Supplementary Figure 1. Comparison of nodules from Gifu and epr3-9 plants inoculated with M. loti MAFF and incubated at 21 C or 28 C.
|
|
|
- Jean Bryant
- 6 years ago
- Views:
Transcription
1 Supplementary Figure 1. Comparison of nodules from Gifu and epr3-9 plants inoculated with M. loti MAFF and incubated at 21 C or 28 C.
2 (a to l) are at 21 C, and (m to å) are at 28 C. (a, e, i, m, q, v, z) Visual appearance of representative wild-type (Gifu) and epr3-9 nodules (28 dpi). (b, f, j, n, r, w, æ) Light microscopy of the sectioned nodules shows the infection pattern. (c, d, g, h, k, l, o, p, s, t, u, x, y, ø, å) Transmission electron micrographs show the bacteroids enclosed in the symbiosome membrane and (d, h) infection threads (red arrows) containing rhizobia. (l, s, t, y) Nodules of epr3-9 with infections between cells (yellow arrows). In epr3-9 nodules, symbiosomes containing several bacteroids and infections between cells are frequently observed at 28 C. (x) Several cells appeared to be undergoing degradation (yellow star). (Ø)Several bacteroids enclosed within the same symbiosome membrane (red star). Scale bars: 500 µm (a, e, i, m, q, v, z), 200 µm (b, f, j, n, r, w, æ), 2 µm (g, h, k, o, s, t, u, j, x, y, ø), and 1 µm (c, d, å).
3 Supplementary Figure 2. pepr3:gus, pnfr1:gus and pnfr5:gus activity in Gifu in response to M. loti. Wild-type plants transformed with the pepr3:gus reporter (a-f), pnfr1:gus (g-j) and pnfr5:gus (k-m) were inoculated with M. loti and stained for GUS activity at time points (a) 1 dpi, (b) 3 dpi, (c) 5 dpi, (d) 7 dpi and (e) 14 dpi. (f) Uninoculated pepr3:gus transformed wild-type showed no staining. (h, i, j, l, n, m) 7 dpi or 21 dpi. (g, k) Uninoculated roots expressing pnfr1:gus and pnfr5:gus are shown. pepr3:gus, pnfr1:gus and pnfr5:gus activity are lower and cease in older nodules (red arrows). Scale bars are 2 mm, except for h-1 mm and l- 0,5 mm.
4 Supplementary Figure 3. pnfr1:tyfp-nls and pnfr5:tyfp-nls activity in uninoculated Gifu roots. Gifu roots transformed with pnfr1:tyfp-nls (a, c, d, e) and pnfr5:tyfp-nls (b, f, g, h). e and h are cross sections. a, b; scale bars are 200 µm, c-h; scale bars are 50 µm.
5 Supplementary Figure 4. Activity of pepr3:gus in nodule primordia of Lotus mutants. Lotus mutants transformed with pepr3:gus. (a) Gifu, (b) cyclops-2, (c) nsp1-1, (d) nena-1, (e) ern1-2, (f) snf1, (g) snf1har1-3, (h) snf2 and (i) snf2har1-3. (a to e) are 10 to 21 dpi with R7A. (f to i) spontaneous nodules formed in the absence of rhizobia. Bars are 250 µm.
6 Supplementary Figure 5. Relative expression of Epr3 (a) The graph shows Epr3 transcript levels measured by RT-qPCR in Gifu roots treated with 10-8 M BAP or 10-7 M Nod factor for 3 to 12 hours relative to 0 h/mock treatment. (b, c) Transcript levels measured by RT-qPCR at (b) 3 dpi and (c) 14 dpi. Bars show 95% confidence interval.
