Il differenziamento cellulare dipende da meccanismi di regolazione

Size: px
Start display at page:

Download "Il differenziamento cellulare dipende da meccanismi di regolazione"

Transcription

1 Il differenziamento cellulare dipende da meccanismi di regolazione dell espressione genica

2

3

4

5 Trascrizione sintesi di tutti gli RNA cellulari

6 RNA Ribonucleotidi monofosfato uniti a formare una catena polinucleotidica

7 Formazione del legame fosfodiesterico

8 I precursori della sintesi sono i ribonucleotidi trifosfato. L energia che occorre per la formazione del legame fosfodiesterico è data dall eliminazione del pirofosfato per idrolisi del legame.

9 La direzione di sintesi è 5-3

10 La sequenza nucleotidica dell RNA è dettata dalla sequenza nucleotidica del DNA

11 L enzima che catalizza l unione dei ribonucleotidi è l RNA polimerasi

12

13 RNA polimerasi sintetizza RNA in direzione 5 3 E in grado di iniziare la sintesi. Non necessita di un innesco Utilizza ribonucleosidi 5 -trifosfato (ATP, GTP, UTP e CTP) e richiede Mg++ Il 3 OH agisce da nucleofilo sul gruppo fosfato in 5 del ribonucleoside trifosfato entrante e si ha liberazione di PPi (NMP)n + NTP = (NMP)n+1+ PPi PPi2Pi Ogni nucleotide è selezionato in base alle regole della complementarietà A:U e G:C

14 closed promoter complex Transcription RNA polymerase open promoter complex initiation elongation termination RNA product

15 Legame al promotore della RNA polimerasi Apertura della doppia elica Inizio della sintesi Allungamento Terminazione

16 Direzione della sintesi Filamento senso Filamento antisenso

17 5' G C A G T A C A T G T C 3' coding strand 3' C G T C A T G T A C A G 5' template strand transcription 5' G C A G U A C A U G U C 3' RNA

18 5..AGAAGATG ATGTCGGGCCAAACGCTCACGGATCGGATCGCCGCCGCTCAGTACAGCGTTACAGGCTCTGCTGT AGCAAGAGCGGTCTGCAAAGCCACTACTCATGAAGTAATGGGCCCCAAGAAAAAGCACCTGGACTATTTGATCCAGGC TACCAACGAGACCAATGTTAATATTCCTCAGATGGCCGACACTCTCTTTGAGCGGGCAACAAACAGTAGCTGGGTGGTT GTGTTTAAGGCTTTAGTGACAACACATCATCTCATGGTGCATGGAAATGAGAGATTTATTCAATATTTGGCTTCTAGAAA TACACTATTCAATCTCAGCAATTTTTTGGACAAAAGTGGATCCCATGGTTATGATATGTCTACCTTCATAAGGCGCTATA GTAGATATTTGAATGAAAAGGCTTTTTCTTACAGACAGATGGCCTTTGATTTTGCCAGGGTGAAGAAAGGGGCCGATGG TGTAATGAGGACAATGGCTCCCGAAAAGCTGCTAAAGAGTATGCCAATACTACAGGGACAAATTGATGCACTGCTTGAA TTTGATGTGCATCCAAATGAACTAACAAATGGTGTCATAAATGCAGCATTTATGCTTCTTTTCAAAGATCTTATCAAACTT TTTGCTTGCTACAATGATGGTGTTATTAACTTACTCGAAAAGTTTTTTGAAATGAAGAAAGGACAATGTAAAGATGCTCTA GAAATTTACAAACGATTTCTAACTAGAATGACACGAGTGTCTGAATTTCTCAAGGTTGCAGAGCAAGTTGGTATTGATAA AGGTGACATTCCTGACCTCACACAGGCTCCCAGCAGTCTTATGGAGACGCTTGAACAGCATCTAAATACATTAGAAGGA AAGAAACCTGGAAACAATGAAGGATCTGGTGCTCCCTCTCCATTAAGTAAGTCTTCTCCAGCCACAACTGTTACGTCTC CTAATTCTACACCAGCTAAAACTATTGACACATCCCCACCGGTTGATTTATTTGCAACTGCATCTGCGGCTGTCCCAGTC AGCACTTCTAAACCATCTAGTGATCTCCTGGACCTCCAGCCAGACTTTTCCTCTGGAGGGGCAGCAGCAGCCGCAGCA CCAGCACCACCACCACCTGCTGGAGGAGCCACTGCATGGGGAGACCTTTTGGGAGAGGATTCTTTGGCTGCACTTTCC TCTGTTCCCTCTGAAGCACAGATTTCAGATCCATTTGCACCAGAACCTACCCCTCCTACTACAACTGCTGAAATTGCAAC CACTACTGCTGCCACCGCCGCTGCCACCACCACTACCATTCATCTCTTGCCAGCTTAGTAGGCAATCTTGGAATTTCTG GTACCACAACAAAAAAGGGAGATCTTCAGTGGAATGCTGGAGAGAAAAAGTTGACTGGTGGAGCCAACTGGCAGCCTA AAGTAGCTCCAGCAACCTGGTCAGCAGGCGTTCCACCAAGTGCACCTTTGCAAGGAGCTGTACCTCCAACCAGTTCAG TTCCTCCTGTTGCCGGGGCCCCATCGGTTGGACAACCTGGAGCAGGATTTGGAATGCCTCCTGCTGGGACAGGCATG CCCATGATGCCTCAGCAGCCGGTCATGTTTGCACAGCCCATGATGAGGCCCCCCTTTGGAGCTGCCGCTGTACCTGGC ACGCAGCTTTCTCCAAGCCCTACACCTGCCAGTCAGAGTCCCAAGAAACCTCCAGCAAAGGACCCATTAGCGGATCTTA ACATCAAGGATTTCTTGTAAACAATTTAAGCTGCAATATTTGTGACTGAATAGGAAAATAAATGAGTTTGGAGACTTCAAA TAAGATTGATGCTGAGTTTCAAAGGGAGCCACCAGTACCAAACCCAATACTTACTCATAACTTCTCTTCCAAAATGTGTA ACACAGCCGTGAAAGTGAACATTAGGAATATGTACTACCTTAGCTGTTATCCCTACTCTTGAAATTGTAGTGTATTTGGA TTATTTGTGTATTGTACGATGTAAACAATGAATGGATGTTACTGATGCCGTTAGTGCTTTTTTGGACTTCACCTGAGGAC AGATGATGCAGCTGTTGTGTGGCGAGCTATTTGGAAAGACGTCTGTGTTTTTGAAGGTTTCAATGTACATATAACTTTTG AACAAACCCCAAACTCTTCCCATAAATTATCTTTTCTTCTGTATCTCTGTTACAAGCGTAGTGTGATAATACCAGATAATA AGGAAAACACTCATAAATATACAAAACTTTTTCAGTGTGGAGTACATTTTTCCAATCACAGGAACTTCAACTGTTGTGAGA AATGTTTATTTTTGTGGCACTGTATATGTTAA..3

