Differential Gene Expression
|
|
- George Lambert
- 5 years ago
- Views:
Transcription
1 Developmental Biology Biology 4361 Differential Gene Expression October 13, 2005
2 core transcription initiation site 5 promoter 3 TATAT +1 upstream downstream
3 Basal transcription factors (eukaryotes)
4 TFIID the TFIID complex binds to the TATA box through its TBP subunit TATA TFIIA +1 transcription initiation site TFIID is stabilized by TFIIA TFIIA TFIIB TFIIH TFIIB and TFIIH join the complex at the TATA box RNA polymerase II a complex of RNA pol II, TFIIE and TFIIF is positioned by TFIIB and its carboxyterminal domain is bound by TFIID TFIIE TFIIF carboxyterminal domain (CTD) CTD the CTD is phosphorylated by TFIIH and is released by TFIID; transcription begins RNA transcript
5 Enhancers cis acting regulatory elements bind specific transcription factors differ from promoters: 1) need a promoter to work 2) can work at a distance 3) can work in reverse orientation
6 Specific Transcription Factors Specific regulators activate repress multiple domains combinatorial competitive silencing
7 Transcription factor engrailed (After Pabo and Sauer 1992.) The homeodomain of the Engrailed protein binds to a particular site in the DNA. Helix 3 contacts the base pairs in the major groove, while the amino terminal portion of the homeodomain enters the minor groove. (After Pabo and Sauer 1992.)
8 Transcription factor families helix turn helix homeodomain zinc finger leucine zipper basic helix loop helix
9 estrogen receptor zinc finger domain
10 helix loop helix domain leucine zipper domain
11 homeodomain
12 Enhancers and transcription factors combinatorial transcription factors NOTE enhancers can act as repressors/silencers Figure 16.4
13 Figure 16.7 Transcription factor competition
14 Transcription factor regulation of gene expression activate/repress activate/repress competitive
15 Regulation of transcription factors Environmental activators heat shock genes metallothionein cytochrome p450s Inactive precursors phosphorylation/dephosphorylation Multimerization Transport from cytoplasm Ligand binding e.g. hormones
16 Transcription factor domains DNA binding activation dimerization homodimers heterodimers ligand binding allosteric control
17 Figure Transcription factor regulation steroid hormone receptors
18 Chromatin structure acetylation state of histones controls DNA binding Regulation: acetyltransferases deacetylases
19 Chromatin configuration John H. Frenster heterochromatin euchromatin
20 nrna processing promoter exon 1 intron 1 exon 2 intron 2 termination region 7 methyl Gppp primary transcript gene transcription, 5 capping cleavage signal AAUAA cap 7 methyl Gppp cleavage factor 3 cleavage, polyadenylation poly(a)polymerase AAAAAAA(n) 7 methyl Gppp splicing exon 1 exon 2 AAAAAAA(n) mature mrna, ready to be transported to the cytoplasm and translated
21 α Tropomyosin alternative splicing striated muscle striated muscle myoblast smooth muscle neuroblast/muscle hepatoma brain
22 Translational Control mrna half life determines translation number stability avoid digestion 5 cap, 3 UTR essential controls poly(a) tail short no translation/no digestion length = translation number
23 Methods In situ hybridization gene fusion reporter gene construction
24 in situ hybridization cdna production Figure 15.11
25 in situ hybridization single stranded cdna of known sequence fluorescence tag hybridize * radioactive tag FISH fluorescence in situ hybridization labeled hybrid DNA molecule autoradiography *
26 Reporter genes LacZ bacterial galactosidase Fig.6. Expression of Bicoid (A), Hunchback (B), zerknüllt (C) and transgenic Clogmia hunchback in Drosophila embryos (D). Clogmiahunchback regulatory sequence drives a lacz reporter gene on the dorsal side of the embryo.
