seminal vesicle thymus kidney lung liver
|
|
|
- Jordan Manning
- 5 years ago
- Views:
Transcription
1 a 1 HEK293 1 B 3 3 T GFPSMAD TGFβ (T)/ BMP (B) IB: SMAD1/3TP IB: GFP b wild type mouse tissue kidney thymus seminal vesicle liver lung brain adipose tissue muscle pancreas heart uterus spleen testis IB: tubulin c brain bone skin breast colon cervix lung A172 U87 U2OS G361 BT474 MCF7 T47D HCT HT29 LoVo SW6 HeLa NCIH441 NCIH727 IB: SMAD2/3 IB: tubulin d IgG IP OTUB1 U2OS input TGFβ FLAG FLAGSMAD3 FLAGSMAD3 phosphomutant FLAGSMAD3 phosphomimetic IB: FLAGSMAD3 Supplementary Figure S1: OTUB1 is ubiquitously expressed. (a) HEK293 cells stably expressing GFPSMAD1 or GFPSMAD3 were treated with BMP ( ng/ml) or TGFβ ( pm) respectively for 1 hour prior to lysis. Extracts were resolved by SDS PAGE and immunoblotted with the indicated antibodies. (b) Indicated mouse tissues were homogenised in lysis buffer, and µg of protein lysate were resolved by SDS PAGE and immunoblotted with antibodies against OTUB1, GAPDH and tubulin (the latter ones used as loading controls). (c) Different cancer cell lines were lysed and extracts resolved by SDSPAGE and immunoblotted with the indicated antibodies. GAPDH and tubulin immunoblots were used as loading controls. (d) U2OS cells were transfected with vectors encoding wild type FLAGSMAD3, FLAGSMAD3 phosphomutant or FLAGSMAD3 phosphomimetic mutant and were treated with TGFβ ( pm; 1 h) prior to lysis. Extracts or IPs with preimmune IgG or OTUB1 antibody were resolved by SDSPAGE and immunoblotted with the indicated antibodies. 1
2 * relative CAGA luciferase activity (%) TGFβ sirna ifoxo4 iotub1 Supplementary Figure S2: Depletion of OTUB1 represses TGFβinduced transcriptional reporter activity. C2C12 cells stably expressing a SMAD3 dependent TGFβresponsive CAGA luciferase reporter construct were transfected with ifoxo4 or iotub1#3. Cells were treated with or without pm TGFβ for 6 hours prior to lysis and luciferase activity was measured. Data are represented as mean and error bars indicate standard deviation (n=3). Statistical significance of differences between experimental groups was assessed with Student s ttest. Differences with p<0.05 were annotated as *. 2
3 a in vitro K48ub 27 GSTOTUB1 WT ΔN D88A C91S H265A D/H D/C/H b in vitro K63ub 27 GSTOTUB1 WT ΔN D88A C91S H265A D/H D/C/H c IPFLAG input HEK293 TGFβ FLAGSMAD3 HAOTUB1 IB: HAOTUB1 IB: FLAGSMAD3 IB: HAOTUB1 IB: FLAGSMAD3 IB: GSTOTUB1 IB: GSTOTUB1 IB: SMAD3TP Supplementary Figure S3: Assessment of OTUB1 mutants in in vitro deubiquitylation assays. (a) Purified GSTOTUB1 or the indicated GSTOTUB1 mutants were incubated with K48linked 27 ubiquitin chains in DUB assay buffer for 1 hour at 30 C and proteins were resolved by SDSPAGE and immunoblotted with GST or ubiquitin antibodies. (b) As in b, except the DUB assay was performed with K63linked 27 ubiquitin chains. (c) HEK293 cells were cotransfected with vectors encoding Nterminal HAtagged OTUB1 and Nterminal FLAGtagged SMAD3. Prior to lysis cells were treated with pm TGFβ for 1 hour. FLAGIPs or extracts were resolved by SDSPAGE and immunoblotted with the indicated antibodies. 3