19

20 Holoenzyme The holoenzyme of RNA-pol in E.coli consists of 5 different subunits: α 2 β β σ. holoenzyme core β σ β α α

21 RNA-pol of E. Coli subunit MW function α Determine the DNA to be transcribed β Catalyze polymerization β β Bind & open DNA template σ Recognize the promoter for synthesis initiation

22 Prokaryotic promoter 5' 3' region T T G A C A A A C T G T -10 region T A T A A T A T A T T A (Pribnow box) Consensus sequence start 3' 5'

23

24

25

26 c. Termination The RNA-pol stops moving on the DNA template. The RNA transcript falls off from the transcription complex. The termination occurs in either ρ - dependent or ρ -independent manner.

27 ρ-independent termination The termination signal is a stretch of nucleotides on the RNA transcript, consisting of many GC followed by a series of U. The sequence specificity of this nascent RNA transcript will form particular stem-loop structures to terminate the transcription.

28 rpll protein DNA 5 TTGCAGCCTGACAAATCAGGCTGATGGCTGGTGACTTTTTAGGCACCAGCCTTTTT TTGCAGCCTGACAAATCAGGCTGATGGCTGGTGACTTTTTAGTCACCAGCCTTTTT... 3 RNA UUUU... UUUU...

29

30 The human RNA polymerases Polymerase Location Product RNA polymerase I nucleolus 18S, 28S, 5.8S rrna RNA polymerase II nucleoplasm hnrna/mrna, U1, U2, U4, U5 snrna RNA polymerase III nucleoplasm mitochondrial RNA polymerase trna, 5S RNA, U6 snrna, 7SL RNA mitochondrion all mitochondrial RNA

31

32 b). Gene structure promoter region exons (filled and unfilled boxed regions) +1 introns (between exons) transcribed region mrna structure 5 3 translated region

33

34 Sequence elements within a typical eukaryotic gene 1 1 based on the thymidine kinase gene octamer transcription element promoter +1 ATTTGCAT GC CAAT GC TATA TATA box (TATAAAA) located approximately bp upstream of the +1 start site determines the exact start site (not in all promoters) binds the TATA binding protein (TBP) which is a subunit of TFIID GC box (CCGCCC) binds Sp1 (Specificity factor 1) CAAT box (GGCCAATCT) binds CTF (CAAT box transcription factor) Octamer (ATTTGCAT) binds OTF (Octamer transcription factor)

