SUPPLEMENTARY INFORMATION

Transcription

1 doi:1.138/nature11172 a Aluminum ZMW Aluminum ZMW No fmet-(cy3)trna fmet fmet-(cy3)trna fmet 3S mrna 3S-Alexa488 mrna Biotin-PEG Biotin-PEG Glass Substrate Glass Substrate fmet-(cy3)trna fmet Alexa488-3S b M F 6(FK) UTR AUG UUCAAAUUCAAAUUCAAAUUCAAAUUCAAAUUCAAAUAA(UUU)4 5'-Biotin 3S Supplementary Figure 1. General experimental setup and mrna structure. a. Immobilization of 3S subunits in a ZMW. 3S subunits in complex with mrna that has a covalently attached 5' biotin were immobilized on the bottom of ZMWs via neutravidinbiotin interactions. To identify immobilized complexes in the ZMW, initiator fmettrna fmet was labeled at the elbow U8 position with Cy3. In complexes lacking initiator trna, the 3S ribosomal particles were directly labeled at h44 by annealing an Alexa488 labeled oligo to the metastable hairpin introduced into terminal loop of the h44 of 16S rrna as described in M. Dorywalska et al., Site-specific labeling of the ribosome for single-molecule spectroscopy 16. b. Model mrna based on the gp32 mrna of T4 phage. The 6(FK) mrna contains an unmodified 5' UTR with Shine-Dalgarno sequence and initiation AUG codon derived from gp32 of T4 phage, followed by six repeats of Phe-Lys codons, UAA stop codon and four UUU codons. The mrna was biotinylated at 5' end and was used to form all complexes described in this manuscript. 1

2 RESEARCH SUPPLEMENTARY INFORMATION a Fluorescence Intensity Fluorescence Intensity b Fluorescence Intensity 3S IF2 + fmet-trna fmet 3S:IF2:fMet-tRNA fmet IF2 + 5S 3S:fMet-tRNA fmet 3S:IF2:fMet-tRNA 2 fmet 3S:5S:fMet-tRNA fmet -5S IF2 -Edeine +Edeine Fluorescence Intensity S c IF2 lifetime 4 3 Lifetime (s) 2 1 IF2 NT GDPNP GDPNP GDP GDP 5S Supplementary Figure 2. Validation of dye labeled biomolecules a. 2 nm of Cy3 labeled initiator trna and 2 nm IF2: were delivered to mrna immobilized 3S-Alexa488 and resulted in stable trna binding with photobleaching- 2

3 RESEARCH limited lifetime ( = 23 s, n = 79). With 2 μm of edeine, only short sampling events ( =.28 s, n = 36) were observed. b. 3S PICs were immobilized via the mrna in ZMW wells and their presence was scored by Cy3-labeled fmet-trna fmet. 2 nm Cy5-labeled IF2 and 2 nm unlabeled 5S were then delivered to the 3S PIC. The length of the Cy5 signal can be used to establish the residence time of IF2 on the ribosome under different conditions. c. IF2 residence times on the ribosome. The residence times of IF2 on the 3S ribosome were characterized for different experimental conditions with s.d. error bars. On 3S PICs, the fitted exponential lifetime of IF2 is ~38s, which is likely photobleaching-limited. The addition of 5S subunits in the presence of lead to a short IF2 lifetime of 1.9s, consistent with rapid IF2 dissociation post 7S-complex formation. IF2 with GDP does not bind stably to 3S PICs (lifetime ~1.2 s), consistent with a 2-fold decrease in IF2 stability with GDP as measured in bulk. The number of molecules analyzed is, from left to right, n = 94, n = 95, n = 83, n = 82, n = 36, and n =

