 3S::YFP, normalized to that of the PPA coding region. Error bars indicate SD of three biological repeats. Asterisk indicates significant difference from control gene PPA (t test; P<.).
3 Supplemental Data. Fan et al. (). Plant Cell./tpc.. A PIF up PIF up HBI up PIF up HBI down PIF down PIF down HBI up PIF down HBI down HBI up HBI down Genomic Percentage of genes.% 8.%.%.%.%.%.% B Hypocotyl length (mm) Supplemental Figure 3. HBI and PIF have overlapping and distinct functions (A) GO analyses of HBI- and PIF-regulated genes. Numbers indicate the percentage of genes belonging to each GO category. Asterisk indicates significant difference from genomic random (Fisher exact test; P<.). (B) Growth of wild-type, pifq, HBI-Ox and HBI-Ox/pifq in the dark for 6 days. Bottom graph shows the quantification of hypocotyl lengths. Asterisk indicates significant difference from wildtype (t test; P<.). Error bars indicate SD from three biological repeats.
4 Supplemental Data. Fan et al. (). Plant Cell./tpc.. A HBI Up HBI Down Elf8 Up 9 6 Elf8 Down B HBI-Ox vs WT C R= M Elf8 - Elf8 vs Mock D % Relative fresh weight % 8% 6% % % M Elf8 E Relative fresh weight % % 8% 6% % % F Flg treatment M Relative Light Units 7 Col Elf8 HBI-Ox Elf8 % Col WT HBI-Ox % Time after elf8 treatment (min) Supplemental Figure. HBI negatively regulates elf8- and flg-mediated PTI responses. (A) Table shows the overlaps between gene sets regulated by HBI and elf8. (B) Scatter plot of log fold change values of the genes co-regulated by HBI and elf8. (C) Quantitative RT-PCR analysis of RNA levels of HBI and its homologs in -week old plants treated with mock (M) or µm elf8 for 3 hours. PPA was used as the internal control. Error bars indicate SD from three biological repeats. Asterisk indicates significant difference from Col with mock treatment. (t test; P<.). (D) Elf8-dependent inhibition of wild-type (Col) and HBI-Ox seedling growth. Seedlings were grown in half-strength MS medium for days, then transferred to liquid half-strength MS medium without (M) or with µm elf8 for another 8 days. Growth is represented relative to untreated plants. Error bars indicate SD from three biological repeats. Asterisk indicates significant difference from wild-type (t test; P<.). (E) Growth of wild-type (Col) and two independent lines of Ox-HBI-MH in the absence (M) or presence of flg ( and nm). Growth is represented as fresh weight relative to untreated plants. Error bars indicate SD from three biological repeats. (F) Oxidative burst triggered by µm elf8 in leaf discs of wild-type and HBI-Ox plants. Error bars indicate SD from twelve biological repeats.
5 Supplemental Data. Fan et al. (). Plant Cell./tpc.. A Atg77 B PR C 3 7 M Flg 3..7 M Flg WT HBI-Ox WT HBI-Ox 3.9 WT JAZ6 M Flg.9 HBI-Ox D 9. MPK M Flg E 8 6. flg Col 3 HBI-Ox 3 Min MAPK6 MAPK3 ponceau WT HBI-Ox Supplemental Figure. Activation of HBI results in the suppression of PTI marker gene expression, but not MAPK activation. (A-D) Quantitative RT-PCR analyses of flg effects on the expression of defense-related genes in wild type and HBI-Ox. The wild-type and HBI-Ox plants were grown in half-strength MS medium under constant light for weeks, and then treated with mock (M) or µm flg for 3 hours. PPA was used as the internal control. Error bars indicate SD from three biological repeats. Asterisk indicates significant difference from flg treatment between wild-type and HBI- Ox (t test; P<.). (E) Immunoblot analysis of flg-induced ( um) MAPK phosphorylation in -week-old Col and HBI-Ox seedlings. Arrowheads indicate phosphorylated MPK3 and MPK6. Blot stained with ponsceau S is presented to show equal loading. Immunoblots were probed with anti-phosphop/ MAPK (Erk/) (Thr/Tyr) antibody (Cell signaling).