35 TATA box

36 Proteins regulating eukaryotic mrna synthesis General transcription factors TFIID (a multisubunit protein) binds to the TATA box to begin the assembly of the transcription apparatus the TATA binding protein (TBP) directly binds the TATA box TBP associated factors (TAFs) bind to TBP TFIIA, TFIIB, TFIIE, TFIIF, TFIIH 1, TFIIJ assemble with TFIID RNA polymerase II binds the promoter region via the TFII s Transcription factors binding to other promoter elements and transcription elements interact with proteins at the promoter and further stabilize (or inhibit) formation of a functional preinitiation complex 1 TFIIH is also involved in phosphorylation of RNA polymerase II, DNA repair (Cockayne syndrome mutations), and cell cycle regulation

37 Nome Alias Chromosoma TAF1 250 Xq13.1 TAF1L 250like 9p21.1 TAF q24.12 TAF p15.1 TAF q13.33 TAF4B q11.2 TF2D TBP + TAF TAF q24-10q25.2 TAF6 80 7q22.1 TAF6L 11q12.3 TAF7 55 5q31 TAF7L 50 Xq22.1 TAF8 43 6p21.1 TAF9 32 5q11.2-5q13.1 TAF p15.3 TAF p21.31 TAF p35.3 TAF p13.3 TAF q11.1-q11.2

38 Binding of the general transcription factors E F TAFs B TFIID H A TBP J TFIID (a multisubunit protein) binds to the TATA box to begin the assembly of the transcription apparatus the TATA binding protein (TBP) directly binds the TATA box TBP associated factors (TAFs) bind to TBP TFIIA, TFIIB, TFIIE, TFIIF, TFIIH, TFIIJ assemble with TFIID

39 Binding of RNA polymerase II E F B TFIID H A TBP J RNA pol II RNA polymerase II (a multisubunit protein) binds to the promoter region by interacting with the TFII s TFs recruit histone acetylase to the promoter

40 TATA BOX BINDING PROTEIN TBP Saddle-like domain TATA BOX DNA BINDING

41 TAF5 stabilizes TAFs interaction, specially histonelike ones (TAF6, TAF9) TAF1: Acetyl transferase activity Interaction with TFIIF TAF6 TAF11 TAF4 TAF12 TAF9 TAF13 TAF3 TAF12 TAF8 TAF4 TAF10 TBP TAF7 TAF5 TAF5 TAF11 TAF8 TAF3 TATA BOX TAF13 TAF6 TAF9TAF10

42 DNA BENDING

43 TFIID

44 Pre-initiation complex (PIC) RNA pol II TF II A TBP TAF TATA TF II F TF II B TF II E TF II H DNA

45 Pre-initiation complex (PIC) TBP of TFII D binds TATA TFII A and TFII B bind TFII D TFII F-RNA-pol complex binds TFII B TFII F and TFII E open the dsdna (helicase and ATPase) TFII H: completion of PIC

46 Phosphorylation of RNA-pol TF II H is of protein kinase activity to phosphorylate CTD of RNA-pol. (CTD is the C-terminal domain of RNA-pol)

47 b. Elongation The elongation is similar to that of prokaryotes. The transcription and translation do not take place simultaneously since they are separated by nuclear membrane.

48 c. Termination The termination sequence is AATAAA followed by GT repeats. The termination is closely related to the post-transcriptional modification.

49

50 Structure of eukaryotic mrna 5 Cap 7mGppp 5 untranslated region initiation AUG translated region 3 untranslated region UGA termination polyadenylation signal AAUAAA (A) ~200 poly(a) tail all mrnas have a 5 cap and all mrnas (with the exception of the histone mrnas) contain a poly(a) tail the 5 cap and 3 poly(a) tail prevent mrna degradation loss of the cap and poly(a) tail results in mrna degradation 3

51 Steps in mrna processing (hnrna is the precursor of mrna) capping (occurs co-transcriptionally) cleavage and polyadenylation (forms the 3 end) splicing (occurs in the nucleus prior to transport) exon 1 intron 1 exon 2 cap Transcription of pre-mrna and capping at the 5 end Cleavage of the 3 end and polyadenylation cap cap poly(a) Splicing to remove intron sequences cap poly(a) Transport of mature mrna to the cytoplasm

52

53 The 5 - cap structure is found on hnrna too. The capping process occurs in nuclei. The cap structure of mrna will be recognized by the cap-binding protein required for translation. The capping occurs prior to the splicing.

54 b. Poly-A tailing at 3 - end There is no poly(dt) sequence on the DNA template. The tailing process dose not depend on the template. The tailing process occurs prior to the splicing. The tailing process takes place in the nuclei.