4 RESEARCH SUPPLEMENTARY INFORMATION Pathway probability IF2 first & simultaneous arrival trna first & simultaneous arrival IF1, IF3-1 nm 1 nm 1 nm IF2() 2 nm 2 nm 2 nm 1 nm fmet-trna fmet 2 nm 2 nm 2 nm 1 nm 5S 2 nm 2 nm 2 nm 1 nm Supplementary Figure 3. IF2 and initiator trna arrival to the 3S subunit. To better illustrate the relative roles that IF2 and initiator trna play in driving the formation of the 3S preinitiation complex (PIC), the relative percentage of each ligand arriving first have been combined with the percentage of molecules exhibiting simultaneous arrival of both ligands from Figure 1c. The bar plot shows the relative percentage of 3S subunits where each ligand either bound to the ribosome first or concurrently with the other ligand. 4

5 RESEARCH 5S arrival time at different [Mg] 5S binding lifetime at different [Mg] Arrival time (s) 3 Lifetime (s) mm [Mg] 5 mm [Mg] 1 mm [Mg] 5 mm [Mg] IF2 2.5 mm [Mg] 5 mm [Mg] 1 mm [Mg] 5 mm [Mg] IF2 Supplementary Figure 4. Magnesium-driven 5S joining. 3S:fMet-tRNAf Met complexes were immobilized on the surface of ZMWs. 2 nm of Cy5 labeled 5S ribosomal subunits were delivered at different Mg 2+ concentrations. IF2, when present is at 1 μm. The bar plots show exponential arrival times of 5S subunits and lifetimes of the formed complexes with s.d. error bars. Error bars represent 95% confidence intervals. Higher magnesium concentrations decreased 5S binding time, but do not enhance the stability of the 7S complex formed. The number of molecules analyzed in each column for both panels is, from left to right, n = 94, n = 246, n = 255, and n =

6 RESEARCH SUPPLEMENTARY INFORMATION a Fluorescence Intensity IF2 + 5S + Tu:Phe-tRNA Phe : 3S:fMet-tRNA fmet 3S:5S:fMet-tRNA fmet :Phe-tRNA Phe b 5S-Cy5 IF2() S-Cy5 No IFs Phe- (Cy2)tRNA Phe.4.2 Phe- (Cy2)tRNA Phe IF2(GDPNP) 1 No IFs GDPNP 1 5S-Cy S-Cy5.8.6 Phe- (Cy2)tRNA Phe.4.2 Phe- (Cy2)tRNA Phe All IFs 1 5S-Cy5.8.6 Phe- (Cy2)tRNA Phe c Efficiency of Phe-(Cy2)tRNA Phe arrival IF IF1 IF3 + Percent molecules GDPNP GDPNP Phe-(Cy2)tRNA Phe lifetime Phe-(Cy2)tRNA Phe arrival time N. D. N. D. IF IF IF1 IF3 + IF1 IF3 + Lifetime (s) GDPNP GDPNP Arrival time (s) GDPNP GDPNP Supplementary Figure 5. Arrival of the first elongator trna post 7S complex formation. a. 3S PICs were immobilized via the mrna in ZMWs and scored by Cy3 labeled fmettrna fmet. 2 nm Cy5 labeled 5S subunit, 2 nm Cy2 labeled Phe-tRNA Phe in a ternary complex with EF-Tu(), and 1 μm unlabeled IF2 were then delivered to the 3S PIC. The timing of arrival of the 5S subunit and the elongator trna is tracked by the appearance of their respective dye signals. 6