Differential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )
More informationDifferential Gene Expression
Biology 4361 - Developmental Biology Differential Gene Expression June 18, 2009 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More information- all cells express large number of the same genes - housekeeping or common genes - many cells also express cell-type-specific genes
Developmental Biology - Biology 4361 Lecture 8 - Differential Gene Expression October 13, 2005 The principle of genomic equivalence states that all cells in a developing organism have the same genetic
More informationDifferential Gene Expression
IBS 8102 Cell, Molecular, and Developmental Biology Differential Gene Expression January 22, 2008 Differential Gene Expression Chromatin structure Gene anatomy Gene sequences Control of gene transcription
More informationChapter 25: Regulating Eukaryotic Transcription The Ligand Responsive Activators
Chapter 25: Regulating Eukaryotic Transcription The Ligand Responsive Activators At least 5 potential gene expression control points Superfamily of Gene Regulators Activation of gene structure Initiation
More informationMolecular Biology (BIOL 4320) Exam #1 March 12, 2002
Molecular Biology (BIOL 4320) Exam #1 March 12, 2002 Name KEY SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number.
More informationGene expression DNA RNA. Protein DNA. Replication. Initiation Elongation Processing Export. DNA RNA Protein. Transcription. Degradation.
Gene expression DNA RNA Protein DNA DNA Degradation RNA Degradation Protein Replication Transcription Translation Initiation Elongation Processing Export Initiation Elongation Processing Targeting Chapter
More information30 Gene expression: Transcription
30 Gene expression: Transcription Gene structure. o Exons coding region of DNA. o Introns non-coding region of DNA. o Introns are interspersed between exons of a single gene. o Promoter region helps enzymes
More informationLecture 11. Initiation of RNA Pol II transcription. Transcription Initiation Complex
Lecture 11 *Eukaryotic Transcription Gene Organization RNA Processing 5 cap 3 polyadenylation splicing Translation Initiation of RNA Pol II transcription Consensus sequence of promoter TATA Transcription
More informationCELL BIOLOGY - CLUTCH CH. 7 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: CONTROL OF GENE EXPRESSION BASICS Gene expression is the process through which cells selectively to express some genes and not others Every cell in an organism is a clone
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationChapter 3. DNA, RNA, and Protein Synthesis
Chapter 3. DNA, RNA, and Protein Synthesis 4. Transcription Gene Expression Regulatory region (promoter) 5 flanking region Upstream region Coding region 3 flanking region Downstream region Transcription
More informationChapter 14 Regulation of Transcription
Chapter 14 Regulation of Transcription Cis-acting sequences Distance-independent cis-acting elements Dissecting regulatory elements Transcription factors Overview transcriptional regulation Transcription
More informationComplex Transcription Machinery
Complex Transcription Machinery Subunits of the Basal Txn Apparatus Stepwise Assembly of the Pre-initiation Complex Interplay of Activators, Co-regulators and RNA Polymerase at the Promoter Divide and
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationGENETICS - CLUTCH CH.10 TRANSCRIPTION.
!! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types
More information(c) 2014 Dr. Alice Heicklen & Dr. Deborah Mowshowitz, Columbia University, New York, NY. Last update 02/26/ :57 PM
C2006/F2402 '14 OUTLINE OF LECTURE #11 (c) 2014 Dr. Alice Heicklen & Dr. Deborah Mowshowitz, Columbia University, New York, NY. Last update 02/26/2014 12:57 PM Handouts: 10C -- Typical Eukaryotic Gene,
More informationComputational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More information32 Gene regulation in Eukaryotes Lecture Outline 11/28/05. Gene Regulation in Prokaryotes and Eukarykotes
3 Gene regulation in Eukaryotes Lecture Outline /8/05 Gene regulation in eukaryotes Chromatin remodeling More kinds of control elements Promoters, Enhancers, and Silencers Combinatorial control Cell-specific
More informationStructure/function relationship in DNA-binding proteins
PHRM 836 September 22, 2015 Structure/function relationship in DNA-binding proteins Devlin Chapter 8.8-9 u General description of transcription factors (TFs) u Sequence-specific interactions between DNA
More informationB. Incorrect! Centromeric DNA is largely heterochromatin, which is inactive DNA.