55

56 Polyadenylation cleavage of the primary transcript occurs approximately nucleotides 3 -ward of the AAUAAA consensus site polyadenylation catalyzed by poly(a) polymerase approximately 200 adenylate residues are added cleavage AAUAAA mgpppnmpnm mgpppnmpnm AAUAAA A A A polyadenylation A A A 3 poly(a) is associated with poly(a) binding protein (PBP) function of poly(a) tail is to stabilize mrna

57

58

59

60 Splicing Rimozione di un introne attraverso due reazioni sequenziali di trasferimento di fosfato, note come transesterificazioni. Queste uniscono due esoni rimuovendo l introne come un cappio

61

62

63

64

65 Chemistry of mrna splicing two cleavage-ligation reactions transesterification reactions - exchange of one phosphodiester bond for another - not catalyzed by traditional enzymes branch site adenosine forms 2, 5 phosphodiester bond with guanosine at 5 end of intron intron 1 Pre-mRNA 2 OH-A branch site adenosine exon 1 exon 2 5 G-p-G-U - A-G-p-G 3 First clevage-ligation (transesterification) reaction

66 ligation of exons releases lariat RNA (intron) intron 1 U-G-5 -p-2 -AA Splicing intermediate exon 1 exon 2 5 G-OH 3 A-G-p-G A - 3 Second clevage-ligation reaction intron 1 Lariat U-G-5 -p-2 -A Spliced mrna 3 G-A exon 1 exon 2 5 G-p-G 3

67 Recognition of splice sites invariant GU and AG dinucleotides at intron ends donor (upstream) and acceptor (downstream) splice sites are within conserved consensus sequences donor (5 ) splice site branch site acceptor (3 ) splice site G/GUAAGU... A... YYYYYNYAG/G U1 U2 small nuclear RNA (snrna) U1 recognizes the donor splice site sequence (base-pairing interaction) U2 snrna binds to the branch site (base-pairing interaction) Y= U or C for pyrimidine; N= any nucleotide

68 intron 1 Step 2: binding of U4, U5, U6 2 OH-A exon 1 exon 2 U5 5 G-p-G-U - A-G-p-G 3 U1 U2 U4 U6 intron 1 Step 3: U1 is released, then U4 is released 2 OH-A exon 1 exon 2 U5 U6 U2 5 G-p-G-U - A-G-p-G 3

69 Step 4: U6 binds the 5 splice site and the two splicing reactions occur, catalyzed by U2 and U6 snrnps intron 1 mrna 3 G-A U6 2 OH-A U2 U-G-5 -p-2 -A U5 5 G-p-G 3

70

71

72

73 Trans-splicing Nei protozoi e in un nematode

74

75

76 Differenti molecole di mrna dallo stesso gene Splicing alternativo Uso di promotori alternativi Uso di segnali di poliadenilazione alternativi

77

78

79

80 d. mrna editing Taking place at the transcription level One gene responsible for more than one proteins Significance: gene sequences, after post-transcriptional modification, can be multiple purpose differentiation.

81 Different pathway of apo B Human apo B gene hnrna ( base) CAA to UAA At 6666 liver apo B100 (500 kd) intestine apo B48 (240 kd)

82

83 Structure of prokaryotic messenger RNA 5 Shine-Dalgarno sequence PuPuPuPuPuPuPuPu 3 AAU termination translated region initiation AUG The Shine-Dalgarno (SD) sequence base-pairs with a pyrimidine-rich sequence in 16S rrna to facilitate the initiation of protein synthesis

84 Il gene dei procarioti è policistronico

85 Enhancers Nei geni degli eucarioti gli enhancers possono distare dalla regione codificante anche più di 50 Kb.

86 Regolazione dell espressione genica Organizzazione della cromatina Punto 1 Inizio della trascrizione

87 Meccanismi di Regolazione dell espressione genica Fase Nucleare Scelta del gene che deve essere espresso Maturazione dell RNA Trasferimento Nucleo Citoplasma Fase Citoplasmatica Sintesi delle catene polipeptidiche Modificazioni post-traduzionali Trasferimento delle proteine nelle sedi di competenza

RNA. Ribonucleotidi monofosfato uniti a. formare una catena polinucleotidica

RNA. Ribonucleotidi monofosfato uniti a. formare una catena polinucleotidica RNA Ribonucleotidi monofosfato uniti a formare una catena polinucleotidica Formazione del legame fosfodiesterico I precursori della sintesi sono i ribonucleotidi trifosfato. L energia che occorre per la

More information

Classes of eukaryotic cellular RNAs

Classes of eukaryotic cellular RNAs Classes of eukaryotic cellular RNAs ribosomal RNA (rrna) 18S (small subunit) 28S (large subunit) 5.8S (large subunit) 5S (large subunit) transfer RNA (trna) messenger RNA (mrna) heterogeneous nuclear RNA

