Sex affects BMPR-II signalling in pulmonary artery smooth muscle

Transcription

1 Sex affects BMPR-II signalling in pulmonary artery smooth muscle cells. Kirsty M Mair, Xu Dong Yang, Lu Long, Kevin White, Emma Wallace, Marie-Ann Ewart, Craig K Docherty, Nicholas W Morrell, and Margaret R MacLean ONLINE DATA SUPPLEMENT

2 Supplemental information Methods hpasmcs The peripheral human PASMCs were isolated by microdissection from peripheral segments of artery (0.3 to 1.0mm external diameter) from macroscopically normal tissue removed from patients with undergoing pneumonectomy with no reported presence of PAH. PASMCs were plated in 10% FBS/DMEM and used between passages 5 to 6. The smooth muscle lineage of cells was confirmed by positive immunofluorescence staining using antibodies to -smooth muscle actin and smooth muscle myosin (Sigma-Aldrich Co Ltd, Poole, UK). Experimental procedures using human lung tissue and hpasmcs conform to the principles outlined in the Declaration of Helsinki and approved by Cambridge East NHS ethical review committee, giving full consent. See Table E1 for details of the patients from which the cells were derived. Isolation of PASMCs from Smad1+/- mice Main pulmonary artery was dissected from wild-type and Smad1+/- mice. PASMCs were explanted, derived and grown in 20%FBS/DMEM with supplement Pack (C-39262, PromoCell, UK) before passage. The smooth muscle phenotype was confirmed by positive immunofluorescent staining using an antibody to smooth muscle specific α-actin (Sigma, UK). The cells were used between passages 4~6 for experiments. E2

3 Proliferation of male vs female PASMCs The cells were plated at 30k/well of 24-well plate overnight, next day the medium was replaced; 1% or 10%FBS/DMEM with or without the drug of choice (E2/0.1µM; 5-HT/1µM; 4-OHE2/1µM; PDGF/5ng/ml, BMP4/10ng/ml) for 3 days unless stated otherwise. Viability of the cells was reduced post-5 days of growth, hence 3 days was the preferred time-point. The ER antagonist 1,3-Bis(4- hydroxyphenyl)-4-methyl-5-[4-(2-piperidinylethoxy)phenol]-1h-pyrazole dihydrochloride (MPP/1µM) was added 30 minutes prior to E2. The cell numbers were counted at the end time points. Experiments in lysates were repeated 3-4 times. sirna transfection in pulmonary artery smooth muscle cells Synthetic small interference RNA (sirna) targeting human BMPRII, SMAD1 and ID3 (20nmol/L, SCBT) were used for targeted gene knockdown in male hpasmcs. sirna with a nontargeting sequence was utilized as a negative control (20nmol/L, SCBT) and untreated (1% FBS) PASMCs served as the experimental control for sirna transfection. Knockdown was confirmed by qrt- PCR and Western blotting at 48 hours. RT-PCR mrna expression was assessed by quantitative reverse transcription polymerase chain reaction. The hpasmcs were harvested after 48hr quiescence in serum-free EGM-2. The total RNA was then extracted from the E3

4 lung tissue or hpasmcs by TRAzol reagent (life technologies, UK) and gene expression quantified using TaqMan gene expression assays (assay details shown in Table E2). ViiA7 Real-time PCR system (Applied Biosystems) was programmed for PCR conditions 95 o C for 10 minutes followed by 50 cycles of 95 o C for 15 seconds and 60 o C for 1 minute. Results were normalised to β-2- microglobulin. The fold change for every gene was obtained using the 2 -ΔΔCt method and expressed relative to control rodent tissue/cells as appropriate. Immunoblotting Protein expression was assessed in mouse whole lung and hpasmcs. hpamscs were seeded on 6cm dishes until ~90% confluence and then quiescent in 0.1%FBS/DMEM. The cells were harvested as the baseline condition after 48hr quiescence. Lung tissue was homogenised in radioimmunoprecipitation assay buffer via ultrasonic homogenization. Samples were denatured and electrophoresed on SDS-PAGE gel. Separated proteins were transferred to PVDF membrane and incubated for 1 hour with 5% milk/tbst (w/v) before incubating overnight at 4 o C with antibodies against aromatase, BMPR-II, psmad1/5/8, Smad1, Id1, Id3, COMT, aromatase, CYP1B1, terk1/2, perk1/2 or GAPDH. Housekeeping antibodies used were α-tubulin or -actin. Densitometric analysis was performed with TotalLab TL100 software. Data are expressed relative to α-tubulin or -actin density. For details of type, source and dilutions of primary antibodies used refer to Table E3. E4