MCAT Biology - Problem Drill 06: Molecular Biology of Eukaryotes Question No. 1 of 10 1. Which type of DNA would have the highest level of expression? Question #01 (A) Heterochromatin. (B) Centromeric
More informationControl of Eukaryotic Gene Expression (Learning Objectives)
Control of Eukaryotic Gene Expression (Learning Objectives) 1. Compare and contrast chromatin and chromosome: composition, proteins involved and level of packing. Explain the structure and function of
More informationGENES AND CHROMOSOMES V. Lecture 7. Biology Department Concordia University. Dr. S. Azam BIOL 266/
1 GENES AND CHROMOSOMES V Lecture 7 BIOL 266/4 2014-15 Dr. S. Azam Biology Department Concordia University 2 CELL NUCLEUS AND THE CONTROL OF GENE EXPRESSION An Overview of Gene Regulation in Eukaryotes
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationSection C: The Control of Gene Expression
Section C: The Control of Gene Expression 1. Each cell of a multicellular eukaryote expresses only a small fraction of its genes 2. The control of gene expression can occur at any step in the pathway from
More informationEukaryotic & Prokaryotic Transcription. RNA polymerases
Eukaryotic & Prokaryotic Transcription RNA polymerases RNA Polymerases A. E. coli RNA polymerase 1. core enzyme = ββ'(α)2 has catalytic activity but cannot recognize start site of transcription ~500,000
More informationCHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES
CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES I. Introduction A. No operon structures in eukaryotes B. Regulation of gene expression is frequently tissue specific.
More informationControl of Eukaryotic Genes. AP Biology
Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution
More informationUnit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
More informationTRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
More informationSIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat
SIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat TRANSCRIPTION: AN OVERVIEW Transcription: the synthesis of a single-stranded RNA from a doublestranded DNA template.
More informationControl of Eukaryotic Genes. AP Biology
Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution
More informationResources. This lecture Campbell and Farrell's Biochemistry, Chapter 11
Transcription Resources This lecture Campbell and Farrell's Biochemistry, Chapter 11 2 Definition of a gene The entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide
More informationChapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More informationDNA Prokaryote Transcription Steps (updated February 2013)
URS AACTGT ATATTA - 35-10 transcription Pribnow Box discriminator +1 AGGAGGT TTA TCCTCCA ATT Gene C TGA TAG ACT ATC rho or GC hairpin loop transcription termination DNA Prokaryote Transcription Steps (updated
More informationUnit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology
Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated
More informationControl of Eukaryotic Genes
Control of Eukaryotic Genes 2007-2008 The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationControl of Eukaryotic Genes. AP Biology
Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution
More informationMechanisms of Transcription. School of Life Science Shandong University
Mechanisms of Transcription School of Life Science Shandong University Ch 12: Mechanisms of Transcription 1. RNA polymerase and the transcription cycle 2. The transcription cycle in bacteria 3. Transcription
More informationGene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory
Gene Regulation in Eukaryotes Dr. Syahril Abdullah Medical Genetics Laboratory syahril@medic.upm.edu.my Lecture Outline 1. The Genome 2. Overview of Gene Control 3. Cellular Differentiation in Higher Eukaryotes
More informationChapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes
Chapter 17 Lecture Concepts of Genetics Tenth Edition Regulation of Gene Expression in Eukaryotes Chapter Contents 17.1 Eukaryotic Gene Regulation Can Occur at Any of the Steps Leading from DNA to Protein
More informationEukaryotic Transcription
Eukaryotic Transcription I. Differences between eukaryotic versus prokaryotic transcription. II. (core vs holoenzyme): RNA polymerase II - Promotor elements. - General Pol II transcription factors (GTF).
More information17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites
17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites 1 Section 17.5 Transcription regulatory proteins, transcription factors, target cis-acting sites
More informationBS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationEUKARYOTIC GENE CONTROL
EUKARYOTIC GENE CONTROL THE BIG QUESTIONS How are genes turned on and off? How do cells with the same DNA/ genes differentiate to perform completely different and specialized functions? GENE EXPRESSION
More informationEukaryotic Gene Expression John O. Thomas
Eukaryotic Gene Expression John O. Thomas I) RNA polymerases A) There are four RNA polymerases in human cells. 1) RNA polymerase I, located in the nucleolar region of the nucleus, is responsible for the
More informationRegulation of gene expression. (Lehninger pg )
Regulation of gene expression (Lehninger pg. 1072-1085) Today s lecture Gene expression Constitutive, inducible, repressible genes Specificity factors, activators, repressors Negative and positive gene
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationBiochemistry Eukaryotic Transcription
1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 1. Understand and have an overview of eucaryotic transcriptional regulation. 2. Explain
More informationThis chapter is all about making different cells from equivalent DNA sequence...