More information

Il differenziamento cellulare dipende da meccanismi di regolazione dell espressione genica

Il differenziamento cellulare dipende da meccanismi di regolazione dell espressione genica Il differenziamento cellulare dipende da meccanismi di regolazione dell espressione genica RNA Ribonucleotidi monofosfato uniti a formare una catena polinucleotidica I precursori della sintesi sono

More information

Trascrizione sintesi di tutti gli RNA cellulari

Trascrizione sintesi di tutti gli RNA cellulari Trascrizione sintesi di tutti gli RNA cellulari RNA Ribonucleotidi monofosfato uniti a formare una catena polinucleotidica Formazione del legame fosfodiesterico I precursori della sintesi sono i ribonucleotidi

More information

Chapter 11. Transcription. The biochemistry and molecular biology department of CMU

Chapter 11. Transcription. The biochemistry and molecular biology department of CMU Chapter 11 Transcription The biochemistry and molecular biology department of CMU Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be

More information

Transcription & post transcriptional modification

Transcription & post transcriptional modification Transcription & post transcriptional modification Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA Similarity

More information

SIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat

SIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat SIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat TRANSCRIPTION: AN OVERVIEW Transcription: the synthesis of a single-stranded RNA from a doublestranded DNA template.

More information

TRANSCRIPTION AND PROCESSING OF RNA

TRANSCRIPTION AND PROCESSING OF RNA TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural

More information

30 Gene expression: Transcription

30 Gene expression: Transcription 30 Gene expression: Transcription Gene structure. o Exons coding region of DNA. o Introns non-coding region of DNA. o Introns are interspersed between exons of a single gene. o Promoter region helps enzymes

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Biochemistry Eukaryotic Transcription

Biochemistry Eukaryotic Transcription 1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 1. Understand and have an overview of eucaryotic transcriptional regulation. 2. Explain

More information

GENETICS - CLUTCH CH.10 TRANSCRIPTION.

GENETICS - CLUTCH CH.10 TRANSCRIPTION. !! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types

More information

DNA Transcription. Dr Aliwaini

DNA Transcription. Dr Aliwaini DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger

More information

Lecture 11. Initiation of RNA Pol II transcription. Transcription Initiation Complex

Lecture 11. Initiation of RNA Pol II transcription. Transcription Initiation Complex Lecture 11 *Eukaryotic Transcription Gene Organization RNA Processing 5 cap 3 polyadenylation splicing Translation Initiation of RNA Pol II transcription Consensus sequence of promoter TATA Transcription

More information

Computational Biology I LSM5191 (2003/4)

Computational Biology I LSM5191 (2003/4) Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 12 Transcription 2 3 4 5 Are You Getting It?? Which are general characteristics of transcription? (multiple answers) a) An entire DNA molecule is transcribed

More information

Chapter 3. DNA, RNA, and Protein Synthesis

Chapter 3. DNA, RNA, and Protein Synthesis Chapter 3. DNA, RNA, and Protein Synthesis 4. Transcription Gene Expression Regulatory region (promoter) 5 flanking region Upstream region Coding region 3 flanking region Downstream region Transcription

More information

Eukaryotic & Prokaryotic Transcription. RNA polymerases

Eukaryotic & Prokaryotic Transcription. RNA polymerases Eukaryotic & Prokaryotic Transcription RNA polymerases RNA Polymerases A. E. coli RNA polymerase 1. core enzyme = ββ'(α)2 has catalytic activity but cannot recognize start site of transcription ~500,000

More information

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian

More information

Gene Expression: Transcription, Translation, RNAs and the Genetic Code

Gene Expression: Transcription, Translation, RNAs and the Genetic Code Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a

More information

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double

More information

Eukaryotic Transcription

Eukaryotic Transcription Eukaryotic Transcription I. Differences between eukaryotic versus prokaryotic transcription. II. (core vs holoenzyme): RNA polymerase II - Promotor elements. - General Pol II transcription factors (GTF).

More information

The discovery of the role of RNA RNA structure, synthesis and function

The discovery of the role of RNA RNA structure, synthesis and function Central Dogma The discovery of the role of RNA RNA structure, synthesis and function! Fundamental observations in genetics!! Genes are located in nuclei (in eukaryotes)!! Polypeptides are synthesised in

More information

M1 - Biochemistry. Nucleic Acid Structure II/Transcription I

M1 - Biochemistry. Nucleic Acid Structure II/Transcription I M1 - Biochemistry Nucleic Acid Structure II/Transcription I PH Ratz, PhD (Resources: Lehninger et al., 5th ed., Chapters 8, 24 & 26) 1 Nucleic Acid Structure II/Transcription I Learning Objectives: 1.