4 a b IPFLAG transiently transfected HEK293 Bortezomib, Lactacystin TGFβ FLAGSMAD3 HAOTUB1 HAOTUB1 ΔN HAOTUB1 K71R HAOTUB1 C91S HAOTUB1 H265A IB: HAOTUB1 IB: FLAGSMAD3 2 1 FlpIn HEK293 GFPOTUB tetracycline (h) Bortezomib ( µm, 3h) IB: HAOTUB1 IB: GFP IB: FLAGSMAD3 input 2 1 Supplementary Figure S4: OTUB1 inhibits ubiquitylation in cells. (a) HEK293 cells were cotransfected with vectors encoding Nterminal HAtagged OTUB1 or indicated HAOTUB1 mutants (ΔN, K71R, C91S, H265A) and Nterminal FLAGtagged SMAD3. Prior to lysis (in the presence of Iodoacetamide) cells were treated with or without pm TGFβ for 1 hour, µm Bortezomib and µm Lactacystin for 3 hours. FLAGIPs or extracts were resolved by SDSPAGE and immunoblotted (IB) with the indicated antibodies. (b) HEK293 FlpIn cells expressing GFPOTUB1 under a tetracycline inducible promoter were treated with tetracycline for 6 or 24 hours in the presence or absence of Bortezomib ( µm, 3h). Extracts were resolved by SDS PAGE and immunoblotted with the indicated antibodies. 4
5 a b c HEK293 IPFLAG M1 ub 27 K48 ub 27 K63 ub 27 HANEDD4L FLAGSMAD3 IB: K48ubiquitin IB: HANEDD4L IB: FLAGSMAD3 d HEK293 HaCaT WT Bortezomib HANEDD4L IB: SMAD2/3 IB: HANEDD4L ΔN CS * iotub1 Rescue 2 1 in vitro DUB added after SMAD3 ubiquitylation ubiquitylated SMAD3 GSTOTUB1 WT ΔN D88A C91S H265A D/H D/C/H K71R HaCaT ΔN WT CS iotub1 Rescue IB: FLAG IB: GSTOTUB1 IB: SMAD3 * = OTUB1 ΔN is not recognised by the OTUB1 antibody, but can be detected with antiflag Supplementary Figure S5: OTUB1 inhibits NEDD4L mediated SMAD3 degradation. (a) HEK293 cells were cotransfected with vectors encoding HA NEDD4L and FLAGSMAD3. Prior to lysis (in the presence of Iodoacetamide) cells were treated with pm TGFβ for 1 hour and µm Bortezomib for 3 hours. FLAG IPs and linear, K48 or K63linked ubiquitin (27 molecules) chains were resolved by SDSPAGE and immunoblotted (IB) with K48linkage specific and total ubiquitin antibodies. (b) HEK293 cells were transfected with HANEDD4L. Prior to lysis (in the presence of Iodoacetamide) cells were treated with pm TGFβ for 1 hour and with or without µm Bortezomib for 3 hours. Extracts were resolved by SDSPAGE and immunoblotted (IB) with the indicated antibodies. (c) SMAD3 was ubiquitylated in vitro in ubiquitylation assay buffer for 1 hour at 30 C with HisUBE1 (E1), UBE2D1 (E2), HisNEDD4L (E3) and FLAGubiquitin. An in vitro DUB assay of polyubiquitylated SMAD3 was performed with GSTOTUB1 and the indicated GST OTUB1 mutants in DUB assay buffer for 1 hour at 30 C and proteins were resolved by SDSPAGE and immunoblotted with indicated antibodies. (d) HaCaT cells were stably transfected with vectors encoding sirnaresistant silent mutations (rescue) of the indicated OTUB1 constructs. These cells were then transfected with control FoxO4 or OTUB1#1 sirna (300 pm/cm dish each) for 48 h. Extracts were resolved by SDSPAGE and immunoblotted with the indicated antibodies. 5
6 Marker GFP GFP OTUB1 2 1 OTUB1 * UBE2 Supplementary Figure S6: OTUB1 binds UBE2 enzymes. GFP and GFPOTUB1 immunoprecipitates from HEK293 cells stably expressing these proteins were lysed in the presence of DSP and GFPIPs were separated by SDSPAGE and interacting proteins identified by mass spectrometry (cf. Supplementary Table S2). 6