Bio 127 Section I Introduction to Developmental Biology Developmental Genetics Gilbert 9e Chapter 2 This chapter is all about making different cells from equivalent DNA sequence... 1. Every somatic cell
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
More informationSynthetic cells: do bacteria need all its genes? No.
NO NEED TO REFER TO THE SLIDES. بسم هللا الرحمن الرحيم Do we need all the non coding regions of the DNA? Two weeks ago, they discovered that the genome of a plant is very small (recall that plant genome
More informationGene Expression and Regulation - 1
Gene Expression and Regulation - 1 We have been discussing the molecular structure of DNA and its function in DNA replication and in transcription. Earlier we discussed how genes interact in transmission
More informationNucleotide Entry Port. Scaffold Subunits. Polymerase Activity β Sliding Clamp. Clamp Loader. Promoter Recognition
Nucleotide Entry ort α (2) Scaffold Subunits olymerase Activity Sliding Clamp σ Clamp Loader romoter Recognition -35-10 NNAAA AA T A TTTTNNAAAANNN TT T N N17 N6 α α α α α α α α α α α α α α +1 α α α α Subunit
More informationThe Little Things About the Little Things Inside of Us The Eukaryotic Genome and Its Expression
The Little Things About the Little Things Inside of Us The Eukaryotic Genome and Its Expression What Are the Characteristics of the Eukaryotic Genome? Key differences between eukaryotic and prokaryotic
More informationUnit 7. Genetic Regulation, Development, and Biotechnology. AP Biology
Unit 7 Genetic Regulation, Development, and Biotechnology The BIG Questions How are genes turned on & off in eukaryotes and prokaryotes? How do cells with the same genes differentiate to perform completely
More informationDNA Binding Domains: Structural Motifs. Effector Domain. Zinc Fingers. Zinc Fingers, continued. Zif268
DNA Binding Domains: Structural Motifs Studies of known transcription factors have found several motifs of protein design to allow sequence-specific binding of DNA. We will cover only three of these motifs:
More informationBIOLOGY. Chapter 16 GenesExpression
BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationGene regulation V Biochemistry 302. March 6, 2006
Gene regulation V Biochemistry 302 March 6, 2006 Common structural motifs associated with transcriptional regulatory proteins Helix-turn-helix Prokaryotic repressors and activators Eukaryotic homeodomain
More informationDivision Ave. High School AP Biology
Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationRegulation of Gene Expression
CAMPBELL BIOLOGY IN FOCUS URRY CAIN WASSERMAN MINORSKY REECE 15 Regulation of Gene Expression Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge, Simon Fraser University SECOND EDITION
More informationChromatographic Separation of the three forms of RNA Polymerase II.
Chromatographic Separation of the three forms of RNA Polymerase II. α-amanitin α-amanitin bound to Pol II Function of the three enzymes. Yeast Pol II. RNA Polymerase Subunit Structures 10-7 Subunit structure.
