SUPPLEMENTARY INFORMATION

Transcription

1 b Supplementary Figure 1. Analysis of Vkg-Dpp interactions. a, In vitro pulldown showing binding of Dpp-HA to the GST-VkgC fusion protein. No interaction is detected between denatured Dpp-HA and GST-Vkg. b, Top panel: Schematic of the Vkg C terminus non-collagenous domain, with the fragments tested as GST fusion proteins represented by bars. The dark and light blue colours indicate that Dpp can and cannot bind respectively. Middle panel: Gel showing the amounts of these different fusion proteins tested for interactions with Dpp. Lower panel: Western blot analysis of Dpp interactions with the different Vkg C terminal fusion proteins. 1

2 2

3 Supplementary Figure 2. Analysis of Collagen IV Dpp/BMP-4 interactions. Surface plasmon resonance sensorgrams are shown for the binding of a, GST-VkgC to immobilised recombinant Dpp, b, GST-Dcg1C to immobilised Dpp, c, GST to immobilised Dpp and d, full length human collagen IV to immobilised recombinant BMP-4. Only one concentration of control GST is shown as there is essentially no binding. e, The values for k ass, k diss and Kd determined from the respective analyses are tabulated. The values are the averages from 3 independent repeats +/- s.e.m. 3

4 Supplementary Figure 3. Interaction of Dpp with the Vkg C terminal domain secreted from Drosophila S2 cells. GST, GST-VkgC or GST-VkgCΔ proteins secreted from transfected S2 cells were immunoprecipitated with an anti-gst antibody (GE Healthcare). Specific binding of Dpp-HA to the immunoprecipitated fusion proteins was determined by Western blot analysis. Dpp-HA binds strongly to GST-VkgC but weakly to GST-VkgCΔ, as observed in the GST pulldown assays using fusion proteins purified from bacteria (Fig. 1). The GST, GST-VkgC and GST-VkgCΔ S2 expression plasmids were constructed by cloning the relevant sequences into pmt/bip/v5-his (Invitrogen) as BglII-SpeI fragments. Expression was induced in S2 cells by the addition of 50µM CuSO 4 24 hr posttransfection, and cells were harvested after an additional 2 days. 4

5 Supplementary Figure 4. Mutational analysis of Vkg. The wildtype sequence of the motif in Vkg implicated in Dpp interaction is shown, along with the deletion or mutant versions tested. Altered residues are highlighted by blue shading. The Coomassie stained gel shows the levels of the GST-Vkg fusion proteins tested. Lower panel shows the Western blot result of Dpp-HA binding to the wildtype and mutant Vkg fusion proteins. Based on the structure of collagen IV NC1 domains 1,2, the 2 Cys residues (C1616 and C1619) in the YISRCVVCE motif form disulphide bonds with Cys residues 1561 and 1528 respectively. In contrast to C1616 and C1619 which are located in the CCEN protein generated by our deletion analysis, C1528 and C1561 reside in the CN deletion protein (Supplementary Fig. 1b). The observation that the CCEN Vkg fusion protein can still bind Dpp (Supplementary Fig. 1b), in the absence of C1528 and C1561, suggests that the motif is not simply structural. This was further tested by the generation of three additional mutant Vkg fusion proteins. VkgCM2 mutates all residues in the motif except C1616 and C1619, whereas CM1 and CM3 are less severe in that only the YISR and Y, E residues respectively are mutated. As shown, all mutations disrupt binding of Dpp-HA to the Vkg fusion protein, consistent with the motif having sequence specificity rather than being solely structural. 5

6 Supplementary Figure 5. Expression and distribution of type IV collagens. a, Agarose gel of DNA fragments generated by semi-quantitative RT-PCR analysis of vkg, Dcg1 and tub expression in embryos of different ages in hours as shown. PCR reactions were performed on samples generated in the presence (+) and absence (-) of reverse transcriptase (RT). Specificity of the primers is demonstrated by reactions in which only vkg, Dcg1 or tub primers were included. M denotes the marker lane. As expected, tub is expressed at the different stages of embryonic development tested 3, 6

