RNA. Ribonucleotidi monofosfato uniti a. formare una catena polinucleotidica

Transcription

1

2

3 RNA Ribonucleotidi monofosfato uniti a formare una catena polinucleotidica

4 Formazione del legame fosfodiesterico

5 I precursori della sintesi sono i ribonucleotidi trifosfato. L energia che occorre per la formazione del legame fosfodiesterico è data dall eliminazione del pirofosfato per idrolisi del legame.

6 La direzione di sintesi è 5-3

7 La sequenza nucleotidica dell RNA è dettata dalla sequenza nucleotidica del DNA

8 L enzima che catalizza l unione dei ribonucleotidi è l RNA polimerasi

9 RNA polimerasi sintetizza RNA in direzione 5 3 E in grado di iniziare la sintesi. Non necessita di un innesco Utilizza ribonucleosidi 5 -trifosfato (ATP, GTP, UTP e CTP) e richiede Mg++ Il 3 OH agisce da nucleofilo sul gruppo fosfato in 5 del ribonucleoside trifosfato entrante e si ha liberazione di PPi (NMP)n + NTP = (NMP)n+1+ PPi Ppi 2Pi Ogni nucleotide è selezionato in base alle regole della complementarietà A:U e G:C

10 closed promoter complex Transcription RNA polymerase open promoter complex initiation elongation termination RNA product

11 Legame al promotore della RNA polimerasi Apertura della doppia elica Inizio della sintesi Allungamento Terminazione

12 Direzione della sintesi Filamento senso Filamento antisenso

13 5' G C A G T A C A T G T C 3' coding strand 3' C G T C A T G T A C A G 5' template strand transcription 5' G C A G U A C A U G U C 3' RNA

14 5..AGAAGATGTCGGGCCAAACGCTCACGGATCGGATCGCCGCCGCTCAGTACAGCGTTACAGGCTCTGCTGT AGCAAGAGCGGTCTGCAAAGCCACTACTCATGAAGTAATGGGCCCCAAGAAAAAGCACCTGGACTATTTGATCCAGGC TACCAACGAGACCAATGTTAATATTCCTCAGATGGCCGACACTCTCTTTGAGCGGGCAACAAACAGTAGCTGGGTGGTT GTGTTTAAGGCTTTAGTGACAACACATCATCTCATGGTGCATGGAAATGAGAGATTTATTCAATATTTGGCTTCTAGAAA TACACTATTCAATCTCAGCAATTTTTTGGACAAAAGTGGATCCCATGGTTATGATATGTCTACCTTCATAAGGCGCTATA GTAGATATTTGAATGAAAAGGCTTTTTCTTACAGACAGATGGCCTTTGATTTTGCCAGGGTGAAGAAAGGGGCCGATGG TGTAATGAGGACAATGGCTCCCGAAAAGCTGCTAAAGAGTATGCCAATACTACAGGGACAAATTGATGCACTGCTTGAA TTTGATGTGCATCCAAATGAACTAACAAATGGTGTCATAAATGCAGCATTTATGCTTCTTTTCAAAGATCTTATCAAACTT TTTGCTTGCTACAATGATGGTGTTATTAACTTACTCGAAAAGTTTTTTGAAATGAAGAAAGGACAATGTAAAGATGCTCTA GAAATTTACAAACGATTTCTAACTAGAATGACACGAGTGTCTGAATTTCTCAAGGTTGCAGAGCAAGTTGGTATTGATAA AGGTGACATTCCTGACCTCACACAGGCTCCCAGCAGTCTTATGGAGACGCTTGAACAGCATCTAAATACATTAGAAGGA AAGAAACCTGGAAACAATGAAGGATCTGGTGCTCCCTCTCCATTAAGTAAGTCTTCTCCAGCCACAACTGTTACGTCTC CTAATTCTACACCAGCTAAAACTATTGACACATCCCCACCGGTTGATTTATTTGCAACTGCATCTGCGGCTGTCCCAGTC AGCACTTCTAAACCATCTAGTGATCTCCTGGACCTCCAGCCAGACTTTTCCTCTGGAGGGGCAGCAGCAGCCGCAGCA CCAGCACCACCACCACCTGCTGGAGGAGCCACTGCATGGGGAGACCTTTTGGGAGAGGATTCTTTGGCTGCACTTTCC TCTGTTCCCTCTGAAGCACAGATTTCAGATCCATTTGCACCAGAACCTACCCCTCCTACTACAACTGCTGAAATTGCAAC CACTACTGCTGCCACCGCCGCTGCCACCACCACTACCATTCATCTCTTGCCAGCTTAGTAGGCAATCTTGGAATTTCTG GTACCACAACAAAAAAGGGAGATCTTCAGTGGAATGCTGGAGAGAAAAAGTTGACTGGTGGAGCCAACTGGCAGCCTA AAGTAGCTCCAGCAACCTGGTCAGCAGGCGTTCCACCAAGTGCACCTTTGCAAGGAGCTGTACCTCCAACCAGTTCAG TTCCTCCTGTTGCCGGGGCCCCATCGGTTGGACAACCTGGAGCAGGATTTGGAATGCCTCCTGCTGGGACAGGCATG CCCATGATGCCTCAGCAGCCGGTCATGTTTGCACAGCCCATGATGAGGCCCCCCTTTGGAGCTGCCGCTGTACCTGGC ACGCAGCTTTCTCCAAGCCCTACACCTGCCAGTCAGAGTCCCAAGAAACCTCCAGCAAAGGACCCATTAGCGGATCTTA ACATCAAGGATTTCTTGTAAACAATTTAAGCTGCAATATTTGTGACTGAATAGGAAAATAAATGAGTTTGGAGACTTCAAA TAAGATTGATGCTGAGTTTCAAAGGGAGCCACCAGTACCAAACCCAATACTTACTCATAACTTCTCTTCCAAAATGTGTA ACACAGCCGTGAAAGTGAACATTAGGAATATGTACTACCTTAGCTGTTATCCCTACTCTTGAAATTGTAGTGTATTTGGA TTATTTGTGTATTGTACGATGTAAACAATGAATGGATGTTACTGATGCCGTTAGTGCTTTTTTGGACTTCACCTGAGGAC AGATGATGCAGCTGTTGTGTGGCGAGCTATTTGGAAAGACGTCTGTGTTTTTGAAGGTTTCAATGTACATATAACTTTTG AACAAACCCCAAACTCTTCCCATAAATTATCTTTTCTTCTGTATCTCTGTTACAAGCGTAGTGTGATAATACCAGATAATA AGGAAAACACTCATAAATATACAAAACTTTTTCAGTGTGGAGTACATTTTTCCAATCACAGGAACTTCAACTGTTGTGAGA AATGTTTATTTTTGTGGCACTGTATATGTTAA..3