More informationRegulation of Gene WORKING WITH THE FIGURES
12 Regulation of Gene Expression in Eukaryotes WORKING WITH THE FIGURES 1. In Figure 12-4, certain mutations decrease the relative transcription rate of the b-globin gene. Where are these mutations located,
More informationChapter 9-II - Transcriptional Control of Gene Expression
Chapter 9-II - Transcriptional Control of Gene Expression Transcriptional Control of Gene Expression 9.3 RNA Polymerase II Promoters and General Transcription Factors Three types of promoter sequences
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationGENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s
GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have
More informationEnhancers. Activators and repressors of transcription
Enhancers Can be >50 kb away from the gene they regulate. Can be upstream from a promoter, downstream from a promoter, within an intron, or even downstream of the final exon of a gene. Are often cell type
More informationCLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS
CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS A. Promoters and Polymerases (RNA pols): 1. General characteristics - Initiation of transcription requires a. Transcription factors
More informationClasses of eukaryotic cellular RNAs
Classes of eukaryotic cellular RNAs ribosomal RNA (rrna) 18S (small subunit) 28S (large subunit) 5.8S (large subunit) 5S (large subunit) transfer RNA (trna) messenger RNA (mrna) heterogeneous nuclear RNA
More informationGene Regulation in Eukaryotes
Gene Regulation in Eukaryotes The latest estimates are that a human cell, a eukaryotic cell, contains 20,000 25,000 genes. Some of these are expressed in all cells all the time. These so-called housekeeping
More informationRegulation of Gene Expression
Slide 1 Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions
More informationChapter 18: Regulation of Gene Expression. Gene Regulation. Transcription Factors 3/21/2017
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More informationTranscription and Post Transcript Modification
Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.
More informationRegulation of Gene Expression in Eukaryotes
12 Regulation of Gene Expression in Eukaryotes WORKING WITH THE FIGURES 1. In Figure 12-4, certain mutations decrease the relative transcription rate of the -globin gene. Where are these mutations located,
More informationThe RNA Polymerase II General Transcription Machinery Prof. Michael Hampsey
The RNA Polymerase II General Transcription Machinery Michael Hampsey, PhD Robert Wood Johnson Medical School Piscataway, New Jersey 1 Central Dogma of Molecular Biology DNA Stores genetic information
More informationREGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes
REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation
More informationBiological information flow
BCMB 3100 Chapters 36-38 Transcription & RNA Processing Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors mrna processing Biological
More informationTranscription factors
Atlas of Genetics and Cytogenetics in Oncology and Haematology Transcription factors I Introduction * II Initiation of transcription III Transcription factors family pdf version I Introduction III.1 Helix-Turn-Helix
More informationGenetics Biology 331 Exam 3B Spring 2015
Genetics Biology 331 Exam 3B Spring 2015 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) DNA methylation may be a significant mode of genetic regulation
More informationControl of Gene Expression
Control of Gene Expression 1 How Gene Regulation Works 2 Control of Gene Expression Controlling gene expression is often accomplished by controlling transcription initiation Regulatory proteins bind to
More informationWe can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA
1 We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA molecules; in transcription, information passes from DNA
More informationDNA Transcription. Visualizing Transcription. The Transcription Process
DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationBiol 3301 Genetics Exam #2A October 26, 2004
Biol 3301 Genetics Exam #2A October 26, 2004 This exam consists of 40 multiple choice questions worth 2.5 points each, for a total of 100 points. Good luck. Name SS# 1. Which of the following statements
More informationCHAPTER 13 LECTURE SLIDES
CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationThere are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.
1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine
More informationTranscription steps. Transcription steps. Eukaryote RNA processing
Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationChapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
More informationExam 1 ID#: October 16, 2007
Biology 4361 Name: KEY Exam 1 ID#: October 16, 2007 Multiple choice (one point each; indicate the best answer) 1. After searches by many embryologists, the mammalian egg was finally discovered by a. William
More informationTranscription. By : Lucia Dhiantika Witasari M.Biotech., Apt
Transcription By : Lucia Dhiantika Witasari M.Biotech., Apt REGULATION OF GENE EXPRESSION 11/26/2010 2 RNA Messenger RNAs (mrnas) encode the amino acid sequence of one or more polypeptides specified by
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationCHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
More informationDelve AP Biology Lecture 7: 10/30/11 Melissa Ko and Anne Huang
Today s Agenda: I. DNA Structure II. DNA Replication III. DNA Proofreading and Repair IV. The Central Dogma V. Transcription VI. Post-transcriptional Modifications Delve AP Biology Lecture 7: 10/30/11
More informationLecture 21 Regulation of transcription
Lecture 21 Regulation of transcription Key learning goals: Understand what a promoter sequence is Understand the role of sigma factors in prokaryotic RNAP initiation Understand what an open complex is,
More information