BIOTECHNOLOGY UNIT EXAM REVIEW PACKET
|
|
|
- Imogen Thompson
- 5 years ago
- Views:
Transcription
1 Name: TOC# This is due by 11/12 Unit Test of 11/14 All late work due by 11/14 BIOTECHNOLOGY UNIT EXAM REVIEW PACKET This review must be completed by 11/12. This covers most of what is on the exam. However, it does not cover EVERY SINGLE THING we learned, so make sure to still study with your notes/flashcards etc. To do well on this unit test: 1. Complete this packet by filling in what you know from memory. 2. Go back and use your notes to fill in the blanks AND CHECK YOUR ANSWERS 3. Print and complete this packet again. 4. Use your flashcards to test yourself (assuming your flashcards are correct). To use flashcards correctly: go through the deck and separate the ones you know 100% and the ones you don t into two piles. Then go through the I don t know this 100% pile until you do know them. Do this again from the start until they all end up in the I know this 100% pile. 5. Print this packet and complete it again. You should be able to fill it out all from memory. Yes, this is a lot, but this is what STUDYING really looks like. You should work on this for a couple of hours each day between now and the unit test if you want to do well. Do not try to study for 10 hours in one day. 1-2 hours Thursday, Friday, Saturday, Sunday, Monday, Tuesday, Wednesday is much more effective. GENE MUTATIONS Looking at Biotech Notes #1, and chapters 17-4 and 17-5 in the book as a guide, explain the following: 1. Define mutation: 2. Define gene mutation: 3. What are the two categories of gene mutations? 4. Why is a point mutation less likely to create a harmful mutation than a frameshift mutation?
2 5. Define chromosomal mutation 6. Complete the following chart Nondisjunction Deletion Translocation Inversion Duplication Definition Example Drawing BIOTECHNOLOGY TOOLS 1. Define Genetic engineering 2. Define recombinant DNA and draw and label a diagram. 3. What are the 6 steps of creating recombinant DNA (be sure to look at your notes so you get the correct ones) 4. What are transgenic organisms? 5. Why is bacteria a useful tool in genetic engineering?
3 6. What is a plasmid? 7. Why are plasmids good for use in biotechnology 8. What is a genome? 9. What is a restriction Enzyme? 10. What is the DNA sequence called where a restriction enzyme cuts? 11. Where did Restriction Enzymes originate from? 12. What are the two types of cuts 13. Why are restriction enzymes important to recombinant DNA? 14. Why are restriction enzymes important to gel electrophoresis? 15. Label whether each restriction enzyme will create sticky ends or blunt ends?
4 16. Please identify the recognition sites for the following RE. Put a box around the recognition sites in the DNA sequence and arrows to indicate where the cuts will occur. Restriction enzyme BamHI: ATCGGATCCTGTCGACGCCAATAGCTGTCGACTAGCTCCATTGTCA TAGCCTAGGACAGCTGCGGTTATCGACAGCTGATCGAGGTAACAGT APPLICATIONS OF BIOTECH: 1. Genetically modified organisms (crops and animals) a. Define genetically modified oraganism b. Explain the steps of creating genetically modified organisms (include the use of restriction enzymes, recombinant DNA, and transformation) c. Explain the example of an transgenic crop from class, Bt corn. 2. In Vitro Fertilization (sex selection and pre-implantation genetic diagnosis) a. Explain the steps of In-vitro Fertilization b. Why would a couple use IVF? c. Explain what sex-selection is. d. Explain what PGD is.
5 e. How is sex-selection/pgd done? (please look at your notes, many missed this on the quiz). f. Why is PGD done? 3. stem cell research a. What are embryonic stem cells, where are they found and what are their potential? b. What are somatic stem cells, where are they found and what are their potential? c. What are induced pluripotent stem cells, where are they found and what are their potential? d. Explain the controversy surrounding stem cell research. 4. DNA in crime solving a. Explain the process of gel electrophoresis (be sure to include the function of restriction enzymes)
6 b. What is a DNA fingerprint? c. Why do we use DNA fingerprints and gel electrophesis to help in crime solving? d. Using the gel electrophoresis below, examine each DNA fingerprint. Who should be arrested for the crime? Explain why. Please reference the bands and restriction enzymes and DNA sequence. 5. reproductive and therapeutic cloning a. What is the process of reproductive cloning? b. What is the process of therapeutic cloning? c. What is formed in reproductive cloning? d. What is formed in therapeutic cloning?