7 a HaCaT TGFβ B M B M B= Bortezomib, M= MG132 b 4 4 HaCaT Bortezomib time (h) after TGFβ removal 2 1 IB: SMAD3TP IB: SMAD2TP IB: SMAD3TP IB: SMAD2TP IB: SMAD4 IB: SMAD2/3 Supplementary Figure S7: Bortezomib stabilises tailphosphorylated SMAD2 and 3. (a) HaCaT cells were treated with TGFβ ( pm) and Bortezomib or MG132 ( µm) for 3 hours. Extracts were resolved with SDSPAGE and immunoblotted with the indicated antibodies. (b) HaCaT cells were treated with TGFβ ( pm) for 1 hour and the media was replaced with serum free media, supplemented with SB5124 (1 µm) in the presence or absence of Bortezomib ( µm). Cells were lysed at the indicated times after removal of TGFβ, extracts resolved with SDSPAGE and immunoblotted with the indicated antibodies. 7
8 Supplementary Figure S8: Original scans of the key western blots presented in the manuscript: Figure 1b IB: SMAD2/3 IB: SMAD3LP IB: SMAD3TP IB: SMAD4 IB: SMAD1TP IB: SMAD7 Figure 2d IB: SMAD4 IB: SMAD2TP 8
9 Figure 5c IB: FLAGSMAD2/3/4 Figure 7b IB: SMAD2TP (low) IB: SMAD2TP (high) IB: SMAD3TP IB: SMAD2/3 IB: SMAD4 9
10 Supplementary Table S1: Assessment of OTUB1 mutants in in vitro deubiquitylation assays. Outline of the ability of OTUB1 mutants to bind SMAD3, cleave K48linked ubiquitin or inhibit ubiquitylation of SMAD3. mutant binds SMAD3 cleaves K48ub chains in vitro inhibits SMAD3 ubiquitylation WT ΔN D88A C91S H265A D/H D/C/H K71R Supplementary Table S2: OTUB1 binds UBE2 enzymes. The table lists E2 enzymes that were identified as interactors of GFPOTUB1 but not GFP. UBE2D1 was used for the ubiquitylation assays. Gene Protein Name MW (Da) score peptide coverage UBE2N Ubiquitinconjugating enzyme E2 N % UBE2E1 Ubiquitinconjugating enzyme E2 E % UBE2E2 Ubiquitinconjugating enzyme E2 E % UBE2E3 Ubiquitinconjugating enzyme E2 E % UBE2D2 Ubiquitinconjugating enzyme E2 D % UBE2D3 Ubiquitinconjugating enzyme E2 D % UBE2V2 Ubiquitinconjugating enzyme E2 variant % UBE2V1 Ubiquitinconjugating enzyme E2 variant % Putative ubiquitinconjugating enzyme E2 UBE2NL Nlike % UBE2D1 Ubiquitinconjugating enzyme E2 D % UBE2D4 Ubiquitinconjugating enzyme E2 D % UBE2L3 Ubiquitinconjugating enzyme E2 L %
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
GFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
Supplementary methods Shoc2 In Vitro Ubiquitination Assay
Supplementary methods Shoc2 In Vitro Ubiquitination Assay 35 S-labelled Shoc2 was prepared using a TNT quick Coupled transcription/ translation System (Promega) as recommended by manufacturer. For the
Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
Supplementary Figure S1
Supplementary Figure S1 Luciferase ctivity (%) 5 4 3 2 1 HeLa E2 OHT Figure S1. SENP2 represses estradiol-dependent transcriptional activity in HeLa cells. HeLa cells were transiently transfected with
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/429/ra54/dc1 Supplementary Materials for Dephosphorylation of the adaptor LAT and phospholipase C by SHP-1 inhibits natural killer cell cytotoxicity Omri Matalon,
Flag-Rac Vector V12 V12 N17 C40. Vector C40 pakt (T308) Akt1. Myc-DN-PAK1 (N-SP)
a b FlagRac FlagRac V2 V2 N7 C4 V2 V2 N7 C4 p (T38) p (S99, S24) p Flag (Rac) NIH 3T3 COS c +Serum p (T38) MycDN (NSP) Mycp27 3 6 2 3 6 2 3 6 2 min p Myc ( or p27) Figure S (a) Effects of Rac mutants on
transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,
Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected
Supplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.
Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected
Supplemental Figure Legends:
Supplemental Figure Legends: Fig S1. GFP-ABRO1 localization. U2OS cells were infected with retrovirus expressing GFP- ABRO1. The cells were fixed with 3.6% formaldehyde and stained with antibodies against
Supplementary information
Supplementary information The E3 ligase RNF8 regulates KU80 removal and NHEJ repair Lin Feng 1, Junjie Chen 1 1 Department of Experimental Radiation Oncology, The University of Texas M. D. Anderson Cancer
supplementary information
DOI: 10.1038/ncb1816 A Gal4 Gal4 B Kinase domain C (1502) N (5111191) Interaction with SIAH1 C SIAH1 SIAH1 C (182) SIAH1 N (82282) RING domain Interaction with Input GST GSTSIAH1 1a a N C Input GST GSTSIAH1
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2271 Supplementary Figure a! WM266.4 mock WM266.4 #7 sirna WM266.4 #10 sirna SKMEL28 mock SKMEL28 #7 sirna SKMEL28 #10 sirna WM1361 mock WM1361 #7 sirna WM1361 #10 sirna 9 WM266. WM136
supplementary information
DOI: 10.1038/ncb2172 Figure S1 p53 regulates cellular NADPH and lipid levels via inhibition of G6PD. (a) U2OS cells stably expressing p53 shrna or a control shrna were transfected with control sirna or
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/404/ra120/dc1 Supplementary Materials for The subcellular localization and activity of cortactin is regulated by acetylation and interaction with Keap1 Akihiro
monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in
Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal
Supporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2743 Figure S1 stabilizes cellular protein level, post-transcriptionally. (a, b) and DDR1 were RNAi-depleted from HEK.293.-CBG cells. Western blots with indicated antibodies (a). RT-PCRs
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
Supplementary Fig.1 Luton
Supplementary Fig.1 Luton a 175 Brain Thymus Spleen Small Intestine Kidney Testis HeLa b 250 Lung Kidney MDCK c EFA6B si Control si Mismatch #637 #1564 #1770 83 62 47.5 175 IB: anti-efa6b #B1 130 66 Lysates
Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.
Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Construct name ISG12b2 (No tag) HA-ISG12b2 (N-HA) ISG12b2-HA (C-HA; FL-HA) 94-283-HA (FL-GFP) 93-GFP
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2579 Figure S1 Incorporation of heavy isotope-labeled amino acids and enrichment of di-glycine modified peptides. The incorporation of isotopelabeled amino acids in peptides was calculated
Sarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or
SUPPLEMENTAL EXPERIMENTAL PROCEDURES
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Luciferase Assays Cells were seeded on 24well plates and grown to 7% confluency. Cells were then transfected with ng of reporter constructs and 1 ng of the renilla
Supplementary Information
Supplementary Information Supplementary Figure 1. Elevated Smurf1 expression is associated with the progression of colorectal cancer. (a) The tumor microarray analysis with anti-smurf1 antibody. (b) Box
Supplementary figures
Relative intensity Relative intensity Relative intensity Supplementary figures a None Caffeine None Caffeine c None Caffeine 6 6 6 ISG 6 6 6 UBE1L 6 6 6 UBCH8 6 6 6 EFP 1 1 DOX (h) 1 1 CPT (h) 1 1 UV (h)
Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions.
Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions. 1 (a) Etoposide treatment gradually changes acetylation level and co-chaperone
supplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
Supplementary Figures
Supplementary Figures 11 1 1 Supplementary Figure 1. Clinical features of EBS cases with KLHL mutations. (a) Photo of Patient 1 s hands showing mild atrophic skin and unaffected finger nails. (b) The skin
Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the
Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.
Thanasoula et al. - Fig. S1
S HK1si G1 Thanasoula et al. - Fig. S1 G2/M HK2si 1 3 5 7 9 11 13 hours after double thymidine block release Figure S1. U2OS synchronous cell cycle progression. U2OS cells transfected with, POT1, HK1,
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3209 Supplementary Figure 1 IR induces the association of FH with chromatin. a, U2OS cells synchronized by thymidine double block (2 mm) underwent no release (G1 phase) or release for 2
Coleman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
Hossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
SUPPLEMENTARY INFORMATION
The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were
Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells.