More information

RNA : functional role

RNA : functional role RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying

More information

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)

More information

Transcription steps. Transcription steps. Eukaryote RNA processing

Transcription steps. Transcription steps. Eukaryote RNA processing Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates

More information

Mechanisms of Transcription. School of Life Science Shandong University

Mechanisms of Transcription. School of Life Science Shandong University Mechanisms of Transcription School of Life Science Shandong University Ch 12: Mechanisms of Transcription 1. RNA polymerase and the transcription cycle 2. The transcription cycle in bacteria 3. Transcription

More information

Chapter 3 Gene Function. Transcription Prokaroyotes Eukaryotes Transcript processing Proteins Translation Genetic nomenclature

Chapter 3 Gene Function. Transcription Prokaroyotes Eukaryotes Transcript processing Proteins Translation Genetic nomenclature Chapter 3 Gene Function Transcription Prokaroyotes Eukaryotes Transcript processing Proteins Translation Genetic nomenclature Transcription RNA composition ATP, GTP, UTP, CTP are substrates for RNA polymerase.

More information

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA. Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally

More information

Transcription. Manzur Ali PP, DBT,M.E.S College,Marampally

Transcription. Manzur Ali PP, DBT,M.E.S College,Marampally Transcription Manzur Ali PP, DBT,M.E.S College,Marampally manzursir@gmail.com RNA transcription is actively regulated Not all DNA is transcribed in a given cell (less than 50% even in prokaryotes) For

More information

Initiation and termination of transcription, Post transcription modification of the RNA. Mitesh Shrestha

Initiation and termination of transcription, Post transcription modification of the RNA. Mitesh Shrestha Initiation and termination of transcription, Post transcription modification of the RNA Mitesh Shrestha Transcription: overview In prokaryotes transcription and translation are coupled. Proteins are synthesized

More information

Transcription and Post Transcript Modification

Transcription and Post Transcript Modification Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.

More information

BEADLE & TATUM EXPERIMENT

BEADLE & TATUM EXPERIMENT FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Transcription. By : Lucia Dhiantika Witasari M.Biotech., Apt

Transcription. By : Lucia Dhiantika Witasari M.Biotech., Apt Transcription By : Lucia Dhiantika Witasari M.Biotech., Apt REGULATION OF GENE EXPRESSION 11/26/2010 2 RNA Messenger RNAs (mrnas) encode the amino acid sequence of one or more polypeptides specified by

More information

RNA metabolism. DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA.

RNA metabolism. DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA. RNA metabolism DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA http://www.youtube.com/watch?v=ovc8nxobxmq DNA dependent synthesis of RNA : production of an RNA molecule

More information

DNA Prokaryote Transcription Steps (updated February 2013)

DNA Prokaryote Transcription Steps (updated February 2013) URS AACTGT ATATTA - 35-10 transcription Pribnow Box discriminator +1 AGGAGGT TTA TCCTCCA ATT Gene C TGA TAG ACT ATC rho or GC hairpin loop transcription termination DNA Prokaryote Transcription Steps (updated

More information

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal. 1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine

More information

CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS

CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS A. Promoters and Polymerases (RNA pols): 1. General characteristics - Initiation of transcription requires a. Transcription factors

More information

Transcription & RNA Processing

Transcription & RNA Processing Chapter 10. Transcription & RNA Processing 1. Transfer of Genetic Information: the Central Dogma 2. The Process of Gene Expression 3. Transcription & RNA Processing in Eukaryotes 4. Interrupted Genes in

More information

Transcription is the first stage of gene expression

Transcription is the first stage of gene expression Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the

More information

Eukaryotic Gene Expression John O. Thomas

Eukaryotic Gene Expression John O. Thomas Eukaryotic Gene Expression John O. Thomas I) RNA polymerases A) There are four RNA polymerases in human cells. 1) RNA polymerase I, located in the nucleolar region of the nucleus, is responsible for the

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

Bis2A 12.2 Eukaryotic Transcription

Bis2A 12.2 Eukaryotic Transcription OpenStax-CNX module: m56061 1 Bis2A 12.2 Eukaryotic Transcription Mitch Singer Based on Eukaryotic Transcription by OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative

More information

Chapter 17. From Gene to Protein

Chapter 17. From Gene to Protein Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle

More information

Information Readout: Transcription and Post-transcriptional Processing Translation

Information Readout: Transcription and Post-transcriptional Processing Translation Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase

More information

FROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation

FROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria

More information

We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA

We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA 1 We can now identify three major pathways of information flow in the cell (in replication, information passes from one DNA molecule to other DNA molecules; in transcription, information passes from DNA

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,

More information

Biochemistry 302. Exam 2. March 10, Answer Key

Biochemistry 302. Exam 2. March 10, Answer Key 1 Biochemistry 302 Exam 2 March 10, 2004 Answer Key 2 Biochemistry 302, Spring 2004 Exam 2 (100 points) Name I. Short answer 1. Identify the 5 end, 3 end, amino acid acceptor nucleoside, and bases comprising

More information

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps

More information

Molecular Genetics Principles of Gene Expression: Transcription

Molecular Genetics Principles of Gene Expression: Transcription Paper No. : 16 Module : 12 Principles of gene expression: Transcription Development Team Principal Investigator: Prof. Neeta Sehgal Head, Department of Zoology, University of Delhi Paper Coordinator: Prof.