7 Supplementary Figure 6. Nodulation kinetics of Gifu and epr3 mutants at 21 C or 28 C. (a, b) Number of mature (pink) and immature (white) nodules formed by L. japonicus Gifu and epr3-9 and epr3-11 mutants after inoculation with Mesorhizobium loti R7A (a) or MAFF (b), when grown at 21 C or 28 C. * (p< 0.05, student s t-test, n 29) and ** (p< 0.01, student s t-test, n 29) indicate significant differences in the number of mature pink nodules formed on epr3 mutants compared to Gifu. (c) Nodulation kinetics of L. japonicus Gifu inoculated with R7A or R7AexoB and grown at 28 C. # (p< 0.05, student s t- test, n 29) and ## (p< 0.01, student s t-test, n 29) indicate significant differences in the number of mature pink nodules, and % (p< 0.05, student s t-test, n 29) and %% (p< 0.01, student s t-test, n 29) indicate significant differences in the number of immature white
8 nodules formed on Gifu inoculated with R7AexoB compared to R7A. These error bars are SE.
9 Supplementary Table 1. Epr3 promoter activity in Lotus symbiotic mutants. M. loti pepr3:gus expression Plant n= inoculation epidermal cortical Nodule primordia Gifu Gifu nfr nfr symrk pollux /(+) ** nup /(+) ** nena /(+) ** ccamk cyclops /(+) * + + cerberus nsp nsp nin ern nap pir lhk har snf snf snf1har snf2har * a very reduced expression ** temperature dependent for nodule formation
10 Supplementary Table 2. List of EMSA probes and primer sets name sequence (5 to 3 ) tag at 5 Nin 1 ATACCCTGCCCTTACAGACAAGTATAAGAGGCACAAAA 6-FAM at 5 Nin 1 complement TTTTGTGCCTCTTATACTTGTCTGTAAGGGCAGGGTAT - Nin 1 mutation ATACCCTGCCTTTTCAGACAAGTACCCGAGGCACAAAA 6-FAM at 5 Nin 1 mutation complement TTTTGTGCCTCGGGTACTTGTCTGAAAAGGCAGGGTAT - Ern1 TGTCATTGTTATAGCCGTCTGAGATCCCAC 6-FAM at 5 Ern1 complement GTGGGATCTCAGACGGCTATAACAATGACA - Ern1 mutation TGTCATTGTTATATTTGTCTGAGATCCCAC 6-FAM at 5 Ern1 mutation complement GTGGGATCTCAGACAAATATAACAATGACA bp 329 bp 280 bp 280 bp ERN1 mut (mut 1) 280 bp NIN1 mut (mut 2) 257 bp 257 bp NIN1 mut Nsp2 gene fw (5 to 3 ) CAACATAGATAAAAACAATTAG fw (5 to 3 ) GAAGTGGTGGAACAGTCTGTG fw (5 to 3 ) TTTGTCATTGTTATAGCCGTCTG fw (5 to 3 ) TTTGTCATTGTTATATTTGTCTG fw (5 to 3 ) TTTGTCATTGTTATAGCCGTCTGAGATCCCACAAAAGATACCCTGCCTTTTCAGACAAGTACCCGAGGCA fw (5 to 3 ) AGATCCCACAAAAGATACCCTG fw (5 to 3 ) AGATCCCACAAAAGATACCCTGCCTTTTCAGACAAGTACCCGAGGCAC fw (5 to 3 ) ATGGAAATGGATATAGATTGCATC rev (5 to 3 ) CAGCTATGCACAATCTGATTCTG All primers were added attb site for Gateway
Supplementary Figure S1 Selected examples of nodulation with M. loti in plate experiments
Supplementary Figure S1 Selected examples of nodulation with M. loti in plate experiments Supplementary Table S1 Complete data set for ccamk-13snf2 and hit1snf1 experiments Supplementary Table S2 M. loti
NODULE INCEPTION Directly Targets NF-Y Subunit Genes to Regulate Essential Processes of Root Nodule Development in Lotus japonicus
NODULE INCEPTION Directly Targets NF-Y Subunit Genes to Regulate Essential Processes of Root Nodule Development in Lotus japonicus Takashi Soyano, Hiroshi Kouchi, Atsuko Hirota, Makoto Hayashi* National