7 GENE REGULATION 1. What is gene regulation? 2. Why do organisms regulate their gene expression? 3. One part of gene regulation is to be efficient, what are the 3 steps taken before mrna translation to make the process more efficient? Explain each. 4. What is an operon? 5. Define the following terms: a. Regulatory gene: b. Repressor: c. Operator: d. Promoter: e. Inducer: f. RNA polymerase:
8 6. What is the figure below illustrating? 7. What is the figure labeled C? What does it bind to? How does it effect gene regulation? 8. What is the figure labeled D? What does it bind to? How does it effect gene regulation? 9. What is labeled as figure A and why is it important? 10. What is labeled as figure B and why is it important 11. Is the figure above showing a gene that is switched on or off? Why 12. In the space below, draw and explain the alternate form of the operon for gene expression.
9 pglo BIOTECHNOLOGY UNIT EXAM REVIEW PACKET 1. Define transformation 2. How do you know if your transformation was successful? 3. Fill in the chart below LB/-DNA LB/AMP/+DNA LB/AMP/-DNA LB/AMP/ara/+DNA What does the plate contain? Growth? Circle: Yes/no Circle: Yes/no Circle: Yes/no Circle: Yes/no Glowing? Circle: Yes/no Circle: Yes/no Circle: Yes/no Circle: Yes/no Explanation Why each plate appears the way it does. 4. What are the three genes of interest on the pglo plasmid and what do they do? 5. Explain how the genes in the plasmid function together to regulate the expression of GFP. You may use drawings and words.
10 6. What is the purpose of the following things in the lab? - Luria Broth: - Ampicillin: - Arabinose: - Transformation solution: - Heat shock: - -pglo solution: - +pglo solution: - e.coli start plate: 7. What is the difference between arabinose and arac? 8. What is the difference between ampicillin and ampicillin resistance? Which is on the pglo plasmid?
Final Review: Biotech Section
Name: attempt# Final Review: Biotech Section GENE MUTATIONS 1. Define mutation: 2. Define gene mutation: 3. What are the two categories of gene mutations? 4. Label the diagram with the different types
Name: Date: IF YOU GOT BELOW A 70% RETAKING THE TEST IS MANDATORY.
IF YOU GOT BELOW A 70% RETAKING THE TEST IS MANDATORY. 1. What is a mutation? Any change in a DNA sequence 2. Name and describe the two categories types of gene mutations. Point: substitution, one nucleotide
Introduction to pglo lab
Please take these notes carefully. You do not need to write anything in RED Introduction to pglo lab Bacteria Transformation What is a plasmid? A plasmid is a small circular piece of DNA (about 2,000 to
MCB 102 University of California, Berkeley August 11 13, Problem Set 8
MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without
2 Gene Technologies in Our Lives
CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?
4/26/2015. Cut DNA either: Cut DNA either:
Ch.20 Enzymes that cut DNA at specific sequences (restriction sites) resulting in segments of DNA (restriction fragments) Typically 4-8 bp in length & often palindromic Isolated from bacteria (Hundreds
Guided Notes Unit 5: Molecular Genetics
Name: Date: Block: Chapter 8: From DNA to Protein I. Concept 8.4: Transcription a. Central Dogma of Molecular Biology i. Information flows in one direction: ii. How? Guided Notes Unit 5: Molecular Genetics
Amgen Laboratory Series. Tabs C and E
Amgen Laboratory Series Tabs C and E Chapter 2A Goals Describe the characteristics of plasmids Explain how plasmids are used in cloning a gene Describe the function of restriction enzymes Explain how to
Virtual Laboratory Bacterial Transformation
Virtual Laboratory Bacterial Transformation Name: Before going to the Virtual lab, go to Bozeman site for AP Bio and watch: Lab 6 Molecular Biology *Note we have already done the Gel electrophoresis lab,
pglo Worksheet Wednesday, January 31, 2018
pglo Worksheet Wednesday, January 31, 2018 9:57 PM pglo Worksheet final 2 Page 1 An organism composed of a single cell is better suited for genetic transformation--it can transform at a faster rate - we
I. Gene Cloning & Recombinant DNA. Biotechnology: Figure 1: Restriction Enzyme Activity. Restriction Enzyme:
I. Gene Cloning & Recombinant DNA Biotechnology: Figure 1: Restriction Enzyme Activity Restriction Enzyme: Most restriction enzymes recognize a single short base sequence, or Restriction Site. Restriction
2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.
AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing
AQA Biology A-level Topic 8: The control of gene expression
AQA Biology A-level Topic 8: The control of gene expression Notes Mutations Mutations are changes in the sequence of nucleotides in DNA molecules. Types of mutations include: Insertion/deletion mutations
Enzyme that uses RNA as a template to synthesize a complementary DNA
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have
Genetics and Biotechnology 13.2 DNA Technology
Biotechnology Genetic Engineering Technology that involves manipulating the DNA of one organism in order to insert the DNA of another organism An electric current is used to separate DNA fragments according
NOTES - CH 15 (and 14.3): DNA Technology ( Biotech )
NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for
Chapter 11: Applications of Biotechnology
Chapter 11: Applications of Biotechnology Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 11-1 Why Biotechnology Works 11-2 Biotechnology
12/31/16. I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA. 1. DNA is a very large molecule
I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA 1. DNA is a very large molecule 3. Led to many biotechnology applications- genetic engineering, DNA fingerprinting, cloning,
Bacterial Transformation Lab - pglo
Bacterial Transformation Lab - pglo Name: Date: Pre-Lab Score: Lab Overview: In this investigation, you will gain an understanding of the techniques of culturing E. coli bacteria and transforming using
Unit 8: Genomics Guided Reading Questions (150 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 18 The Genetics of Viruses and Bacteria Unit 8: Genomics Guided
-Is the process of manipulating genes and genomes
Genetic Engineering -Is the process of manipulating genes and genomes Biotechnology -Is the process of manipulating organisms or their components for the purpose of making useful products Restriction Enzymes
Biotechnology Chapter 20
Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the
Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
Can a cross-over event occur between genes A and D? Briefly support your answer.
Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday
Chapter 5 Learning Objectives
Schedule and Announcements Go over Exam 1 Look at Elodea (plant cells) Start Chapter 5 Quiz Thursday over lab material Science Café 2 Friday Don t forget- research plan for project is due Friday September
Step 1: Digest vector with Reason for Step 1. Step 2: Digest T4 genomic DNA with Reason for Step 2: Step 3: Reason for Step 3:
Biol/Chem 475 Spring 2007 Study Problems for Quiz 2 Quiz 2 (~50 pts) is scheduled for Monday May 14 It will cover all handouts and lab exercises to date except the handout/worksheet (yet to be distributed)
UNIT 3: GENETICS Chapter 9: Frontiers of Biotechnology
CORNELL NOTES Directions: You must create a minimum of 5 questions in this column per page (average). Use these to study your notes and prepare for tests and quizzes. Notes will be stamped after each assigned
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 1 The BIG Questions! How can we use our knowledge of DNA to: " diagnose disease or defect? " cure disease or defect? " change/improve organisms?!
DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Here s one thing genetic engineers do: Techniques for gene cloning enable scientists to prepare multiple identical copies of gene-sized pieces of DNA. Cloning means to make copies, in this case, copies
Unit 6: Gene Activity and Biotechnology
Chapter 16 Outline The Molecular Basis of Inheritance Level 1 Items students should be able to: 1. Recognize scientists and the experiments that lead to the understanding of the molecular basis of inheritance.
Chapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
Chapter 20 DNA Technology & Genomics. If we can, should we?
Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant
Regents Biology REVIEW 5: GENETICS
Period Date REVIEW 5: GENETICS 1. Chromosomes: a. Humans have chromosomes, or homologous pairs. Homologous: b. Chromosome pairs carry genes for the same traits. Most organisms have two copies of the gene
MCDB 1041 Class 27. Making recombinant DNA and using it
MCDB 1041 Class 27 Making recombinant DNA and using it Learning Goals Explain why and how bacteria can be easily used to make copies of human DNA. Compare the two methods for making lots of copies of DNA:
Problem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
APS Science Curriculum Unit Planner
APS Science Curriculum Unit Planner Grade Level/Subject Biology DNA / DNA Technology Stage 1: Desired Results Enduring Understanding Advancements in our understanding of DNA have both solved and created
Student Manual. pglo Transformation
Student Manual pglo Transformation Lesson 1 Introduction to Transformation In this lab you will perform a procedure known as genetic transformation. Remember that a gene is a piece of DNA which provides
GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
Page 70 Monday December 8, 2014
replication and Monday December 8, 0 Notebook check 8: Page 69, DNA Technology Introduction Worksheet. The process by which a foreign gene is replicated by insertion into a bacterium is called genetic
Biosc10 schedule reminders
Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,
Wake Acceleration Academy - Biology Note Guide Unit 5: Molecular Genetics
Wake Acceleration Academy - Biology Note Guide Unit 5: Molecular Genetics Extra Resources Website: http://waa-science.weebly.com Module 1: Overview of DNA Vocabulary Term Definition (You may use an Internet
BISHOPAgEd.Weebly.com. Weeks: Dates: 1/18-1/29 Unit: RNA &Protein Synthesis. Monday Tuesday Wednesday Thursday Friday. FFA Meeting 6pm 27 E
Ms. King BISHOPAgEd.Weebly.com Name: Period: Weeks: 21-22 Dates: 1/18-1/29 Unit: RNA &Protein Synthesis Monday Tuesday Wednesday Thursday Friday 18 NO School 19 E 20 O RNA Part 1 FFA Meeting 6pm 21 E 22
Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis
Name: Date: Period: Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis ***Completing this study guide in its entirety will result in extra credit on the exam. You must show me the DAY OF the
Green Fluorescent Protein (GFP) Purification. Hydrophobic Interaction Chromatography
Green Fluorescent Protein (GFP) Purification Hydrophobic Interaction Chromatography What is the GFP gene? GFP is a green fluorescent protein that is normally found in jellyfish. It has been engineered
Lab 5/5a Transformation of E. coli with a Recombinant Plasmid
Lab 5/5a Transformation of E. coli with a Recombinant Plasmid Lab 2 Pre Lab Readiness Familiarity and Proper use of micropipettes Remember the 1 st and 2 nd stops Aseptic Technique Antibiotic Resistance
Revision Based on Chapter 15 Grade 10
Revision Based on Chapter 15 Grade 10 Biology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Which of the following has the disadvantage of possibly bringing
LABORATORY 5: TRANSFORMING BACTERIA WITH THE LIGATION PRODUCTS
LABORATORY 5: TRANSFORMING BACTERIA WITH THE LIGATION PRODUCTS So far in your quest to clone a gene you have produced recombinant plasmids and verified that you made the para-r plasmid containing the rfp
GENE EXPRESSSION. Promoter sequence where RNA polymerase binds. Operator sequence that acts as a switch (yellow) OPERON
GENE EXPRESSSION 1 GENE REGULATION IN PROKARYOTES Bacteria can turn genes on or off depending on their environment Prokaryotes have operons clusters of related genes and regulatory sequences Promoter sequence
DNA Function. DNA Heredity and Protein Synthesis
DNA Function DNA Heredity and Protein Synthesis 1 Review DNA made of Nucleotide bases Proteins made of Amino acids Describe how DNA is involved in protein synthesis DNA base sequence codes for amino acid
Biotechnology. D. Drugs may already exist to cure these diseases, so there is no need for risky therapy.