15

16 Holoenzyme The holoenzyme of RNA-pol in E.coli consists of 5 different subunits: 2. holoenzyme core

17

18

19

20 The human RNA polymerases Polymerase Location Product RNA polymerase I nucleolus 18S, 28S, 5.8S rrna RNA polymerase II nucleoplasm hnrna/mrna, U1, U2, U4, U5 snrna RNA polymerase III nucleoplasm trna, 5S RNA, U6 snrna, 7SL RNA mitochondrial RNA polymerase mitochondrion all mitochondrial RNA

21

22 b). Gene structure promoter region exons (filled and unfilled boxed regions) +1 introns (between exons) transcribed region mrna structure 5 3 translated region

23

24 TATA box (TATAAAA) located approximately bp upstream of the +1 start site determines the exact start site (not in all promoters) binds the TATA binding protein (TBP) which is a subunit of TFIID GC box (CCGCCC) binds Sp1 (Specificity factor 1) CAAT box (GGCCAATCT) binds CTF (CAAT box transcription factor) Octamer (ATTTGCAT) binds OTF (Octamer transcription factor) Sequence elements within a typical eukaryotic gene 1 1 based on the thymidine kinase gene octamer transcription element promoter +1 ATTTGCAT GC CAAT GC TATA

25 Proteins regulating eukaryotic mrna synthesis General transcription factors TFIID (a multisubunit protein) binds to the TATA box to begin the assembly of the transcription apparatus the TATA binding protein (TBP) directly binds the TATA box TBP associated factors (TAFs) bind to TBP TFIIA, TFIIB, TFIIE, TFIIF, TFIIH 1, TFIIJ assemble with TFIID RNA polymerase II binds the promoter region via the TFII s Transcription factors binding to other promoter elements and transcription elements interact with proteins at the promoter and further stabilize (or inhibit) formation of a functional preinitiation complex 1 TFIIH is also involved in phosphorylation of RNA polymerase II, DNA repair (Cockayne syndrome mutations), and cell cycle regulation

26 Binding of the general transcription factors E F TAFs B TFIID H A TBP J TFIID (a multisubunit protein) binds to the TATA box to begin the assembly of the transcription apparatus the TATA binding protein (TBP) directly binds the TATA box TBP associated factors (TAFs) bind to TBP TFIIA, TFIIB, TFIIE, TFIIF, TFIIH, TFIIJ assemble with TFIID

27 Binding of RNA polymerase II E F B TFIID H A TBP J RNA pol II RNA polymerase II (a multisubunit protein) binds to the promoter region by interacting with the TFII s TFs recruit histone acetylase to the promoter

28 TATA BOX BINDING PROTEIN TBP Saddle-like domain TATA BOX DNA BINDING

29 TAF5 stabilizes TAFs interaction, specially histonelike ones (TAF6, TAF9) TAF1: Acetyl transferase activity Interaction with TFIIF TAF6 TAF11 TAF4 TAF12 TAF9 TAF13 TAF3 TAF12 TAF8 TAF4 TAF10 TBP TAF7 TAF5 TAF5 TAF11 TAF8 TAF3 TATA BOX TAF13 TAF6 TAF9 TAF10

30 DNA BENDING

31 TFIID

32 Pre-initiation complex (PIC) RNA pol II TF II A TBP TAF TATA TF II F TF II B TF II E TF II H DNA

33 Pre-initiation complex (PIC) TBP of TFII D binds TATA TFII A and TFII B bind TFII D TFII F-RNA-pol complex binds TFII B TFII F and TFII E open the dsdna (helicase and ATPase) TFII H: completion of PIC

34 c. Termination The termination sequence is AATAAA followed by GT repeats. The termination is closely related to the post-transcriptional modification.