6 Supplemental Data. Fan et al. (). Plant Cell./tpc...6 Mock Flg..8. BEE BEE3 CIB CIB3 CIB CIBL BPE BPEL ACE Supplemental Figure 6. Quantitative RT-PCR analyses of flg effects on the expression of HBI homologous genes. The wild-type plants were grown in half-strength MS medium under constant light for weeks, and then treated with mock or µm flg for 3 hours. PPA was used as the internal control. Error bars indicate SD from three biological repeats. Asterisks indicate significant difference from the mock treatment (t test; P<.).
7 Supplemental Data. Fan et al. (). Plant Cell./tpc.. Gene HBI-Ox vs WT RT-qPCR RNA-Seq Atg ± Atg ±.6 - WRKY ±. -. Atg6 -. ± VQ8 -.9 ±.8 -. MPK -.3 ±. -3. KDR -.78 ± BEE -. ± IBH.79 ±.. AIF.8 ±.3. EXP8. ±..3 EXP.6 ±.. PIF. ±.7. Supplemental Table. Quantitative RT-PCR validation of the RNA-Seq data. Seedlings of wild-type (WT) and HBI-Ox plants were grown in half-strength MS medium under constant light for days. The RT-qPCR data were normalized to PPA, and the average ratio (in log) between HBI-Ox and WT and the standard deviation were calculated from three biological repeats. Significant difference between HBI-Ox and WT (p<.). RNA-Seq data are from Supplemental Table.
8 Supplemental Data. Fan et al. (). Plant Cell./tpc.. RT-PCR primers PPA RTF PPA RTR EXPRTF EXPRTR EXP8RTF EXP8RTR CPDRTF CPDRTR DWFRTF DWFRTR BR6OXRTF BR6OXRTR FRKRTF FRKRTR Atg77 RTF Atg779 RTR PRRTF PRRTR JAZ6RTF JAZ6RTR HBIRTF HBIRTR BEERTF BEERTR BEERTF BEERTR BEE3RTF BEE3RTR CIBRTF CIBRTR CIBRTF CIBRTR ACERTF ACERTR tatcggatgacgattcttcgtgcag gcttggtcgactatcggaatgagag GCTTACCGAAGGCTTACCGAAG CTTGACATCGCTTGCCATCCAG tcctcctcttcagcatttcgacct cttgccacgactgtgtttttgagc TTGCTCAACTCAAGGAAGAG TGATGTTAGCCACTCGTAGC cataaagctcttcagtcacga cgtctgttctttgtttcctaa TCGGGTTACGAAACTGTCTCTACG CCTGAATGCCAAATGCTCAGCTC ATCTTCGCTTGGAGCTTCTC TGCAGCGCAAGGACTAGAG TGCTCCATCTCTCTTTGTGC ATGCGTTGCTGAAGAAGAGG AAGGGTTCACAACCAGGCAC CACTGCATGGGACCTACGC cgtggtgattcccgatcttaacgag tgggaggaagatgactaccgtgttg TGCCTGGATGCAATAAGGTCACAG TGGAGCTTCGATAGATGTCGTTTGG CAGTTTCAGGCTTACTTCACAGGT CTTTAGCGCCGAGAGATGTGGT TGGTGCCCGGATGTTATAAGGC GCTGCAGTGAGTTTCATCGAGAGG TGCTGTGGAATCCATGCAGAAG AGGGTCCACGATGATGAATGGAAG aggccggattttgatatggatgac ttgctgcattggattgacatgaagg TGTCCACATGAACCATGAAACCG CTCCACCTTCATGTCAGCTGTTG GCAACTGTGAACCCACAAATGGAC ACCAGCTCGTAGTTGAAGTGCATC ChIP-PCR primers PPA ChIP-F PPA ChIP-R EXPChIPF EXPChIPR EXP8ChIPF EXP8ChIPR DWFChIPF DWFChIPR CPDChIPF CPDChIPR BR6OXChIPF BR6OXChIPR CGGCTTTCATGATTCCCTCT GCCTTAAGCTCCGTTTCCTACTT TGTATGCGAAGCACACAAAGACATC GATGGAGGTGCCTTAATATAAACGC CACAACCTTCAAAGTCCCT CAACAATGTATGCCACCG acgagaaaacggcatgtgaaattgg gatactttgggcacgtccatgtgttc gagagacatgtgaagtgttcatag gttcgatgaatgtagtcagtgttagattc accgtaatcatggttatgcctagagc tgccttgtgatgattgagcgcacg Supplemental Table. Oligonucleotide sequences used in this paper
Supplemental Data. Bai et al. Plant Cell. (2012) /tpc A
A B Unconserved Conserved AIF4 AIF2 AIF3 AIF1 UPB1 IBH1 Supplemental Figure 1. IBH1, UPB1 and AIFs belong to the same HLH family. (A), Part of a phylogenetic tree constructed using conserved domains shows
Supplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
AD BD TOC1. Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between
AD X BD TOC1 AD BD X PIFΔAD PIF TOC1 TOC1 PIFΔAD PIF N TOC1 TOC1 C1 PIFΔAD PIF C1 TOC1 TOC1 C PIFΔAD PIF C TOC1 Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between PIF and TOC1
SUPPLEMENTARY INFORMATION
DOI:.38/ncb54 sensitivity (+/-) 3 det- WS bri-5 BL (nm) bzr-dbri- bzr-d/ bri- g h i a b c d e f Hypcocotyl length(cm) 5 5 PAC Hypocotyl length (cm)..8..4. 5 5 PPZ - - + + + + - + - + - + PPZ - - + + +
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
Supplemental Data. Liu et al. (2013). Plant Cell /tpc
Supplemental Figure 1. The GFP Tag Does Not Disturb the Physiological Functions of WDL3. (A) RT-PCR analysis of WDL3 expression in wild-type, WDL3-GFP, and WDL3 (without the GFP tag) transgenic seedlings.