Supporting Online Material for
www.sciencemag.org/cgi/content/full/327/5969/1126/dc1 Supporting Online Material for A Nodule-Specific Protein Secretory Pathway Required for Nitrogen- Fixing Symbiosis Dong Wang, Joel Griffitts, Colby
Supplemental Data. Shimoda et al. (2011). Plant Cell /tpc B C D E
(kda) 80 58 46 30 25 B C D E (0/15) (29/29) (0/29) (0/32) Supplemental Figure 1. Immunodetection of Myc-tagged CCaMK Protein Variants on ccamk-3 Roots. () Immunodetection of myc-tag fusion CCaMK WT, 1-340
GTTCGGGTTCC TTTTGAGCAG
Supplementary Figures Splice variants of the SIP1 transcripts play a role in nodule organogenesis in Lotus japonicus. Wang C, Zhu H, Jin L, Chen T, Wang L, Kang H, Hong Z, Zhang Z. 5 UTR CDS 3 UTR TCTCAACCATCCTTTGTCTGCTTCCGCCGCATGGGTGAGGTCATTTTGTCTAGATGACGTGCAATTTACAATGA
Supplemental Data. Liu et al. (2013). Plant Cell /tpc
Supplemental Figure 1. The GFP Tag Does Not Disturb the Physiological Functions of WDL3. (A) RT-PCR analysis of WDL3 expression in wild-type, WDL3-GFP, and WDL3 (without the GFP tag) transgenic seedlings.
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
Plant Physiology Preview. Published on July 21, 2017, as DOI: /pp
Plant Physiology Preview. Published on July 21, 2017, as DOI:10.1104/pp.17.00832 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 Short
Supplementary Data Supplementary Figures
Supplementary Data Supplementary Figures Supplementary Figure 1. Pi04314 is expressed during infection, each GFP-Pi04314 fusion is stable and myr GFP-Pi04314 is removed from the nucleus while NLS GFP-Pi04314
Rearrangement of Actin Cytoskeleton Mediates Invasion of Lotus japonicus Roots by Mesorhizobium loti C W
The Plant Cell, Vol. 21: 267 284, January 2009, www.plantcell.org ã 2009 American Society of Plant Biologists Rearrangement of Actin Cytoskeleton Mediates Invasion of Lotus japonicus Roots by Mesorhizobium
S156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Supplemental Materials Supplemental Figure S1 (a) Phenotype of the wild type and grik1-2 grik2-1 plants after 8 days in darkness.
Supporting Online Material for
Revised 20 December 2006 www.sciencemag.org/cgi/content/full/1132514/dc1 Supporting Online Material for A Cytokinin Perception Mutant Colonized by Rhizobium in the Absence of Nodule Organogenesis Jeremy
- 1 - Supplemental Data
- 1-1 Supplemental Data 2 3 4 5 6 7 8 9 Supplemental Figure S1. Differential expression of AtPIP Genes in DC3000-inoculated plants. Gene expression in leaves was analyzed by real-time RT-PCR and expression
sides of the aleurone (Al) but it is excluded from the basal endosperm transfer layer
Supplemental Data. Gómez et al. (2009). The maize transcription factor MRP-1 (Myb-Related-Protein-1) is a key regulator of the differentiation of transfer cells. Supplemental Figure 1. Expression analyses
Pattern Formation via Small RNA Mobility SUPPLEMENTAL FIGURE 1 SUPPLEMENTAL INFORMATION. Daniel H. Chitwood et al.