35

36 Structure of eukaryotic mrna 5 Cap 7mGppp 5 untranslated region initiation AUG translated region 3 untranslated region UGA termination polyadenylation signal AAUAAA (A) ~200 poly(a) tail all mrnas have a 5 cap and all mrnas (with the exception of the histone mrnas) contain a poly(a) tail the 5 cap and 3 poly(a) tail prevent mrna degradation loss of the cap and poly(a) tail results in mrna degradation 3

37 Steps in mrna processing (hnrna is the precursor of mrna) capping (occurs co-transcriptionally) cleavage and polyadenylation (forms the 3 end) splicing (occurs in the nucleus prior to transport) exon 1 intron 1 exon 2 cap Transcription of pre-mrna and capping at the 5 end Cleavage of the 3 end and polyadenylation cap cap poly(a) Splicing to remove intron sequences cap poly(a) Transport of mature mrna to the cytoplasm

38

39 The 5 - cap structure is found on hnrna too. The capping process occurs in nuclei. The cap structure of mrna will be recognized by the cap-binding protein required for translation. The capping occurs prior to the splicing.

40 b. Poly-A tailing at 3 - end There is no poly(dt) sequence on the DNA template. The tailing process dose not depend on the template. The tailing process occurs prior to the splicing. The tailing process takes place in the nuclei.

41 Polyadenylation cleavage of the primary transcript occurs approximately nucleotides 3 -ward of the AAUAAA consensus site polyadenylation catalyzed by poly(a) polymerase approximately 200 adenylate residues are added cleavage AAUAAA mgpppnmpnm mgpppnmpnm AAUAAA A A A polyadenylation A A A 3 poly(a) is associated with poly(a) binding protein (PBP) function of poly(a) tail is to stabilize mrna

42

43

44

45 Splicing Rimozione di un introne attraverso due reazioni sequenziali di trasferimento di fosfato, note come transesterificazioni. Queste uniscono due esoni rimuovendo l introne come un cappio

46

47

48 Recognition of splice sites invariant GU and AG dinucleotides at intron ends donor (upstream) and acceptor (downstream) splice sites are within conserved consensus sequences donor (5 ) splice site branch site acceptor (3 ) splice site G/GUAAGU... A... YYYYYNYAG/G U1 U2 small nuclear RNA (snrna) U1 recognizes the donor splice site sequence (base-pairing interaction) U2 snrna binds to the branch site (base-pairing interaction) Y= U or C for pyrimidine; N= any nucleotide

49 intron 1 Step 2: binding of U4, U5, U6 2 OH-A exon 1 exon 2 U5 5 G-p-G-U - A-G-p-G 3 U1 U2 U4 U6 intron 1 Step 3: U1 is released, then U4 is released 2 OH-A exon 1 exon 2 U5 U6 U2 5 G-p-G-U - A-G-p-G 3

50 Step 4: U6 binds the 5 splice site and the two splicing reactions occur, catalyzed by U2 and U6 snrnps intron 1 mrna 3 G-A U6 2 OH-A U-G-5 -p-2 -A U5 U2 5 G-p-G 3

51

52

53 Differenti molecole di mrna dallo stesso gene Splicing alternativo Uso di promotori alternativi Uso di segnali di poliadenilazione alternativi

54

55

56 Structure of prokaryotic messenger RNA 5 Shine-Dalgarno sequence PuPuPuPuPuPuPuPu 3 AAU termination translated region initiation AUG The Shine-Dalgarno (SD) sequence base-pairs with a pyrimidine-rich sequence in 16S rrna to facilitate the initiation of protein synthesis

57 Il gene dei procarioti è policistronico

58 Enhancers Nei geni degli eucarioti gli enhancers possono distare dalla regione codificante anche più di 50 Kb.

59 Regolazione dell espressione genica Organizzazione della cromatina Punto 1 Inizio della trascrizione

60 Meccanismi di Regolazione dell espressione genica Fase Nucleare Scelta del gene che deve essere espresso Maturazione dell RNA Trasferimento Nucleo Citoplasma Fase Citoplasmatica Sintesi delle catene polipeptidiche Modificazioni post-traduzionali Trasferimento delle proteine nelle sedi di competenza

61 Il differenziamento cellulare dipende da meccanismi di regolazione dell espressione genica

62

63 Trascrizione sintesi di tutti gli RNA cellulari