Supplemental Figure 1. Phos-Tag mobility shift detection of in vivo phosphorylated ERF6 in 35S:ERF6 WT plants after B. cinerea inoculation.
Supplemental Figure 1. Phos-Tag mobility shift detection of in vivo phosphorylated ERF6 in 35S:ERF6 WT plants after B. cinerea inoculation. Protein extracts from 35S:ERF6 WT seedlings treated with B. cinerea
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/244/ra72/dc1 Supplementary Materials for An Interaction Between BZR1 and DELLAs Mediates Direct Signaling Crosstalk Between Brassinosteroids and Gibberellins
Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN
A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression
Nature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1
INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot
ABI3 Controls Embryo De-greening Through Mendel's I locus
Supporting Online Material for ABI3 Controls Embryo De-greening Through Mendel's I locus Frédéric Delmas a,b,c, Subramanian Sankaranarayanan d, Srijani Deb d, Ellen Widdup d, Céline Bournonville b,c,norbert
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
Supplemental Data. Li et al. (2015). Plant Cell /tpc
Supplemental Data Supplemental Figure 1: Characterization of asr3 T-DNA knockout lines and complementation transgenic lines. (A) The scheme of At2G33550 (ASR3) with gray boxes indicating exons and dash
Supplemental Data. Seo et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Protein alignment of ABD1 from other model organisms. The alignment was performed with H. sapiens DCAF8, M. musculus DCAF8 and O. sativa Os10g0544500. The WD40 domains are underlined.
Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
Supplemental Data. Tilbrook et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Protein alignment of with. Identical aligned residues highlighted in black and similar and non-similar residues highlighted in grey and white, respectively. Position of Trp residues
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line
Coleman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
Supplemental Data. Furlan et al. Plant Cell (2017) /tpc
Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Figure.
Supplementary information
Supplementary information Supplementary figures Figure S1 Level of mycdet1 protein in DET1 OE-1, OE-2 and OE-3 transgenic lines. Total protein extract from wild type Col0, det1-1 mutant and DET1 OE lines
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10928 Materials and Methods 1. Plant material and growth conditions. All plant lines used were in Col-0 background unless otherwise specified. pif4-101 mutant
Supplementary Information
Supplementary Information Supplementary Fig. 1. Seed dormancy and germination responses of RVE1 and PIF1. (a) Diagram of RVE1 and the T-DNA insertion of the rve1-2 mutant (SAIL_326_A01). Black boxes represent
Supplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
Supplemental Data. Sun et al. Plant Cell. (2012) /tpc FLS2 -cmyc -GFP FLS2 -HA. FLS2-FLAG FLS2 -HA BAK1-HA flg22 (10mM)
Supplemental Data. Sun et al. Plant ell. ()..5/tpc..9599 A FLS-FLA FLS -HA BAK-HA flg (mm) - B FLS -cmyc -FP FLS -HA IP antibody cmyc FLA FP cmyc IP ; WB: α-ha IP; WB: α-ha IP: α-fla; WB: α-ha IP ; WB:
Supplemental Figure S1. Validation of auxin-related gene expression from Fig. 1A. Relative gene expression in 2x and 3x seeds 6 days after
Supplemental Figure S1. Validation of auxin-related gene expression from Fig. 1A. Relative gene expression in 2x and 3x seeds 6 days after pollination (6 DAP), as determined by RT-qPCR for YUC10 (A), YUC11
S156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Supplemental Materials Supplemental Figure S1 (a) Phenotype of the wild type and grik1-2 grik2-1 plants after 8 days in darkness.