SUPPLEMENTAL INFORMATION Pattern Formation via Small RNA Mobility Daniel H. Chitwood et al. SUPPLEMENTAL FIGURE 1 Supplemental Figure 1. The ARF3 promoter drives expression throughout leaves. (A, B) Expression
Nuclear-Localized and Deregulated Calcium- and Calmodulin-Dependent Protein Kinase Activates Rhizobial and Mycorrhizal Responses in Lotus japonicus W
The Plant Cell, Vol. 24: 810 822, February 2012, www.plantcell.org ã 2012 American Society of Plant Biologists. All rights reserved. Nuclear-Localized and Deregulated Calcium- and Calmodulin-Dependent
Supplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
CYCLOPS, A DNA-Binding Transcriptional Activator, Orchestrates Symbiotic Root Nodule Development
Article CYCLOPS, A DNA-Binding Transcriptional Activator, Orchestrates Symbiotic Root Nodule Development Sylvia Singh, 1, Katja Katzer, 1, Jayne Lambert, 1 Marion Cerri, 1 and Martin Parniske 1, * 1 Faculty
Lotus japonicus Nodulation Requires Two GRAS Domain Regulators, One of Which Is Functionally Conserved in a Non-Legume 1[C][W]
![Lotus japonicus Nodulation Requires Two GRAS Domain Regulators, One of Which Is Functionally Conserved in a Non-Legume 1[C][W]](/thumbs/75/71704547.jpg "Lotus japonicus Nodulation Requires Two GRAS Domain Regulators, One of Which Is Functionally Conserved in a Non-Legume 1[C][W]")
Lotus japonicus Nodulation Requires Two GRAS Domain Regulators, One of Which Is Functionally Conserved in a Non-Legume 1[C][W] Anne B. Heckmann, Fabien Lombardo, Hiroki Miwa 2, Jillian A. Perry, Sue Bunnewell,
Supplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Analysis of mature mirna sequences of the mir172 family members. Mature sequences of mir172 family members were aligned using software MEGA5. The stars indicate nucleotides conserved
Supplemental Data. Na Xu et al. (2016). Plant Cell /tpc
Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
Supplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN
A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression
AD-FIL AD-YAB2 -2 BD-JAZ3 AD-YAB3 AD-YAB5 AD-FIL -4 3AT BD-JAZ3 AD-YAB3
3 4 9 10 11 12 AD-FIL AD-YAB5 2 B AD-YAB3 1 BD-JAZ 5 6 7 8 AD-FIL A AD-YAB2 Supplemental Data. Boter et al. (2015). Plant Cell 10.1105/tpc.15.00220 BD AD-YAB2-2 -2 BD-JAZ3 AD-YAB3 BD AD-YAB5-4 AD-FIL -4
Supplemental Data. Meng et al. (2011). Plant Cell /tpc B73 CML311 CML436. Gaspé Flint
Gaspé Flint B73 CML311 CML436 A B C D 10 th leaf 10 th leaf 10 th leaf Supplemental Figure 1. Whole plant images of the four varieties used in this study (A) Extreme early flowering temperate line Gaspé
Short Term Scientific Mission Report
Short Term Scientific Mission Report COST Action: FA1103 Reference : ECOST-STSM-FA1103-290713-031130 Beneficiary: Daniela Tsikou, University of Thessaly, Dept of Biochemistry and Biotechnology, Larissa(Greece),
8000 Aarhus, Denmark, 4 National Institute of Livestock and Grassland Science, Nasu Research Station, Nasushiobara, Tochigi, Japan, and
The Plant Journal (2009) 60, 168 180 doi: 10.1111/j.1365-313X.2009.03943.x CERBERUS, a novel U-box protein containing WD-40 repeats, is required for formation of the infection thread and nodule development
Sperm cells are passive cargo of the pollen tube in plant fertilization
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 3 ARTICLE NUMBER: 17079 Sperm cells are passive cargo of the pollen tube in plant fertilization Jun Zhang 1, Qingpei
PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
To investigate the heredity of the WFP gene, we selected plants that were homozygous