7 and serves as an internal control for the RT-PCR. vkg and Dcg1 expression is detected in later stage embryos (12-16 h) as reported previously 4, 5. We also detect a lower level of vkg and Dcg1 transcripts in 0-2 h, but not 2-4 h, embryos indicating maternal but not early zygotic transcription of vkg and Dcg1. Reverse transcription was carried out according to the manufacturer s protocol (Invitrogen). The PCR conditions used were: 30 cycles of 95 o C 30 sec, 60 o C 40 sec, 72 o C 1 min, with the appropriate pairs of the following primers: tubf: AACTCCACTGCCATCCAGGA, tubr: GGATCCGACTTTATTGATTACG, vkgf: GTCCTGGTTCCAATCCCGAA, vkgr: CGTTTACAATAATCCCAACAGG, Dcg1F: ATCGCCTGGCTCCTGTTTGG, Dcg1R: ACTTTTGGACATACGACCGAGG. b, Confocal images of Vkg-GFP exon trapped and wildtype embryos (stage 4) showing GFP, PatJ and DAPI immunostaining, as labelled. The distribution of GFP- Vkg is similar to that of PatJ, a basal marker at this stage. c, Tangential confocal sections through a cellularised embryo showing DAPI staining and the distribution of Dcg1 using a specific antibody 5, 6. Control embryos with preimmune serum are included. d, As in c, except that images represent sagittal confocal sections. 7

8 Supplementary Figure 6. Analysis of dpp hr56 homozygous mutant embryos. RNA in situ hybridisation analysis of the Race and hnt expression patterns in embryos homozygous for the hypomorphic dpp hr56 allele. The loss of Race and hnt expression in the presumptive amnioserosa of embryos from vkg or Dcg1 heterozygous females (Fig. 3a) resembles that seen in these these dpp hr56 homozygous mutant embryos, consistent with the lowered dose of type IV collagen reducing Dpp signalling. 8

9 Supplementary Figure 7. Dpp target gene expression in vkg mutants. RNA in situ hybridisation analyses of the zerknüllt (zen) and tailup (tup) expression patterns in wildtype embryos or those collected from vkg k00235 /+ females and males. Embryos are at the onset of gastrulation and oriented as dorsal views. The expression patterns of both genes are narrower in the mutant embryos than wildtype embryos, and similar expression pattern defects are observed in Dcg1 k00405 mutant embryos (data not shown). This observation suggests that there is a defect in Dpp signalling in type IV collagen mutant embryos. 9

10 Supplementary Figure 8. vkg and dpp genetic interactions. a, Left hand graph shows viability of progeny with the dpp hr56 mutation, from crosses between wildtype or vkg heterozygous females as indicated and dpp hr56 /CyO males. Viability is expressed as a percentage of the number of progeny which inherit the wildtype chromosome. dpp hr56 is a weak hypomorphic dpp allele which does not affect survival of heterozygous mutant progeny 7. However, dpp hr56 heterozygous embryos from these vkg/+ females have reduced survival. Right hand graph shows the percentage viability of progeny with each vkg mutation calculated relative to the number with a wildtype chromosome. We find that there is no lethality associated with embryos from females heterozygous for either of 2 different vkg alleles, suggesting there is a compensation mechanism for the early defects in signalling. Each plotted value is an average taken from five separate counts of at least 100 flies each (n=5). Error bars denote s.e.m. Significant differences (Student s t-test) are indicated *P< b, Cuticle phenotypes of progeny 10

11 from the crosses as labelled (females x males). The filzkörper structure, which is internalised in the mutants, is marked with an asterisk on the wildtype cuticle. The proportion of cuticles showing these phenotypes is: wt x dpp hr56 99%; vkg k00236 /+ x wt 99%; vkg k00236 /+ x dpp hr56 40%, dpp hr56 homozygote 31% (n>400 across 3 biological repeats in all cases). Embryos from wildtype females crossed to dpp hr56 males have an essentially normal cuticle, as do embryos from vkg k00236 heterozygous females which inherit a wildtype copy of dpp paternally. In contrast, embryos from vkg k00236 /+ mothers which inherit the dpp hr56 mutation have a partially ventralised phenotype with head defects and an internalised filzkörper. An average of 40% of embryos have this phenotype (n=400 from 3 biological repeats), in a similar range to the lethality observed. Such a phenotype resembles that of embryos homozygous for the dpp hr56 mutation, providing additional evidence that embryos from vkg/+ females are deficient in Dpp signalling. c, RNA in situ hybridisation of Race and ush expression in embryos from either wildtype or vkg k00236 heterozygous females crossed to dpp hr56 /+ males. The expression patterns are unaffected in embryos when wildtype females are tested. However, in embryos from vkg/+ females, the Race expression pattern is lost from the presumptive amnioserosa and the headspots are diminished. This can lead to a total loss of the most anterior headspot as shown here. The ush expression pattern is thinner. Overall, embryos from vkg heterozygous females crossed to dpp hr56 males appear to have a more severe loss of Race headspot expression and slightly narrower ush pattern than that observed in embryos from vkg/+ females crossed to wildtype males (compare with Fig. 3a). 11