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
Supplementary Material and Methods
Supplementary Material and Methods Microarray Total RNA was extracted from three independent batches of plants using Tri-Reagent (Ambion, Austin, TX, USA). From each batch of wild type (Col- 0) and wrky33
Supplemental Figure 1. Alignment of the NbGAPC amino acid sequences with their Arabidopsis homologues.
Supplemental Figure 1. Alignment of the NbGAPC amino acid sequences with their Arabidopsis homologues. Homologs from N. benthamiana (NbGAPC1, NbGAPC2, NbGAPC3), Arabidopsis (AtGAPC1, AT3G04120; AtGAPC2,
Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.
Supplementary Figure 1 lision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK, PPK3 and PPK respectively. % of nuclei with signal / field a 5 c ppif3:gus pppk1:gus 0 35 30 5 0 15 10
Supplementary Information
Supplementary Information COP1 E3 ligase protects HYL1 to retain microrna biogenesis Seok Keun Cho 1, Samir Ben Chaabane 1, Pratik Shah 1, Christian Peter Poulsen 1, and Seong Wook Yang 1 * 1 Laboratory
Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
SUPPLEMENTARY INFORMATION
Ca 2+ /calmodulin Regulates Salicylic Acid-mediated Plant Immunity Liqun Du, Gul S. Ali, Kayla A. Simons, Jingguo Hou, Tianbao Yang, A.S.N. Reddy and B. W. Poovaiah * *To whom correspondence should be
A Repressor Complex Governs the Integration of
Developmental Cell 15 Supplemental Data A Repressor Complex Governs the Integration of Flowering Signals in Arabidopsis Dan Li, Chang Liu, Lisha Shen, Yang Wu, Hongyan Chen, Masumi Robertson, Chris A.
Supplemental Data. Wang et al. Plant Cell. (2013) /tpc
SNL1 SNL Supplemental Figure 1. The Expression Patterns of SNL1 and SNL in Different Tissues of Arabidopsis from Genevestigator Web Site (https://www.genevestigator.com/gv/index.jsp). 1 A 1. 1..8.6.4..
AD-FIL AD-YAB2 -2 BD-JAZ3 AD-YAB3 AD-YAB5 AD-FIL -4 3AT BD-JAZ3 AD-YAB3
3 4 9 10 11 12 AD-FIL AD-YAB5 2 B AD-YAB3 1 BD-JAZ 5 6 7 8 AD-FIL A AD-YAB2 Supplemental Data. Boter et al. (2015). Plant Cell 10.1105/tpc.15.00220 BD AD-YAB2-2 -2 BD-JAZ3 AD-YAB3 BD AD-YAB5-4 AD-FIL -4
Supplemental Data. Jing et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Characterization of epp1 Mutants. (A) Cotyledon angles of 5-d-old Col wild-type (gray bars) and epp1-1 (black bars) seedlings under red (R), far-red (FR) and blue (BL) light conditions,
Kwon et al., Supplemental Figure 1
Kwon et al., Supplemental Figure 1 Mock, 14 dpi AvrRpm1, 14 dpi RabG3bDN RabG3bRNAi Supplemental Figure S1. Cell death phenotypes of leaves inoculated with Pst DC3000 (AvrRpm1) in 5-week-old young plants.
Supplemental Figure 1. Conserved regions of the kinase domain of PEPR1, PEPR2, CLV1 and BRI1.
Supplemental Figure 1. Conserved regions of the kinase domain of PEPR1, PEPR2, CLV1 and BRI1. The asterisks and colons indicate the important residues for ATP-binding pocket and substrate binding pocket,
SUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
Supplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.
Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution
- 1 - Supplemental Data
- 1-1 Supplemental Data 2 3 4 5 6 7 8 9 Supplemental Figure S1. Differential expression of AtPIP Genes in DC3000-inoculated plants. Gene expression in leaves was analyzed by real-time RT-PCR and expression
Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated
Supplemental Data. Zhang et al. Plant Cell (2014) /tpc
Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc.114.134163 55 - T C N SDIRIP1-GFP 35-25 - Psb 18 - Histone H3 Supplemental Figure 1. Detection of SDIRIP1-GFP in the nuclear fraction by Western
Supplementary Figure Legends
Supplementary Figure Legends Figure S1 gene targeting strategy for disruption of chicken gene, related to Figure 1 (f)-(i). (a) The locus and the targeting constructs showing HpaI restriction sites. The
Supplemental Data. Steiner et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. SPY does not interact with free GST. Invitro pull-down assay using E. coli-expressed MBP-SPY and GST, GST-TCP14 and GST-TCP15. MBP-SPY was used as bait and incubated with equal amount
Supporting Information
Supporting Information Materials and Methods Plant Materials and Growth Conditions All Arabidopsis thaliana plants used in this study were of the Columbia-0 ecotype. 35S:PIF3-Myc (1), 35S:PIF4-Myc (2),
Supplemental Materials
Supplemental Materials Supplemental Figure S. Phenotypic assessment of alb4 mutant plants under different stress conditions. (A) High-light stress and drought stress. Wild-type (WT) and alb4 mutant plants
Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling
Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling development. a. Exogenous BR application overcomes the hypersensitivity of bzr1-1d seedlings to ABA. Seed germination
Supplemental Data. Zhou et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Confirmation of mutant mapping results. (A) Complementation assay with stably transformed genomic fragments (ComN-N) (2 kb upstream of TSS and 1.5 kb downstream of TES) and CaMV
Supplemental Data. Challa et al. (2016). Plant Cell /tpc
Supplemental Figure 1. DEX-induced TCP4 activity rescues jaw-d phenotypes. (A) and (B) Rosettess of 32-day-old Col-0;ProTCP4:mTCP4:GR plants (A) and jaw-d;protcp4:mtcp4:gr (B) plants grown in mock or in
Supplemental Materials
Supplemental Materials Flores-Pérez et al., Supplemental Materials, page 1 of 5 Supplemental Figure S1. Pull-down and BiFC controls, and quantitative analyses associated with the BiFC studies. (A) Controls
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Endogenous gene tagging to study subcellular localization and chromatin binding. a, b, Schematic of experimental set-up to endogenously tag RNAi factors using the CRISPR Cas9 technology,
Supplemental Data. Benstein et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Purification of the heterologously expressed PGDH1, PGDH2 and PGDH3 enzymes by Ni-NTA affinity chromatography. Protein extracts (2 µl) of different fractions (lane 1 = total extract,
Supplemental Data. Lee et al. Plant Cell. (2010) /tpc Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2.
Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2. (A) Protein structures of DWA1 and DWA2. WD40 region was determined based on the NCBI conserved domain databases (B, C) Schematic representation
Supplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
Supplementary Table, Figures and Videos
Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation
Supplemental Data. Na Xu et al. (2016). Plant Cell /tpc
Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site
Supplemental Data. Farmer et al. (2010) Plant Cell /tpc
Supplemental Figure 1. Amino acid sequence comparison of RAD23 proteins. Identical and similar residues are shown in the black and gray boxes, respectively. Dots denote gaps. The sequence of plant Ub is
Supplementary Data Supplementary Figures
Supplementary Data Supplementary Figures Supplementary Figure 1. Pi04314 is expressed during infection, each GFP-Pi04314 fusion is stable and myr GFP-Pi04314 is removed from the nucleus while NLS GFP-Pi04314
Legend for Supplemental Figures and Tables
Legend for Supplemental Figures and Tables Supplemental Fig. 1. Negative regulation of the CYP27B1 promoter in a ligand-dependent manner (A) OK-P cells were transfected with pcdna-trα, pcdna-trβ1 or pcdna3
The Arabidopsis Transcription Factor BES1 Is a Direct Substrate of MPK6 and Regulates Immunity
Supplemental Data The Arabidopsis Transcription Factor BES1 Is a Direct Substrate of MPK6 and Regulates Immunity Authors: Sining Kang, Fan Yang, Lin Li, Huamin Chen, She Chen and Jie Zhang The following
PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
Supplemental Figure S1. Nucleotide and deduced amino acid sequences of pepper CaHSP70a (Capsicum annuum heat shock protein 70a) cdna.