5 Haemodynamics All haemodynamic measurements were carried out under general anaesthesia using 1-2% (v/v) isoflurane supplemented with O 2. Right ventricular systolic pressure (RVSP) was measured by a transdiaphragmatic approach by advancing a heparinised needle into the mid-portion of the abdomen using a micromanipulator. Systemic arterial pressure (SAP) was obtained by cannulation of the left common carotid artery as previously described. Vascular remodelling in mice lungs were removed and fixed with 10% neutral buffered formalin and embedded in paraffin. 5µm sections were stained with anti-α-smooth muscle actin antibody and some lightly counterstained with hematoxylin. α-smooth muscle actin was visualized with the DAB substrate kit (Vector Laboratories, UK), which stained brown/dark brown. Small pulmonary vessels ( μm diameter) accompanying alveolar ducts were assessed for degrees of circumferential α-sma positive staining indicative of muscularization. Vessels were classified as non-muscular (no α-sma positive immunoreactivity), partially muscular or fully muscularised. The percentage of vessels in each of the 3 muscularisation categories was expressed as a percentage of total vessels counted for each animal by a blinded observer. Lung sections from 4 mice per group were assessed and at least 40 vessels were analyzed per animal. Images were captured using a Zeiss Axio Imager M1. For details of primary antibodies used refer to Supplemental Table E3. Bilateral ovariectomy E5

6 To investigate the role of ovarian hormones in the development of PH, we ovariectomized wildtype (WT) and Smad1+/- mice at 8 10 weeks of age. Bilateral ovariectomy was performed under inhalational anaesthesia (1.5% isoflurane supplemented with O 2 ). A dorsal midline skin incision was performed and the ovaries located and removed by cauterization through the distal uterine tube. Successful removal of the ovaries was confirmed at necropsy by weight measurement of the uterus (Figure E1). In vivo measurements were assessed following 12 weeks surgical recovery (5 months of age). Sham-operated mice were studied as controls. E6

7 Figure E1. Uterine weight following ovariectomy (OVX) or sham operation (sham) in female Smad1+/- mice (+/-) and their wildtype controls (WT) (n=6-9). E7

8 Figure E2. Lung expression of Smad1, BMPR-II (BRII), Id1 and Id3 mrna in Smad1 heterozygous knockout mice (+/-) compared to wildtype controls (+/+). (A) Smad 1 mrna levels were significantly reduced in both male and female +/- mice compared to +/+ mice (n=5-6). Female +/+ mice express lower lung levels of Smad1 mrna than males, and Smad1 is decreased more markedly in female +/- mice than male +/- mice. Levels of BMPR-II (BRII) and Id3 were significantly lower in female mice than male (B, C). n=5-6. Plasma estrogen (E2) levels were not affected by Smad knockdown in female mice (n= 3-5) (D) and both +/+ and +/- female mouse lung express both aromatase and CYP1B1 (E-G). p<0.05, p<0.01, one-way ANOVA with Bonferroni post-hoc analyses. E8

9 Figure E3. Expression of BMPR-II, Smad1, Id1 or Id3 mrna in liver and kidney tissue from male and female Smad1+/- mice (n=5). E9

