Environmental Genomics and Systems Biology Institute of Natural Resource Sciences Zurich University of Applied Sciences, Wädenswil, Switzerland
|
|
- Harriet Strickland
- 6 years ago
- Views:
Transcription
1 Environmental Genomics and Systems Biology Institute of Natural Resource Sciences Zurich University of Applied Sciences, Wädenswil, Switzerland MALDI-TOF MS for microorganism identification: from pattern recognition towards marker based approaches - The example of plant pathogenic Pseudomonas isolates Joël F. Pothier M. Ruinelli F. Foucault, V. Pflüger FA
2 Environmental Genomics and Systems Biology Institute of Natural Resource Sciences Zurich University of Applied Sciences, Wädenswil, Switzerland MALDI-TOF MS for microorganism identification: from pattern recognition towards marker based approaches - The example of Streptococci (and plant pathogenic Pseudomonas isolates) Joël F. Pothier M. Ruinelli F. Foucault, V. Pflüger FA
3 MALDI-TOF MS principle Matrix-Assisted Laser Desorption/Ionization Time-Of-Flight Mass Spectrometry Mass Spectrometry: the velocity of the ion depends on the mass-to-charge (m/z) ratio % intensity Time-Of-Flight: ions acceleration (electric field) and time-of-flight to the detector is recorded Pulsed laser ~337nm m/z To MS detector Ions Laser Desorption/Ionization: matrix ionization (laser pulses) and partial transfer of its (+) charge to the analytes sample + matrix Matrix-Assisted: sample embedded in a matrix, - avoid destruction by the laser - facilitate vaporisation and ionization Ionization Separation Detection slide Environmental Genomics and Systems Biology, IUNR, ZHAW 3
4 What does a MALDI-TOF MS look like? A MALDI-TOF Mass Spectrometer Not a MALDI-TOF Mass Spectrometer X Axima Performance (Shimadzu) Environmental Genomics and Systems Biology, IUNR, ZHAW 4
5 Current bacterial identification methods morphology color, smell, microscopy, etc. molecular Specific PCR, 16S seq., MLSA, MLST, ANI, SNP, RFLP, REP-PCR, etc. immunological mono- or polyclonal antibodies ID biochemical metabolic capacities and resistance to antibiotics ? Environmental Genomics and Systems Biology, IUNR, ZHAW 5
6 Voyager Spec #1=>AdvBC(32,0.5,1.0)=>NF0.7[BP = , 2117] Mass (m/z) Modern microbial taxonomy: genomics & proteomics bacterial cell protein DNA proteome species definition & determination genome % Intensity mass fingerprint DNA fingerprint Environmental Genomics and Systems Biology, IUNR, ZHAW 6
7 Gold standards for identification & phylogeny Specific PCR: Portfolio of different methods Primer design Metabolic profiling: Variability within taxa High influence of growth Low resolution Fatty acid profiling: Low resolution Sequencing (locus / MLSA): Multiple primers design to amplify all strains Requires sequencing Expensive Fingerprints (REP, BOX, ERIC, etc.): Low reproducibility Comparison Environmental Genomics and Systems Biology, IUNR, ZHAW 7
8 Gold standards vs. IC MALDI-TOF MS Specific PCR: Portfolio of different methods Primer design Metabolic profiling: Variability within taxa High influence of growth Low resolution Fatty acid profiling: Low resolution Sequencing (locus / MLSA): Multiple primers design to amplify all strains Requires sequencing Expensive IC MALDI-TOF: Time of preparation/analysis < 30 min No primer optimization needed Down to species or in individual cases even to subspecies and strain-level High reproducibility Relatively low cost per analysis but: - Requires (sufficient) bacterial growth - High initial investment for the machine Fingerprints (REP, BOX, ERIC, etc.): Low reproducibility Comparison Environmental Genomics and Systems Biology, IUNR, ZHAW 8
9 IC-MALDI-TOF MS workflow is easy and fast (1) (3) Transfer Add matrix RT crystallisation (2) Acquire mass spectra automated ~20s Identification or phylogeny % Intensity Mass (m/z) Environmental Genomics and Systems Biology, IUNR, ZHAW
10 4000 m/z IC-MALDI-TOF MS of bacteria: different taxa produce distinct peak patterns Pantoea agglomerans Acinetobacter lwoffi Burkholderia cepacia Raoultella ornithinolytica Staphylococcus aureus Escherichia coli 4000 m/z 8000 Environmental Genomics and Systems Biology, IUNR, ZHAW
11 Several peaks can be associated to ribosomal proteins 30S: about 21 subunits 50S: about 31 subunits (Demirev et al. 2001, Welker et al. 2011) Ribosomal proteins are: constitutively expressed and therefore abundant in detectable amounts (independently of sample preparation and culturing conditions) highly conserved and therefore allow a highly accurate species identification in general smaller than 20kDa, making small changes easily detectable by MALDI-TOF MS Environmental Genomics and Systems Biology, IUNR, ZHAW 11