Supplemental Figure S1. Nucleotide and deduced amino acid sequences of pepper (Capsicum annuum heat shock protein 70a) cdna. Translation initiation codon is shown in bold typeface; termination codon is
Supplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde
Supplemental Material Igreja and Izaurralde 1 CUP promotes deadenylation and inhibits decapping of mrna targets Catia Igreja and Elisa Izaurralde Supplemental Materials and methods Functional assays and
Supplemental Figure 1. Identification of the sid2 ald1 (sid2-1 ald1) double mutant.
Supplemental Data. Bernsdorff et al. (216). Plant Cell 1.115/tpc.15.496-1 A B C Supplemental Figure 1. Identification of the sid2 ald1 (sid2-1 ald1) double mutant. (A) PCR analysis of genomic DNA isolated
Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95
Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
Supplememtal Data. Guan et al. (2013) Plant Cell /tpc
Supplememtal Data. Guan et al. (23) Plant Cell.5/tpc.2.834 A B Supplemental Figure. Hierarchical Clustering Analysis of Genes in Wild-Type Plants in Response to Cold Stress Treatments Based on Publically
Supplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1
Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded
(phosphatase tensin) domain is shown in dark gray, the FH1 domain in black, and the
Supplemental Figure 1. Predicted Domain Organization of the AFH14 Protein. (A) Schematic representation of the predicted domain organization of AFH14. The PTEN (phosphatase tensin) domain is shown in dark
Chemical hijacking of auxin signaling with an engineered auxin-tir1
1 SUPPLEMENTARY INFORMATION Chemical hijacking of auxin signaling with an engineered auxin-tir1 pair Naoyuki Uchida 1,2*, Koji Takahashi 2*, Rie Iwasaki 1, Ryotaro Yamada 2, Masahiko Yoshimura 2, Takaho
Supplemental materials
Supplemental materials Materials and methods for supplemental figures Yeast two-hybrid assays TAP46-PP2Ac interactions I. The TAP46 was used as the bait and the full-length cdnas of the five C subunits
Figure S1. nuclear extracts. HeLa cell nuclear extract. Input IgG IP:ORC2 ORC2 ORC2. MCM4 origin. ORC2 occupancy
A nuclear extracts B HeLa cell nuclear extract Figure S1 ORC2 (in kda) 21 132 7 ORC2 Input IgG IP:ORC2 32 ORC C D PRKDC ORC2 occupancy Directed against ORC2 C-terminus (sc-272) MCM origin 2 2 1-1 -1kb
pgbkt7 Anti- Myc AH109 strain (KDa) 50
pgbkt7 (KDa) 50 37 Anti- Myc AH109 strain Supplementary Figure 1. Protein expression of CRN and TDR in yeast. To analyse the protein expression of CRNKD and TDRKD, total proteins extracted from yeast culture
Supplementary Figure 1.
Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
Supplementary Materials
Supplementary Materials Table S1. Oligonucleotide sequences and PCR conditions used to amplify the indicated genes. TA = annealing temperature; gdna = genomic DNA; cdna = complementary DNA; c = concentration.