10 Figure E4. Expression of extracellular-signal-regulated kinases (ERK) 1 and 2, estrogenic enzymes and inhibitory Smads in male (M) and female (F) human pulmonary arterial smooth muscle cells (hpasmcs). (A) Representative Western blots for perk1/2, terk1/2, aromatase, CYP1B1, membrane-bound COMT (MB-COMT),soluble COMT (S-COMT), CYP1A1 and the inhibitory Smad proteins 6 and 7. (B) perk2 (but not perk1) expression is elevated in female hpasmcs. The estrogen metabolising enzymes CYP1B1 and COMT are expressed equally in male and female hpasmcs. n=4. * p<0.05, *** p<0.001 using Student s unpaired t-test with two-tailed distribution. E10

11 Male Age Diagnosis 62 Emphysema 60 Squamous carcinoma 72 n/a 68 Lung carcinoma n/a Metastatic disease n/a Differentiated adenocarcinoma 62 Squamous carcinoma Female Age Diagnosis 63 fibrosis with squamous metaplasia 56 Squamous carcinoma 64 Squamous carcinoma 59 Squamous carcinoma n/a Squamous carcinoma 64 COPD 58 Mild emphysema Table E1. Patient age and diagnosis. No evidence of pulmonary vascular remodelling following pathological examination. All cells derived from macroscopically normal lung sections. n/a: information not available. E11

12 Gene Species Assay ID/primer sequence BMPR-II Smad1 Id1 Id3 Human Human Human Human Mm _m1 Forward: CAAATCTGTGAGCCCAACAGTCAA Reverse: GAGGAAGAATAATCTGGATAAGGACCAAT Mm _m1 Forward: ACT GCC TCA TGT CAT TTA CTG C Reverse: CTA TTG GGA GAG TGA GGA AAC G Mm _g1 Forward: GACGGCCGAGGCGGCATG Reverse: GGGGAGACCCACAGAGCACG Mm _g1 Forward: CCTTCCCATCCAGACAGCCG Reverse: ACGGCCGAGTCAGTGGCAAAA Table E2. TaqMan gene expression assays purchased from Applied Biosystems and primer sequences. BMPR-II, bone morphogenetic protein type II receptor; Id1, Inhibitor of DNA-binding/differentiation protein1; Id3, Inhibitor of DNA-binding/differentiation protein3. E12

13 Antibody Type (Clone) Source (catalogue number) Dilution used BMPR-II GAPDH Smad1 monoclonal monoclonal BD Biosciences Immunoblotting: 1:10000 (612292) Abcam (ab9482) Immunoblotting: 1:10000 Cell signaling technology (9743) Immunoblotting:1:10000 psmad1/5/8 Cell signaling technology (9511) Immunoblotting: 1:1000 Id1 Id3 Aromatase CYP1B1 CYP1B1 COMT perk1/2 terk1/2 β-actin α-sma monoclonal monoclonal CalBioreagents Immunoblotting: 1:1000 (M085) CalBioreagents Immunoblotting: 1:1000 (M100) Abcam (ab18995) Immunoblotting: 1:800 Abcam (ab33586) Immunoblotting: 1:1000 Santa Cruz (H-105) Immunoblotting: 1:500 Abcam (ab126618) Immunoblotting: 1:1000 Cell signalling (9101) Immunoblotting: 1:800 Cell signalling (9102) Immunoblotting: 1:800 Sigma (A5441) Immunoblotting: 1:5000 Abcam (ab5694) Immunohistochemistry: 1:500 Table E3. Specifications and sources of antibodies used for immunoblotting and immunohistochemistry. α-sma, α-smooth muscle actin; BMPR-II, bone morphogenetic protein type II receptor; Id1, Inhibitor of DNAbinding/differentiation protein1; Id3, Inhibitor of DNA-binding/differentiation protein3; psmad1/5/8, Phosphorylated Smad1/5/8. E13