Supplementary information Supplementary Note ST-12 WFP allele is semi-dominant To investigate the heredity of the WFP gene, we selected plants that were homozygous for chromosome 1 of Nipponbare and heterozygous
BIOLOGICAL INTERACTIONS IN GRASSLAND SOILS AND PRODUCTIVITY. Abstract
ID # 04-05 BIOLOGICAL INTERACTIONS IN GRASSLAND SOILS AND PRODUCTIVITY R. Cook 1, R. D. Bardgett 2, W. R. Eason 1, L. Skøt 1 and K. J. Webb 1 1 Institute of Grassland and Environmental Research, Aberystwyth,
A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang
Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/167/ra20/dc1 Supplementary Materials for Poly(ADP-Ribose) (PAR) Binding to Apoptosis-Inducing Factor Is Critical for PAR Polymerase-1 Dependent Cell Death (Parthanatos)
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis seedlings expressing ERF109pro-GUS. The GUS staining
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3
Supplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and
1 Supplemental information 2 3 Materials and Methods 4 Reagents and animals 5 8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 6 Silencer Select Pre-designed sirna
Poly-A signals. amirna. pentr/d-topo for Gateway cloning
popon inducible system A Poly-A signals CaMV 35S minimal promoter TMV omega translational enhancer HYG KAN RR 35S 35S LhGR GUS Ω pop6 Ω Gene construct B - Dex + Dex CACC prs300 (mir319a) CACC amirna pentr/d-topo
Supplementary Fig. 1
a FL (1-2266) NL (1-1190) CL (1191-2266) HA-ICE1: - HA-ICE1: - - - FLAG-ICE2: + + + + FLAG-ELL: + + + + + + IP: anti-ha FLAG-ICE2 HA-ICE1-FL HA-ICE1-NL HA-ICE1-CL FLAG-ICE2 b IP: anti-ha FL (1-2266) NL
Supplemental Data. Wu and Xue (2010). Plant Cell /tpc
Supplemental Data. Wu and Xue (21). Plant Cell 1.115/tpc.11.75564 A P1-S P1-A P2-S P2-A P3-S P3-A P4-S P4-A B Relative expression Relative expression C 5. 4.5 4. 3.5 3. 2.5 2. 1.5 1..5 5. 4.5 4. 3.5 3.
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
Supplemental Information
Supplemental Information Supplemental Figure 1. The Heterologous Yeast System for Screening of Arabidopsis JA Transporters. (A) Exogenous JA inhibited yeast cell growth. Yeast cells were diluted to various
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated
Supplemental data. Zhao et al. (2009). The Wuschel-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice.
Supplemental data. Zhao et al. (2009). The Wuschel-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice. A B Supplemental Figure 1. Expression of WOX11p-GUS WOX11-GFP
Supplemental Materials
Supplemental Materials Flores-Pérez et al., Supplemental Materials, page 1 of 5 Supplemental Figure S1. Pull-down and BiFC controls, and quantitative analyses associated with the BiFC studies. (A) Controls
WiscDsLox485 ATG < > //----- E1 E2 E3 E4 E bp. Col-0 arr7 ARR7 ACTIN7. s of mrna/ng total RNA (x10 3 ) ARR7.
A WiscDsLox8 ATG < > -9 +0 > ---------//----- E E E E E UTR +9 UTR +0 > 00bp B S D ol-0 arr7 ol-0 arr7 ARR7 ATIN7 D s of mrna/ng total RNA opie 0. ol-0 (x0 ) arr7 ARR7 Supplemental Fig.. Genotyping and
Bioengineering of Tobacco Mosaic Virus to Create a Non- Infectious Positive Control for Ebola Diagnostic Assays
Supplementary Information for Bioengineering of Tobacco Mosaic Virus to Create a Non- Infectious Positive Control for Ebola Diagnostic Assays Patricia Lam 1, Neetu M. Gulati 2,3, Phoebe L. Stewart 2,3,
SUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
Supplementary Materials: 1. Supplementary Figures S1-S9. 2. Supplementary Tables S1-S2
Supplementary Materials: 1. Supplementary Figures S1-S9 2. Supplementary Tables S1-S2 S1 1. Supplementary Figures Fig. S1. Genotypes of tcp20 mutants. Fig. S2. Root phenotypes of tcp20 mutants. Fig. S3.
Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.
Supplementary Figure 1 Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. (left) Representative bright-field images of wild type (wt), heterozygous (het)
Supplemental Data. Benstein et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Purification of the heterologously expressed PGDH1, PGDH2 and PGDH3 enzymes by Ni-NTA affinity chromatography. Protein extracts (2 µl) of different fractions (lane 1 = total extract,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
*** *** * *** *** *** * *** ** ***
Figure S: OsMADS6 over- or down-expression is stable across generations A, OsMADS6 expression in overexpressing (OX, OX, dark bars) and corresponding control (OX, WT, white bars) T4 plants. B, OsMADS6
Supplementary Information to: Genome-wide Real-time in vivo Transcriptional Dynamics During Plasmodium falciparum. Blood-stage Development
Supplementary Information to: Genome-wide Real-time in vivo Transcriptional Dynamics During Plasmodium falciparum Blood-stage Development Painter et al. 1 of 8 Supplementary Figure 1: Supplementary Figure
Characterization of LysM-containing receptor-like kinases involved in plant innate immunity
Characterization of LysM-containing receptor-like kinases involved in plant innate immunity Simone Ferrari Department of Biology and Biotechnology Charles Darwin Plant-pathogen interactions Plants are
B. C. Staurosporine BEZ235 DMSO. -actin. Suppl. Fig. 1 BEZ235 and BGT226 inhibit phosphorylation of Akt and downstream targets of PI3K and mtor.
DMSO Staurosporine BGT226 A. B. C. BGT226 P-Akt 0 1 2 4 8 hrs. P-Akt 0 5 10 25 50 100 nm PS6 P-4E-BP1 -actin C-Caspase3 -actin PS6 P-4E-BP1 -actin Suppl. Fig. 1 and BGT226 inhibit phosphorylation of Akt
Legume genomics Lotus japonicus as model
Jens Stougaard Department of Molecular Biology University of Aarhus Denmark Legume genomics Lotus japonicus as model Wheat & barley, P&T Lolium EST seguencing Potato SAGE & P Metabolomics sec metabolism
Supplementary Figures and Tables
Supplementary Figures and Tables SI Fig. 1. Schematic diagrams of the Gateway-system based T. pseudonana transformation vectors. A-C, for expression and in vivo localization of egfp-tagged SIT genes under
A Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast. Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice
A Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice Fei Chen 1,*, Guojun Dong 2,*, Limin Wu 1, Fang Wang 3, Xingzheng
B. Transgenic plants with strong phenotype (%)
A. TCTAGTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTT AAATATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAATATGG 2XP35S STTM165 5 GGGGGATGAAGctaCCTGGTCCGA3 3 CCCCCUACUUC---GGACCAGGCU5 mir165 HindIII mir165 96 nt GTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTT
Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.