7 RESEARCH b. Traces showing subunit joining were postsynchronized to stable 5S subunit arrival (t > 1 s) being the new t = point and then overlaid together. The results are presented as contour plots normalized to the total number of the molecule on which the postsynchronization was done (the 5S subunit in this case). Strong trna density is observed immediately after 5S subunit joins in IF2 and but only a very low density is observed in IF2 and GDPNP. Without initiation factors, infrequent magnesium-driven subunit joining events were observed, and few stable elongator trna arrival events were detected in those ribosomes. The higher density of trna events in the GDPNP plot without factors is likely the result of magnesium-driven trna binding. There is an increased effective magnesium ion concentration in GDPNP as it chelates magnesium less effectively then. In the lower panel, with all initiation factors (IF1, IF2, and IF3), the postsynchronized behavior of elongator trna arrival does not change noticeably from IF2 only. c. The percent of stable 7S molecules showing stable elongator trna arrival (>1 s) in the left panel 1 s after subunit joining was plotted in the left panel. The single exponential lifetimes of the elongator trna are plotted in the middle panel. hydrolysis appears to be necessary for efficient and stable elongator trna arrival post 7S complex formation. In the right panel, the lag times of stable (>1 s) elongator trna arrival in a 1 s window post 5S subunit joining were fitted to a single exponential function. The fitted lifetimes are presented as a bar plot. Conditions with N.D. on top could not be fitted due to lack of measurable rise in stable trna arrival post 7S joining. The arrival time in GDPNP without factors is likely that of magnesium-driven trna binding as above. Adding IF1 and IF3 in addition to IF2 increased the fitted trna arrival time by more than 2-fold, which may reflect extra time required for the other factors to dissociate from the 7S ribosome prior to elongator trna arrival.when present, IF1 and IF3 are at 1 μm. The number of molecules analyzed in each column for both panels is, from left to right, n = 134, n = 255, n = 166, n = 32, and n = 177, error bars, when present, are s.d. 7

8 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 6. Positions of dyes on labeled biomolecules The red spheres indicate labeling site positions. a. A double IF2 (1ZO1 in PDB from E. coli) mutant C599A and K791C was labeled with Cy5-maleimide at K791C. b. trnafmet (3CW6 in PDB from E. coli) was labeled at 4-thiouridine at position 8 with Cy3-maleimide. 8 W W W. N A T U R E. C O M / N A T U R E c. trnaphe (2ZXU in PDB from E. coli) was labeled at 3-(3-amino-3-carboxypropyl)- 13

9 RESEARCH b. trna fmet (3CW6 in PDB from E. coli) was labeled at 4-thiouridine at position 8 with Cy3-maleimide. c. trna Phe (2ZXU in PDB from E. coli) was labeled at 3-(3-amino-3-carboxypropyl)- uridine at position 47 with Cy2-NHS ester. d & e. 3S (d, 3R8N in PDB from E. coli) and 5S (e, 3R8S in PDB from E. coli) subunits are shown from the side of their inter-subunit interface. Small and large subunits bear metastable hairpin insertions on the terminuses of helix 44 and helix 11 respectively, with both extensions located away from active sites of the ribosome. Fluorescently labeled oligonucleotides were annealed to the hairpins to label ribosomal subunits. 9

10 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Text 1. Control experiments to establish the functionality of dye-labeled ligands We first demonstrated the feasibility of using this ZMW-based system and labeled reagents (Methods 1) to follow initiation. Delivering 2 nm fmet-(cy3)trnafmet, Cy5- IF2, and 5S, we observed stable binding of initiator trna and IF2 to the 3S subunit followed by 5S binding to the 3S PIC. In agreement with previous biochemical studies, stable trna binding was abrogated by 2 μm of the P-site blocking antibiotic edeine 19,2 (Supplemtary Figure 2a). Stability of IF2 binding was dependent of the identity of guanine nucleotide in agreement with previous studies 21,22. (Supplementary Figure 2b and c). These controls showed our ability to track translation initiation in real time. 2. The role of IF2 in subunit joining To elucidate a role of IF2 in 7S formation we delivered 2 nm of Cy5-5S to immobilized Cy3-3S at different magnesium concentataions (2.5~1 mm) both with and without 1 μm IF2 in either or GDPNP. Where present, IF1 and IF3 are at 1μM. The wait time until the appearance of the 5S signal and its lifetime was analyzed to determine the efficiency of subunit joining under the different conditions. Without IF2, subunit joining was slow and short-lived. At 5 mm magnesium concentration, 5S subunit k on was.3x1 6 M -1 s -1 ( = 29s) and 5S lifetime was 6 s (Supplementary Figure 4). While increasing the magnesium concentration up to 1 mm accelerated 5S subunit on rate (k on =.5x1 6 M -1 s -1, = 2s), 5S subunit lifetime remained low (4.2 s). They were still significantly worse than 7S complexes formed with 1