Supplementary Fig. 1 Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells. (a) FRTL-5 cells were treated with 1 mm dibutyryl camp for 24 h, and the lysates
At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
Supplementary Information
Supplementary Information Supplementary Figures Supplementary Figure 1. MLK1-4 phosphorylate MEK in the presence of RAF inhibitors. (a) H157 cells were transiently transfected with Flag- or HA-tagged MLK1-4
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/428/ra5/1 Supplementary Materials for ameliorates liver steatosis by decreasing stearoyloa desaturase 1 (S1) abundance and altering hepatic lipid metabolism
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated
Supplementary Information for. Regulation of Rev1 by the Fanconi Anemia Core Complex
Supplementary Information for Regulation of Rev1 by the Fanconi Anemia Core Complex Hyungjin Kim, Kailin Yang, Donniphat Dejsuphong, Alan D. D Andrea* *Corresponding Author: Alan D. D Andrea, M.D. Alan_dandrea@dfci.harvard.edu
Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter
Supplement Supporting Materials and Methods Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter were independently generated using a two-step PCR method. The Smad4 binding site
HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95
Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:
SUPPLEMENTAL FIGURES AND TABLES
SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2
Supplementary Fig. 1
a FL (1-2266) NL (1-1190) CL (1191-2266) HA-ICE1: - HA-ICE1: - - - FLAG-ICE2: + + + + FLAG-ELL: + + + + + + IP: anti-ha FLAG-ICE2 HA-ICE1-FL HA-ICE1-NL HA-ICE1-CL FLAG-ICE2 b IP: anti-ha FL (1-2266) NL
Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2
Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,
Primers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al,
Supplementary METHODS Flow Cytometry (FACS) For FACS analysis, trypsinized cells were fixed in ethanol, rehydrated in PBS and treated with 40μg/ml propidium iodide and 10μ/ml RNase for 30 min at room temperature.
Supplementary Figure 1
Supplementary Figure 1 PTEN promotes virus-induced expression of IFNB1 and its downstream genes. (a) Quantitative RT-PCR analysis of IFNB1 mrna (left) and ELISA of IFN-β (right) in HEK 293 cells (2 10
SUPPLEMENTARY INFORMATION
DOI:.38/ncb327 a b Sequence coverage (%) 4 3 2 IP: -GFP isoform IP: GFP IP: -GFP IP: GFP Sequence coverage (%) 4 3 2 IP: -GFP IP: GFP 33 52 58 isoform 2 33 49 47 IP: Control IP: Peptide Sequence Start
Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression
Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,
Regulation of autophagic activity by ζ proteins associated with class III. phosphatidylinositol-3 kinase. Mercedes Pozuelo Rubio
ONLINE SUPPORTING INFORMATION Regulation of autophagic activity by 14-3-3ζ proteins associated with class III phosphatidylinositol-3 kinase Mercedes Pozuelo Rubio entro Andaluz de Biología Molecular y
Figure S1. USP-46 is expressed in several tissues including the nervous system
Supplemental Figure legends Figure S1. USP-46 is expressed in several tissues including the nervous system Transgenic animals expressing a transcriptional reporter (P::GFP) were imaged using epifluorescence
Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids.
Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids. The cells were harvested 72 h after transfection. FLAG-tagged deubiquitinases
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3562 In the format provided by the authors and unedited. Supplementary Figure 1 Glucose deficiency induced FH-ATF2 interaction. In b-m, immunoblotting or immunoprecipitation analyses were
Supplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1
Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded
Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17
Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,
ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3363 Supplementary Figure 1 Several WNTs bind to the extracellular domains of PKD1. (a) HEK293T cells were co-transfected with indicated plasmids. Flag-tagged proteins were immunoprecipiated
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
Nature Structural & Molecular Biology: doi: /nsmb.1583
Acetylation by GCN5 regulates CDC6 phosphorylation in the S-phase of the cell cycle Roberta Paolinelli 1,2, Ramiro Mendoza-Maldonado 2, Anna Cereseto 1 and Mauro Giacca 2 1 Molecular Biology Laboratory,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11070 Supplementary Figure 1 Purification of FLAG-tagged proteins. a, Purification of FLAG-RNF12 by FLAG-affinity from nuclear extracts of wild-type (WT) and two FLAG- RNF12 transgenic
hours after food deprivation hours after food deprivation
Figure S.6 protein (fasted / control).2.8.4 p47 p97 Rpt Ufd 3 24 48 hours after food deprivation mrn (fasted / control) C mrn (denervated / control) 2.5 2.5.5 3.5 3 2.5 2.5.5 p97 ** Npl4 Ufd p47 2 3 4
Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after
Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for
Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3
ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated
Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates
Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates vascular calcification (VC). (a) Von Kossa staining shows that TSA potentiated the Pi-induced VC. Scale bar, 100
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
Supplementary information. Supplementary Figures
Supplementary information Supplementary Figures Supplementary Figure 1. A. i. HA-JMY expressing U2OS cells were treated with SAHA (6h). DAPI was used to visualise nuclei. ii. U2OS cells stably expressing
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified
Pei et al. Supplementary Figure S1
Pei et al. Supplementary Figure S1 C H-CUL9: + + + + + Myc-ROC1: - - + + + U2OS/pcDN3 U2OS/H-CUL9 U2OS/ + H-CUL9 IP: -H -myc input -H -myc 1 2 3 4 5 H-CUL9 Myc-ROC1 -H -H -H -H H-CUL9: wt RR myc-roc1:
Post-translational modification
Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample
VCP adaptor interactions are exceptionally dynamic and subject to differential modulation by a VCP inhibitor
VCP adaptor interactions are exceptionally dynamic and subject to differential modulation by a VCP inhibitor Liang Xue 1, Emily E. Blythe 1, Elyse C. Freiberger 2, Jennifer Mamrosh 1, Alexander S. Hebert
MCF10A cells were trypsinized and attached onto fibronectin-coated petri dishes
Supplemental Information Supplemental figure legends Figure S. Supplemental figure for Fig... Different methods of cell detachment similarly induce YP phosphorylation. MCF0 cells were trypsinized and attached
SUPPLEMENTARY INFORMATION
Figure S1 The effect of T198A mutation on p27 stability. a, Hoechst 33342 staining for nuclei (see Fig 1d). Scale bar, 100 μm. b, Densitometric analysis of wild type and mutant p27 protein levels represented
PHF20 is an effector protein of p53 double lysine methylation
SUPPLEMENTARY INFORMATION PHF20 is an effector protein of p53 double lysine methylation that stabilizes and activates p53 Gaofeng Cui 1, Sungman Park 2, Aimee I Badeaux 3, Donghwa Kim 2, Joseph Lee 1,
SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal
Supplementary material for: Materials and Methods:
Supplementary material for: Iron-responsive degradation of iron regulatory protein 1 does not require the Fe-S cluster: S.L. Clarke, et al. Materials and Methods: Fe-S Cluster Reconstitution: Cells treated
Supplementary Figure Legends
Supplementary Figure Legends Figure S1 gene targeting strategy for disruption of chicken gene, related to Figure 1 (f)-(i). (a) The locus and the targeting constructs showing HpaI restriction sites. The
Rer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein 22 mutant that causes type 1A Charcot-Marie-Tooth disease
Rer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein mutant that causes type 1A Charcot-Marie-Tooth disease Taichi Hara, Yukiko Hashimoto, Tomoko Akuzawa, Rika Hirai,
This is the author's accepted version of the manuscript.
This is the author's accepted version of the manuscript. The definitive version is published in Nature Communications Online Edition: 2015/4/16 (Japan time), doi:10.1038/ncomms7780. The final version published
Xu et al., Supplementary Figures 1-7
Xu et al., Supplementary Figures 1-7 Supplementary Figure 1. PIPKI is required for ciliogenesis. (a) PIPKI localizes at the basal body of primary cilium. RPE-1 cells treated with two sirnas targeting to
Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity
Immunity, Volume 39 Supplemental Information Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity Jorg van Loosdregt, Veerle Fleskens, Juan
b alternative classical none
Supplementary Figure. 1: Related to Figure.1 a d e b alternative classical none NIK P-IkBa Total IkBa Tubulin P52 (Lighter) P52 (Darker) RelB (Lighter) RelB (Darker) HDAC1 Control-Sh RelB-Sh NF-kB2-Sh
Supplementary
Supplementary information Supplementary Material and Methods Plasmid construction The transposable element vectors for inducible expression of RFP-FUS wt and EGFP-FUS R521C and EGFP-FUS P525L were derived
Supplemental Figure 1
Supplemental Fig. 1. Kinetics of,,, AKT and ERK activation in BMMCs following SCF stimulation. Starved BMMCs were stimulated with 250ng/mL of SCF for the indicated time. Soluble Cell Lysates (SCLs) were
Supporting Information
Supporting Information Üstün and Börnke, 2015 Figure S1: XopJ does not display acetyltransferase activity. Autoacetylation activity in vitro. Acetylation reactions using MBP, MBP-XopJ, GST and GST-HopZ1a
Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated
Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)
Product Data Sheet - TRUEMAB
888.267.4436 techsupport@origene.com www.origene.com Name:VAPA mouse monoclonal antibody, clone OTI10E10 (formerly 10E10) Product Data Sheet - TRUEMAB Catalog: TA809100 Components: VAPA mouse monoclonal
TRIM31 is recruited to mitochondria after infection with SeV.
Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/182/ra46/dc1 Supplementary Materials for The Deacetylase Promotes Membrane Localization and Activation of and PDK1 During Tumorigenesis and Cardiac Hypertrophy