More information

Nucleotide Entry Port. Scaffold Subunits. Polymerase Activity β Sliding Clamp. Clamp Loader. Promoter Recognition

Nucleotide Entry Port. Scaffold Subunits. Polymerase Activity β Sliding Clamp. Clamp Loader. Promoter Recognition Nucleotide Entry ort α (2) Scaffold Subunits olymerase Activity Sliding Clamp σ Clamp Loader romoter Recognition -35-10 NNAAA AA T A TTTTNNAAAANNN TT T N N17 N6 α α α α α α α α α α α α α α +1 α α α α Subunit

More information

BIO 311C Spring Lecture 36 Wednesday 28 Apr.

BIO 311C Spring Lecture 36 Wednesday 28 Apr. BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through

More information

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

More information

Basi s c i Fea e tu t re r s s of f R NA N Sy S nth t esi s s i s

Basi s c i Fea e tu t re r s s of f R NA N Sy S nth t esi s s i s Transcription Dr.H.B.Mahesha, Yuvaraja s College, University of Mysore, Mysuru. It is the process of transcribing or making a copy of Genetic information stored in a DNA strand into a Complementary strand

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

RNA: Structure & Synthesis. Amr S. Moustafa, M.D.; Ph.D.

RNA: Structure & Synthesis. Amr S. Moustafa, M.D.; Ph.D. RNA: Structure & Synthesis By Amr S. Moustafa, M.D.; Ph.D. Objectives The differences between DNA and RNA The structure and functions of RNAs RNA synthesis (Transcription) Post-transcriptional events (modifications)

More information

Chapter 24: Promoters and Enhancers

Chapter 24: Promoters and Enhancers Chapter 24: Promoters and Enhancers A typical gene transcribed by RNA polymerase II has a promoter that usually extends upstream from the site where transcription is initiated the (#1) of transcription

More information

Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:

Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine

More information

Chapter 2. An Introduction to Genes and Genomes

Chapter 2. An Introduction to Genes and Genomes PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents

More information

Transcription. Dr. Mahesha H B Associate Professor and Head Department of Sericulture Yuvaraja scollege University of Mysore, Mysuru, India

Transcription. Dr. Mahesha H B Associate Professor and Head Department of Sericulture Yuvaraja scollege University of Mysore, Mysuru, India Transcription Dr. Mahesha H B Associate Professor and Head Department of Sericulture Yuvaraja scollege University of Mysore, Mysuru, India 3 September 2017 www.hbmahesh.weebly.com 1 Transcription It is

More information

Resources. This lecture Campbell and Farrell's Biochemistry, Chapter 11

Resources. This lecture Campbell and Farrell's Biochemistry, Chapter 11 Transcription Resources This lecture Campbell and Farrell's Biochemistry, Chapter 11 2 Definition of a gene The entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide

More information

DIFFERENT ASPECTS OF GENE REGULATION

DIFFERENT ASPECTS OF GENE REGULATION TARTU UNIVERSITY FACULTY OF BILOGY AND GEOGRAPHY DIFFERENT ASPECTS OF GENE REGULATION TARTU 2005 Sten Ilmjärv 2 TABLE OF CONTENT TABLE OF CONTENT...2 GLOSSARY...3 INTRODUCTION...4 1. THE GENE...5 2. GENE

More information

Differential Gene Expression

Differential Gene Expression Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:

More information

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions. Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen

More information

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks. DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program

More information

DNA Evolution of knowledge about gene. Contains information about RNAs and proteins. Polynucleotide chains; Double stranded molecule;

DNA Evolution of knowledge about gene. Contains information about RNAs and proteins. Polynucleotide chains; Double stranded molecule; Evolution of knowledge about gene G. Mendel Hereditary factors W.Johannsen, 1909 G.W.Beadle, E.L.Tatum, 1945 Ingram, 1957 Actual concepts The gene hereditary unit located in chromosomes Hypotheses One

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Gene function at the level of traits Gene function at the molecular level

Gene function at the level of traits Gene function at the molecular level Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines

More information

The 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange.