Supplementary Figure 1 lision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK, PPK3 and PPK respectively. % of nuclei with signal / field a 5 c ppif3:gus pppk1:gus 0 35 30 5 0 15 10
Supplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the
Supplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the roots of three-day-old etiolated seedlings of Col-0
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09861 & &' -(' ()*+ ')(+,,(','-*+,&,,+ ',+' ' 23,45/0*6787*9:./09 ;78?4?@*+A786?B- &' )*+*(,-* -(' ()*+ ')(+,,(','-*+,&,,+ ',+'./)*+*(,-*..)*+*(,-*./)*+*(,-*.0)*+*(,-*..)*+*(,-*
AGATCCACTAGTTCTAGAGCTCAACTTGTTGGTTTGTCTTT TGTCCAAAAACGGTTTCCAG TGCCTTTCTGTTCGATTGAT
1 Table S1. PCR primers Primer Use Sequence (5 3 ) JC17 SAT1 flipper GGCCCCCCCTCGAGGAAGTT JC18 SAT1 flipper GCTCTAGAACTAGTGGATCT JC57 5 NCR of CNA1 AATGATGGAGTTTATGGGAA JC58 5 NCR of CNA1 AACTTCCTCGAGGGGGGGCCGAAAAAAAAAAAGGGGGGGG
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase
A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase tag insertion at the 3 end using CRISPR-Cas9 genome editing technique Sambuddha Basu 1, 3, Levi Adams 1, 3, Subhrangshu
Supplementary Figure 1
Supplementary Figure 1 Preaxial dominance during salamander limb development. Panel (a, b) shows RNA in situ hybridisation on whole-mount limbs with Sox9 sense probe as a control. Note the absence of reactivity
Temperature modulates tissue-specification program to control fruit dehiscence in Brassicaceae
Supplemental information Temperature modulates tissue-specification program to control fruit dehiscence in Brassicaceae Xin-Ran Li 1, Joyita Deb 1, S. Vinod Kumar 1* and Lars Østergaard 1* 1 John Innes
Supplementary Figure 1. ips_3y+mir-302b. ips_3y+mir-372. ips_3y+mir-302b + mir-372. ips_4y. ips_4y+mir-302b. ips_4y + mir-372
Supplementary Figure 1 ips_3y+mir-32b ips_3y+ ips_3y+mir-32b + ips_4y ips_4y+mir-32b ips_4y + Nature Biotechnology: doi:1.138/nb.t.1862 TRA-1-6 DAPI Oct3/4 Supplementary Figure 1: ips cells derived from
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Sox2 localizes in neutrophils of mouse spleen. (a) Microscopy analysis of Sox2 and MPO in wild-type mouse spleen. Nucl, nucleus. (b) Immunohistochemistry staining of Sox2 and MPO
Supplementary Figures, Tables, and Legends:
Supplementary Figures, Tables, and Legends: Supplementary Figure 1. RBPjκ is efficiently knocked down in RBPjk Prx1 mutant compact bones. Western blot analyses for RBPjk in protein extracts from femurs
Supplemental Data. Wang et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Time-Course Analysis of Storage Proteins during Endosperm Development of the Wild-type 9311 and the gpa4-1 Mutant. (A) SDS-PAGE analyses of seed storage proteins during wild-type
(phosphatase tensin) domain is shown in dark gray, the FH1 domain in black, and the
Supplemental Figure 1. Predicted Domain Organization of the AFH14 Protein. (A) Schematic representation of the predicted domain organization of AFH14. The PTEN (phosphatase tensin) domain is shown in dark
A Repressor Complex Governs the Integration of
Developmental Cell 15 Supplemental Data A Repressor Complex Governs the Integration of Flowering Signals in Arabidopsis Dan Li, Chang Liu, Lisha Shen, Yang Wu, Hongyan Chen, Masumi Robertson, Chris A.
monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in
Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in
Supplementary information Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in Alzheimer s disease Zhentao Zhang, Mingke Song, Xia Liu, Seong Su Kang, Il-Sun Kwon, Duc
Supplemental Data. Huo et al. (2013). Plant Cell /tpc
Supplemental Data. Huo et al. (2013). Plant Cell 10.1105/tpc.112.108902 1 Supplemental Figure 1. Alignment of NCED4 Amino Acid Sequences from Different Lettuce Varieties. NCED4 amino acid sequences are
Supplemental Information. Boundary Formation through a Direct. Threshold-Based Readout. of Mobile Small RNA Gradients
Developmental Cell, Volume 43 Supplemental Information Boundary Formation through a Direct Threshold-Based Readout of Mobile Small RNA Gradients Damianos S. Skopelitis, Anna H. Benkovics, Aman Y. Husbands,
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing
A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response
A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response Ann E. Lin, Federico C. Beasley, Nadia Keller, Andrew Hollands, Rodolfo Urbano, Emily
SUPPLEMENTARY INFORMATION
doi: 1.138/nature7652 Supplementary Figure legends Figure 1. Diagrammatic representation of the rdna locus on yeast chromosome XII and the processing pathway from 35S full length nascent rrna to mature
Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation
1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura
Nature Biotechnology: doi: /nbt.1693
b a c Supplementary Figure 1. Isolation of cambium cell layer from xylem tissue. a, Preparation of T. cuspidata explant by peeling off cambium, phloem, cortex, and epidermal cells from the xylem. Given
Revised: RG-RV2 by Fukuhara et al.
Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the
Supplemental Figure 1. Conserved regions of the kinase domain of PEPR1, PEPR2, CLV1 and BRI1.
Supplemental Figure 1. Conserved regions of the kinase domain of PEPR1, PEPR2, CLV1 and BRI1. The asterisks and colons indicate the important residues for ATP-binding pocket and substrate binding pocket,
Supplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
Figure S1. Figure S2 RT-PCR. qpcr RT-PCR. Northern. IVSwt ΔIVS IVS IVS IVS. NTC mock IVSwt ΔIVS IVS IVS. mock IVSwt ΔIVS
Figure S1 40 cycles IVS IVS IVS NTC wt Δ Δ mut pri-mirna163 * Fig. S1 Transcripts generated from the MIR163 gene variants in which splice sites have been mutated are not spliced. products were separated
Lotus japonicus SYMREM1 is a novel signalling component involved in symbiotic nitrogen fixation
Lotus japonicus SYMREM1 is a novel signalling component involved in symbiotic nitrogen fixation A thesis submitted for the degree of Doctor of Philosophy of Eötvös Loránd University Katalin Tóth Doctorate
Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
Supplementary Fig. 1. Microscopic image of cotyledon adaxial epidermis of 3-dayold Col, epf2-1, ros1-4 and rdd. Scale bar, 100 m.
Supplementary Fig. 1. Microscopic image of cotyledon adaxial epidermis of 3-dayold Col, epf2-1, ros1-4 and rdd. Scale bar, 100 m. Supplementary Fig. 2. The small-cell-cluster phenotype of different ros1
kda
Relative VENUS/RFP fluorescence Relative fluorescence a min 2 min 4 min 6 min 8 min min Jas9-VENUS d kda 8 3 75 63 48 Jas9-VENUS Col- - + - + COR µm Jas9-VENUS 35 28 H2B-RFP 7 b c Overlay,2,8,6,4,2,6,4,2,8,6,4,2
Supplementary Figure Legends
Supplementary Figure Legends Figure S1 gene targeting strategy for disruption of chicken gene, related to Figure 1 (f)-(i). (a) The locus and the targeting constructs showing HpaI restriction sites. The
Supplemental Data. Tilbrook et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Protein alignment of with. Identical aligned residues highlighted in black and similar and non-similar residues highlighted in grey and white, respectively. Position of Trp residues
Supplementary Material for: p53-dependent expression of CXCR5 chemokine receptor in MCF-7 breast cancer cells
Supplementary Material for: p53-dependent expression of CXCR5 chemokine receptor in MCF-7 breast cancer cells Nikita A Mitkin 1, Christina D Hook 1, Anton M Schwartz 1, Subir Biswas 2, Dmitry V Kochetkov
Supplementary Materials
Supplementary Materials Table S1. Oligonucleotide sequences and PCR conditions used to amplify the indicated genes. TA = annealing temperature; gdna = genomic DNA; cdna = complementary DNA; c = concentration.
supplementary information
Figure S1 ZEB1 full length mrna. (a) Analysis of the ZEB1 mrna using the UCSC genome browser (http://genome.ucsc.edu) revealed truncation of the annotated Refseq sequence (NM_030751). The probable terminus