Supplemental Data. Guo et al. (2015). Plant Cell /tpc
Supplemental Figure 1. The Mutant exb1-d Displayed Pleiotropic Phenotypes and Produced Branches in the Axils of Cotyledons. (A) Branches were developed in exb1-d but not in wild-type plants. (B) and (C)
Poly-A signals. amirna. pentr/d-topo for Gateway cloning
popon inducible system A Poly-A signals CaMV 35S minimal promoter TMV omega translational enhancer HYG KAN RR 35S 35S LhGR GUS Ω pop6 Ω Gene construct B - Dex + Dex CACC prs300 (mir319a) CACC amirna pentr/d-topo
Supplemental Data. Hu et al. Plant Cell (2017) /tpc
1 2 3 4 Supplemental Figure 1. DNA gel blot analysis of homozygous transgenic plants. (Supports Figure 1.) 5 6 7 8 Rice genomic DNA was digested with the restriction enzymes EcoRⅠ and BamHⅠ. Lanes in the
Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
Supplemental Figure 1 A
Supplemental Figure 1 A Supplemental Data. Han et al. (2016). Plant Cell 10.1105/tpc.15.00997 BamHI -1616 bp SINE repeats SalI ATG SacI +1653 bp HindIII LB HYG p35s pfwa LUC Tnos RB pfwa-bamhi-f: CGGGATCCCGCCTTTCTCTTCCTCATCTGC
Technical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
indicated numbers of pups at day of life (DOL) 10, or embryonic day (ED) B. Male mice of
SUPPLEMENTRY FIGURE LEGENDS Figure S1. USP44 loss leads to chromosome missegregation.. Genotypes obtained from the indicated numbers of pups at day of life (DOL) 10, or embryonic day (ED) 13.5.. Male mice
SUPPLEMENTAL INFORMATION
SUPPLEMENTL INFORMTION P. syringae Genotype; relevant features a bbreviation Reference pv. tomato DC Wild Type; Rf R DC Cuppels, D.. 98 CUCP ΔhrcC::nptII, TSS -, Km R in hrp inducing media ΔhrcC Peñaloza-
At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
Figure S1. DELLA Proteins Act as Positive Regulators to Mediate GA-Regulated Anthocyanin
Supplemental Information Figure S1. DELLA Proteins Act as Positive Regulators to Mediate GA-Regulated Anthocyanin Biosynthesis. (A) Effect of GA on anthocyanin content in WT and ga1-3 seedlings. Mock,
Effects of metformin on Sirt1, Nrf2 and AhR expression in cancer cells
A Dissertation for the Degree of Doctor of Philosophy Effects of metformin on Sirt1, Nrf2 and AhR expression in cancer cells Department of Pharmacy Graduate School Chungnam National University By Minh
Supplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.
Supplementary Materials: 1. Supplementary Figures S1-S9. 2. Supplementary Tables S1-S2
Supplementary Materials: 1. Supplementary Figures S1-S9 2. Supplementary Tables S1-S2 S1 1. Supplementary Figures Fig. S1. Genotypes of tcp20 mutants. Fig. S2. Root phenotypes of tcp20 mutants. Fig. S3.
WiscDsLox485 ATG < > //----- E1 E2 E3 E4 E bp. Col-0 arr7 ARR7 ACTIN7. s of mrna/ng total RNA (x10 3 ) ARR7.
A WiscDsLox8 ATG < > -9 +0 > ---------//----- E E E E E UTR +9 UTR +0 > 00bp B S D ol-0 arr7 ol-0 arr7 ARR7 ATIN7 D s of mrna/ng total RNA opie 0. ol-0 (x0 ) arr7 ARR7 Supplemental Fig.. Genotyping and
ATL1-GFP Marker-mCherry/RFP Merge B C D
Input IP:α-H EDR1-H stedr1-h EV EDR1-H stedr1-h EV α-h α-mcherry TL1-GFP Marker-mCherry/RFP Merge C D GmMan49-mCherry mcherry-syp21 VH-a1-RFP E F G H I J EDR1-nYFP+TL1-cYFP ra6-mcherry Merge K L M Supplemental
supplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
Supplemental Figure 1. Rosette Leaf Morphology of Single, Double and Triple Mutants of eid3, phya-201 and phyb-5. Photographs of Ler wild type,
Supplemental Figure 1. Rosette Leaf Morphology of Single, Double and Triple Mutants of eid3, phya-201 and phyb-5. Photographs of Ler wild type, phya-201, phyb-5, phya-201 phyb-5, eid3, phya-201 eid3, phyb-5
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis seedlings expressing ERF109pro-GUS. The GUS staining
Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana.
SUPPLEMENTARY FIGURES Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. YFP:, :CFP, HA: and (A) and HA, CFP and YFPtagged and AVR1-CO39 (B) were expressed
Supplementary Figures 1-12
Supplementary Figures 1-12 Supplementary Figure 1. The specificity of anti-abi1 antibody. Total Proteins extracted from the wild type seedlings or abi1-3 null mutant seedlings were used for immunoblotting