The 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange. RNA PROCESSING The 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange. Splicing can occur either before or after

More information

Transcription. DNA to RNA

Transcription. DNA to RNA Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy

More information

Chapters 31-32: Ribonucleic Acid (RNA)

Chapters 31-32: Ribonucleic Acid (RNA) Chapters 31-32: Ribonucleic Acid (RNA) Short segments from the transcription, processing and translation sections of each chapter Slide 1 RNA In comparison with DNA RNA utilizes uracil in place of thymine

More information

Chromatographic Separation of the three forms of RNA Polymerase II.

Chromatographic Separation of the three forms of RNA Polymerase II. Chromatographic Separation of the three forms of RNA Polymerase II. α-amanitin α-amanitin bound to Pol II Function of the three enzymes. Yeast Pol II. RNA Polymerase Subunit Structures 10-7 Subunit structure.

More information

Biological information flow

Biological information flow BCMB 3100 Chapters 36-38 Transcription & RNA Processing Biological information flow Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors

More information

Translation BIT 220 Chapter 13

Translation BIT 220 Chapter 13 Translation BIT 220 Chapter 13 Making protein from mrna Most genes encode for proteins -some make RNA as end product Proteins -Monomer Amino Acid 20 amino acids -peptides -polypeptides -Structure of Amino

More information

Biological information flow

Biological information flow BCMB 3100 Chapters 36-38 Transcription & RNA Processing Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors mrna processing Biological

More information

Molecular Biology (BIOL 4320) Exam #1 March 12, 2002

Molecular Biology (BIOL 4320) Exam #1 March 12, 2002 Molecular Biology (BIOL 4320) Exam #1 March 12, 2002 Name KEY SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number.

More information

Proofreading, post-replication modification of DNA. Mitesh Shrestha

Proofreading, post-replication modification of DNA. Mitesh Shrestha Proofreading, post-replication modification of DNA Mitesh Shrestha Proofreading During DNA replication (copying), most DNA polymerases can check their work with each base that they add. This process is

More information

5. Which of the following enzymes catalyze the attachment of an amino acid to trna in the formation of aminoacyl trna?

5. Which of the following enzymes catalyze the attachment of an amino acid to trna in the formation of aminoacyl trna? Sample Examination Questions for Exam 3 Material Biology 3300 / Dr. Jerald Hendrix Warning! These questions are posted solely to provide examples of past test questions. There is no guarantee that any

More information

RNA Metabolism Chap 26, part I

RNA Metabolism Chap 26, part I RNA Metabolism Chap 26, part I mrna (selective and regulated) trna rrna other (specialized) RNAs (eukaryotes!!!) processing transcriptome (Surprisingly, much of your genome is transcribed!) RNA is the

More information

The Flow of Genetic Information

The Flow of Genetic Information Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins

More information

RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA

RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA that it has a hydroxyl group at the 2 position of the

More information

Ch. 10 From DNA to Protein. AP Biology

Ch. 10 From DNA to Protein. AP Biology Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

DNA Replication and Repair

DNA Replication and Repair DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands

More information

A. Incorrect! This feature does help with it suitability as genetic material.

A. Incorrect! This feature does help with it suitability as genetic material. College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

SCBC203 Gene Expression. Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318

SCBC203 Gene Expression. Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318 SCBC203 Gene Expression Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318 Rutaiwan.toh@mahidol.ac.th 1 Gene Expression Gene expression is a process where by the genetic

More information

Biological information flow

Biological information flow BCMB 3100 Chapters 36-38 Transcription & RNA Processing Biological information flow Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors

More information

RNA synthesis/transcription I Biochemistry 302. February 6, 2004 Bob Kelm

RNA synthesis/transcription I Biochemistry 302. February 6, 2004 Bob Kelm RNA synthesis/transcription I Biochemistry 302 February 6, 2004 Bob Kelm Overview of RNA classes Messenger RNA (mrna) Encodes protein Relatively short half-life ( 3 min in E. coli, 30 min in eukaryotic

More information

Biological information flow

Biological information flow BCMB 3100 Chapters 36-38 Transcription & RNA Processing Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors mrna processing Biological

More information

Differential Gene Expression

Differential Gene Expression Developmental Biology Biology 4361 Differential Gene Expression October 13, 2005 core transcription initiation site 5 promoter 3 TATAT +1 upstream downstream Basal transcription factors (eukaryotes) TFIID

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

Exam 2 Bio200: Cellular Biology Winter 2014

Exam 2 Bio200: Cellular Biology Winter 2014 Exam 2 Bio200: Cellular Biology Winter 2014 Name: Multiple Choice Questions Circle the one best answer for each of the following questions. (2 points each) 1. Which type of DNA repair includes the formation

More information

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein

More information