12 Supplementary Figure 9. Ectopic Dpp signalling rescues vkg mutant embryos. RNA in situ hybridisation of dpp and Race expression in embryos from vkg k00236 heterozygous females crossed to wt males or those carrying a st2-dpp transgene, as indicated. Lateral and dorsal views are shown for embryos stained for dpp and Race respectively. The st2-dpp transgene contains the even-skipped stripe 2 enhancer which drives an ectopic source of dpp in a stripe along the anterior-posterior axis. Embryos carrying this transgene show ectopic activation of Race expression over many cell diameters in a wildtype embryo in response to the misexpressed dpp stripe 8. The embryos shown here reveal that the defect in Race expression observed in embryos from vkg/+ females is rescued by dpp overexpression in embryos carrying the transgene, supporting the hypothesis that the mutant phenotype is due to insufficient Dpp signalling. 12

13 Supplementary Figure 10. Vkg overexpression augments Dpp signalling. a, RNA in situ hybridisation of Race expression in embryos (dorsal views) that are either wildtype or contain a vkgfl transgene, which expresses full-length vkg under the control of the ubiquitin enhancer that drives maternal and ubiquitous zygotic expression 9. Race expression is expanded in a proportion of embryos overexpressing vkg, suggesting enhanced Dpp signalling. b, The cuticle phenotypes of embryos collected from dpp hr56 /+, dpp hr56 /+; vkgfl/+ or dpp hr56 /+; vkg FLΔ/+ females and males were analysed, and the proportion mutant calculated relative to the total number. The typical cuticle phenotype of dpp hr56 homozygous embryos is shown in Supplementary Fig. 8. Each plotted value is an average calculated from 3 biological repeats with at least 300 cuticles counted for each (n=3). Error bars denote s.e.m. When dpp hr56 /+ females and males are crossed, the proportion of resultant embryos with a mutant phenotype exceeds the 25% predicted for dpp hr56 homozygotes. However, a similar effect has been documented previously and attributed to weak haplolethality of the dpp hr56 allele 6. The data reveal that in the presence of the vkgfl transgene there are significantly less mutant embryos (*P<0.05, 13

14 Student s t-test), equivalent to rescue of approximately one quarter of the mutants observed in the absence of a transgene. This may reflect a requirement for embryos to be homozygous for the vkgfl transgene in order for the mutant phenotype to be rescued. Nonetheless, these results suggest that there is increased Dpp signalling in the presence of higher Vkg levels. Moreover, the vkgflδ transgene is ineffective at rescuing the mutant phenotype, consistent with an interaction between type IV collagens and Dpp being necessary to promote gradient formation and signalling in vivo. References: 1. Than, M. E. et al. The 1.9-A crystal structure of the noncollagenous (NC1) domain of human placenta collagen IV shows stabilization via a novel type of covalent Met-Lys cross-link. Proc. Natl. Acad. Sci. U S A 99, (2002). 2. Sundaramoorthy, M., Meiyappan, M., Todd, P. & Hudson, B. G. Crystal structure of NC1 domains. Structural basis for type IV collagen assembly in basement membranes. J. Biol. Chem. 277, (2002). 3. Bialojan, S., Falkenburg, D. & Renkawitz-Pohl, R. Characterization and developmental expression of beta tubulin genes in Drosophila melanogaster. Embo J. 3, (1984). 4. Yasothornsrikul, S., Davis, W. J., Cramer, G., Kimbrell, D. A. & Dearolf, C. R. viking: identification and characterization of a second type IV collagen in Drosophila. Gene 198, (1997). 5. Lunstrum, G. P. et al. Drosophila basement membrane procollagen IV. I. Protein characterization and distribution. J. Biol. Chem. 263, (1988). 6. Medioni, C. & Noselli, S. Dynamics of the basement membrane in invasive epithelial clusters in Drosophila. Development 132, (2005). 14

15 7. Wharton, K. A., Ray, R. P. & Gelbart, W. M. An activity gradient of decapentaplegic is necessary for the specification of dorsal pattern elements in the Drosophila embryo. Genetics 142, (1996). 8. Ashe, H. L., Mannervik, M. & Levine, M. Dpp signaling thresholds in the dorsal ectoderm of the Drosophila embryo. Development 127, (2000). 9. Lee, H. S., Simon, J. A. & Lis, J. T. Structure and expression of ubiquitin genes of Drosophila melanogaster. Mol. Cell. Biol. 8, (1988). 15