Name: Date: 1. Certain disorders, such as sickle cell anemia, are linked to specific genes. Some scientists would like to use gene therapy to cure such disorders. Gene therapy involves replacing the nonworking
13-1 Changing the Living World
13-1 Changing the Living World In the past, variation was limited to the variations already in nature or random variations that resulted from mutations. Now, scientists can change DNA and swap genes from
BIOLOGY 101. CHAPTER 18: Gene Expression: Turning genes on and off
BIOLOGY 101 CHAPTER 18: Gene Expression: Turning genes on and off BACTERIAL TRANSFORMATION: Bacteria have the ability to pick up DNA from their surroundings and transcribe it as if it was their own. When
Biotechnology (Chapter 20) Objectives
Biotechnology (Chapter 20) Objectives Understand the background science behind the technology applications Understand the tools and details of the technology Develop familiarity with performing the select
Genetic Technologies
Genetic Technologies Distinguish the terms biotechnology, recombinant DNA technology, transgenic organisms, genetic engineering Understand the two basic techniques to obtain selective fragments of DNA
Transforming E. Coli with pglo Plasmids
Name: Transforming E. Coli with pglo Plasmids AP Biology Transformation Background: Transformation is a process of transferring genetic information from one organism to another. In bacteria, a small circular
Bio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
Answers to Questions: Teacher s Edition PreLab Activity: Student Learning Outcome & Pre-Lab Predictions For Laboratory Activity
: Teacher s Edition PreLab Activity: Student Learning Outcome & Pre-Lab Predictions For Laboratory Activity Student Learning Outcomes at the end of this laboratory, students will be able to: 1. Explain
Module 17: Genetic Engineering and Biotechnology, Student Learning Guide
Name: Period: Date: Module 17: Genetic Engineering and Biotechnology, Student Learning Guide Instructions: 1. Work in pairs (share a computer). 2. Make sure that you log in for the first quiz so that you
3. This is the name of the small fragments of DNA that are replicated with several RNA primers in between them:
Section A: Multiple Choice [15] 1. The central dogma states that: a) DNA is held in the nucleus, which is translated into an amino acid strand, which leaves the nucleus and is transcribed into a mrna strand
2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
ONTARIO SCIENCE CENTRE
ONTARIO SCIENCE CENTRE Table of Contents Bacterial transformation background information 3 Experimental procedure 5 Expected results 8 Post-program activity sheet 9 Post-program activity sheet with answers
Virus- infectious particle consisting of nucleic acid packaged in a protein coat.
Chapter 19 Virus- infectious particle consisting of nucleic acid packaged in a protein coat. Most scientists consider viruses non-living because they cannot reproduce or carry out metabolic activities
CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
Biology Chapter 9 & Honors Biology Chapter 13. Frontiers Of Biotechnology
Biology Chapter 9 & Honors Biology Chapter 13 Frontiers Of Biotechnology DNA TECHNOLOGY IS ABOUT: Manipulating DNA for man s purposes. It includes: cutting DNA, Gel Electrophoresis and Polymerase Chain
WARM UP. 1. Take out your laptop and Chapter 12 Notes 2. Log in to Google Classroom 3. Wait for me to post the quick quiz!
WARM UP 1. Take out your laptop and Chapter 12 Notes 2. Log in to Google Classroom 3. Wait for me to post the quick quiz! AGENDA Warm up- Quick Quiz Chapter 13 Notes: Genetic Technology Genetic Engineering
BIOTECHNOLOGY. Understanding the Application
BIOTECHNOLOGY Understanding the Application GENETIC ENGINEERING Genetic engineering refers to any process in which man alters an organism s DNA Examples: cloning, genetically modified organisms (GMO),
Mutations, Genetic Testing and Engineering
Mutations, Genetic Testing and Engineering Objectives Describe how techniques such as DNA fingerprinting, genetic modifications, and chromosomal analysis are used to study the genomes of organisms (TEKS
2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
DNA Technology Outline
I) Tools of DNA technology A. PCR (Polymerase Chain Reaction): method of copying DNA sequences 1. DNA is copied in a similar way to natural replication in our cells, but much faster. 2.PCR consists of
Name Per AP: CHAPTER 27: PROKARYOTES (Bacteria) p559,
AP: CHAPTER 27: PROKARYOTES (Bacteria) p559, 561-564 1. How does the bacterial chromosome compare to a eukaryotic chromosome? 2. What is a plasmid? 3. How fast can bacteria reproduce? 4. What is a bacterial
Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
Biology Warm Up. 1. Complete the entrance ticket you received at the door.
Biology Warm Up Monday, February 8 1. Complete the entrance ticket you received at the door. NOTE: This is not a grade. I want to see what you know/remember. Once you finish, place in front blue basket.
DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
Transforming E. Coli with pglo Plasmids
Name: Transforming E. Coli with pglo Plasmids AP Biology Transformation Background: Transformation is a process of transferring genetic information from one organism to another. In bacteria, a small circular
BIOTECHNOLOGY. Understanding the Application
BELLRINGER-5/4/15 1. What method would you guess forensic scientists use to identify criminals at crime scenes? 2. What do you think we mean by the term biotechnology? BIOTECHNOLOGY Understanding the Application
B.Sc V Semester Question Bank. B.Sc V Semester Question Bank. Prepared by Nitin Swamy, Department of Biotechnology, SACJ Page 1 of 6
B.Sc V Semester Question Bank Prepared by Nitin Swamy, Department of Biotechnology, SACJ Page 1 of 6 UNIT I Genetic Material Different forms of DNA (DNA topology):- B-form, Z-form, D-form; Gene structure-introns,exons
Chapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and
Chapter 14: Genes in Action
Chapter 14: Genes in Action Section 1: Mutation and Genetic Change Mutation: Nondisjuction: a failure of homologous chromosomes to separate during meiosis I or the failure of sister chromatids to separate
Researchers use genetic engineering to manipulate DNA.
Section 2: Researchers use genetic engineering to manipulate DNA. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the different tools and processes used in genetic
Chapter 18. The Exciting World Of Bacterial Genetics
Chapter 18. The Exciting World Of Bacterial Genetics Why study bacterial genetics? Its an easy place to start history we know more about it systems better understood simpler genome good model for control
Competent cells formation &Transformation of competent cells with recombinant plasmid DNA. BCH462- Practical
Competent cells formation &Transformation of competent cells with recombinant plasmid DNA BCH462- Practical Cell-based technique used to create copies of certain DNA fragments using a vector carrying the
Name Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
Biology Day 67. Tuesday, February 24 Wednesday, February 25, 2015
Biology Day 67 Tuesday, February 24 Wednesday, February 25, 2015 Do#Now:' Brainstorm+8.5 + 1. Write today s FLT! 2. Identify 3 specific differences between DNA and RNA.! 3. is the process of making RNA
7.02/ RECOMBINANT DNA METHODS EXAM KEY
MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 RECOMBINANT DNA METHODS EXAM KEY Regrade requests are due to the instructor in the 7.02 teaching lab by the
Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
Wk Std Monday Tuesday Wednesday Thursday Friday 13 Obj./Essential question: ~DNA Structure ~DNA Replication
Wk Std Monday Tuesday Wednesday Thursday Friday 13 NO SCHOOL What are the 4 nitrogenous bases of DNA? DNA & Ch 11.1 281-287 replication review questions When 2 daughter strands of dna are synthesized from
BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction
BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology
C A T T A G C nitrogenous complimentary G T A A T C G to each other
Name DNA RNA Review Worksheet Date 1. What does DNA stand for? Deoxyribonucleic acid 2. What is DNA s primary function? - Provides a pattern for protein manufacture - Provides a pattern for replication
What is Biotechnology? 15.1 What is Biotechnology? Transgenic Biotechnology Transgenic Biotechnology. Biotechnology. Transgenic organism
What is Biotechnology? 15.1 What is Biotechnology? Biotechnology the use of technology to control biological processes as a means of meeting societal needs Gene therapy Genetic engineering Bioremediation
Bacterial Transformation with pglo, Part 1
Biology 211 Bacterial Transformation with pglo, Part 1 OBJECTIVES: Practice formulating predictions Describe the principles of bacterial transformation. Explain the procedure for gene transfer using plasmid
Overview: The DNA Toolbox
Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant
B. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
Pick up 3 handout from back. Draw this on the back side of the handout called Concepts of biotechnology. After you have read and highlighted
Pick up 3 handout from back. Draw this on the back side of the handout called Concepts of biotechnology. After you have read and highlighted important information from the reading, see if you cann identify
Chapter 9 Genetic Engineering
Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation
Genetic Technologies.notebook March 05, Genetic Technologies
Genetic Testing Genetic Technologies Tests can be used to diagnose disorders and/or identify those individuals with an increased risk of inheriting a disorder. Prenatal Screening A fetus may be screened
Name Biol Group Number. ALE 11. The Genetics of Viruses, Control of Gene Expression, and Recombinant DNA Technology
Name Biol 211 - Group Number ALE 11. The Genetics of Viruses, Control of Gene Expression, and Recombinant DNA Technology Chapter 19: The Genetics of Viruses (pp. 381-395, Biology by Campbell/Reece, 8 th
Genome 261, Spring 2007 ****** MIDTERM KEY ******
(16 pts) Multiple True/False CIRCLE ALL ANSWERS THAT ARE TRUE!!!! 1. A gene is a sequence of deoxyribonucleotides. can be transcribed into RNA. typically codes for a protein. can have a slightly different