11 RESEARCH IF2 at 5 mm magnesium concentration. Lowering magnesium concentration to 2.5 mm resulted in a 5S subunit lifetime of 4.2 s and an even lower on rate of (k on =.2x1 6 M -1 s -1, = 47 s). This highlights the importance of IF2, which sits on the 3S subunit interface, in guiding rapid and stable 7S complex formation. 3. The dynamics of trna arrival to 7S complexes formed under different conditions The final key event that marks the end of initiation is the arrival of the first elongator trna encoded by the second codon on the mrna. To track formation of the 7S initiation complex and the arrival of the first elongator trna, we delivered 2 nm Cy5-5S and 2 nm Phe-(Cy2)tRNA Phe as a ternary complex with EF-Tu and to the 3S PIC. The wait times until the 5S subunit and the trna signals appear, the timing of the trna signal relative to the 5S signal, and the lifetime of the trna signal were analyzed to determine the efficiency of initiation under different conditions (Supplementary Figure 5a). When 7S where formed in the absence of initiation factors in, only 13% of the assembled 7S particles have a stable trna arrival ( > 5s) within a 1s window after subunit joining (Supplementary Figure 5b and c). With IF2(), the efficiency sharply improved to 49% of the molecules having a stable trna arrival event within the same time window. Loading IF2 with GDPNP reduced the percentage to 14%, which is similar to that of alone without factors. Adding 1 μm IF1 and IF3 improves successful trna arrival to 58%. Overall, these results and prior studies demonstrate that formation of elongation competent ribosomes requires hydrolysis by IF2 13,23, and IF1 and IF3 may help guide 11

12 RESEARCH SUPPLEMENTARY INFORMATION effective transition into elongation. To understand the dynamics of elongator trna binding to the 7S ribosome formed in the presence and in the absence of initiation factors, we determined the stability of elongator trna Phe binding to 7S initiation complexes (Supplementary Figure 5c). Without initiation factors, in Mg 2+ -driven subunit joining, predominantly short lifetime ( = 3.4 s) events were observed. Adding 2μM IF2() increased the trna Phe lifetime to a photobleaching-limited = 1.4s. However, in the presence of IF2(GDPNP), trna lifetimes were significantly reduced to 1.2s. Adding 1µM IF1 and IF3 did not change the trna lifetimes appreciably both with and GDPNP but improved trna Phe acceptance efficiency in the presence of IF2() as mentioned above (Supplementary Figure 5c). 4. Elongator trna binding frequency before and after IF2 dissociation Detailed analysis of these four-color single-molecule data confirms that IF2 departure controls the transition to elongation. The frequency of elongator trna binding events within a 2 s window prior to and post IF2 departure were similar in the presence of either or GDPNP, both before and after IF2 departure. When only events >1 s are selected, we observed a significant drop in event frequency only for GDPNP. Accordingly, the majority of trna arrival events were short-lived sampling in GDPNP whereas most of the trna events in involved stable binding. IF2 departure facilitated stable elongator trna arrival. The average frequency of stable trna events with before IF2 departure was.1 events per molecule per second and increased to.16 post-if2 departure. 12

13 RESEARCH 19 Szer, W. & Kurylo-Borowska, Z. Effect of edeine on aminoacyl-trna binding to ribosomes and its relationship to ribosomal binding sites. Biochimica et biophysica acta 224, (197). 2 Peters, M. & Yarus, M. Transfer RNA selection at the ribosomal A and P sites. J Mol Biol 134, (1979). 21 Mitkevich, V. A. et al. Thermodynamic characterization of ppgpp binding to EF-G or IF2 and of initiator trna binding to free IF2 in the presence of GDP,, or ppgpp. J Mol Biol 42, , doi:1.116/j.jmb (21). 22 Grigoriadou, C., Marzi, S., Kirillov, S., Gualerzi, C. O. & Cooperman, B. S. A quantitative kinetic scheme for 7 S translation initiation complex formation. J Mol Biol 373, , doi:1.116/j.jmb (27). 23 Dubnoff, J. S., Lockwood, A. H. & Maitra, U. Studies on the role of guanosine triphosphate in polypeptide chain initiation in Escherichia coli. J Biol Chem 247, (1972). 13