12 For example, let s take two samples Environmental Genomics and Systems Biology, IUNR, ZHAW 12
13 Same residues in different order = not informative Transcription DNA ATGATTTGCCAT GCGGAACTGTAA ATGATTTGCCAT GAACTGGCGTAA Translation RNA AUGAUUUGCCAU GCGGAACUGUAA AUGAUUUGCCAU GAACUGGCGUAA Protein MICHAEL* MICHELA* Ionisation Protein mass m/z Da m/z Da Mass spectrum Environmental Genomics and Systems Biology, IUNR, ZHAW 13
14 Similar residues = not informative ATGATTTGCCATGCGGAACTGGGCGAAACCGCG[G/C]A[G/A]TAA MICHAELGETAZ* m/z Da Transcription DNA ATGATTTGCCATGCGGAACTG GGCGAAACCGCGGAATAA ATGATTTGCCATGCGGAACTG GGCGAAACCGCGCAGTAA Translation RNA AUGAUUUGCCAUGCGGAACUG GGCGAAACCGCGGAAUAA AUGAUUUGCCAUGCGGAACG GGCGAAACCGCGCAGUAA Protein MICHAELGETAE* MICHAELGETAQ* Ionisation Protein mass m/z Da m/z Da % Mass spectrum Environmental Genomics and Systems Biology, IUNR, ZHAW 14
15 C-terminal variation = informative Transcription DNA ATGATTTGCCATGCGGAACTG GGCGAAACCGCGTAA ATGATTTGCCATGAACTG GCGCGCATTAACTAA Translation RNA AUGAUUUGCCAUGCGGAACU GGGCGAAACCGCGUAA AUGAUUUGCCAUGAACUG GCGCGCAUUAACUAA Protein MICHAELGETA* MICHELARUIN* Ionisation Protein mass m/z Da m/z Da % Mass spectrum Environmental Genomics and Systems Biology, IUNR, ZHAW 15
16 Missense mutation = very informative Transcription DNA ATGATTTGCCATGAACTGGCGC GCATTAACGAACTGCTGATTTAA ATGATTTGCCATGAACTGGTGCG CATTAACGAACTGCTGATTTAA Translation RNA AUGAUUUGCCAUGAACUGGCGC GCAUUAACGAACUGCUGAUUUAA AUGAUUUGCCAUGAACUGGUGC GCAUUAACGAACUGCUGAUUUAA Protein MICHELARUINELLI* MICHELVRUINELLI* Ionisation Protein mass m/z Da m/z Da % Mass spectrum Environmental Genomics and Systems Biology, IUNR, ZHAW 16
17 Voyager Spec #1=>AdvBC(32,0.5,1.0)=>NF0.7[BP = , 2117] Mass (m/z) Modern microbial taxonomy: genomics & proteomics bacterial cell protein DNA proteome species definition & determination genome % Intensity mass fingerprint DNA fingerprint Environmental Genomics and Systems Biology, IUNR, ZHAW 17
18 PAPMID TM database (Putatively Assigned Protein Masses for Identification) Taxonomic tools PAPMID TM Hybrid plot features E. coli K12 DH10B L L L L SNP Codon 43 Weight (Da) AAA K AGA K43R ACA K43T AAY K43N Compare functions The PAPMID TM database: Contains the relevant reference information of > genomes covering ~3 200 bacterial species Is independent of the MALDI-TOF MS instrument type and enables automated spectra quality control Allows phylogenetic interpretation of acquired bacterial spectral data Environmental Genomics and Systems Biology, IUNR, ZHAW
19 Application to streptococci Over 50 species are recognized in the genus Divided into Lancefield groups Divided into 6 groups based on 16S rdna seq. Several species are medically relevant: Several new species described: S. infantis, S. tigurinus, S. orisratti, etc. ongoing in Group D streptococci PAPMID: 792 genomes available, covering 34 species S. pneumoniae vs. S. mitis blind test with 61 isolates (17 S. pneumoniae) 100% specificity. Applied in daily routine. Environmental Genomics and Systems Biology, IUNR, ZHAW 19
20 Application to streptococci S._mitis_11_5 S._mitis_NCTC_12261 S._mitis_13_39 S._pseudopneumoniae_ATCC_BAA-960 S._pseudopneumoniae_SK674 S._pneumoniae_801 S._pneumoniae_N.A. S._pneumoniae_1542 S._oralis_SK100 S._oralis_SK10 S._oralis_ATCC_49296 S._tigurinus_1366 S._tigurinus_AZ_3a S._infantis_ATCC_ S._infantis_X S._infantis_SK1076 S._peroris_ATCC_ S._parasanguinis_CC87K S._parasanguinis_F0405 S._parasanguinis_ATCC_903 S._australis_ATCC_ S._mutans_1ID3 S._mutans_1SM1 S._mutans_2ST1 S._vestibularis_ATCC_49124 S._vestibularis_F0396 S._salivarius_K12 S._salivarius_SK126 S._thermophilus_ASCC_1275 S._thermophilus_MN-ZLW-002 S._thermophilus_1F8CT S._gallolyticus_ATCC_43143 F-1867 S._gallolyticus_subsp._gallolyticus_ S._pasteurianus_ATCC_43144 JCM_534 S._equinus_ATCC_ S._macedonicus_N.A. S._equinus_ S._equinus_ATCC_9812 S._infantarius_subsp._infantarius_A S._lutetiensis_033 S._intermedius_ATCC_27335 S._intermedius_BA1 S._intermedius_F0395 S._anginosus_N.A. S._anginosus_SK1138 S._anginosus_subsp._whileyi_CCUG_ S._sanguinis_ATCC_29667 S._sanguinis_CC94A S._macacae_NCTC_11558 S._dysgalactiae_subsp._dysgalactiae_ S._dysgalactiae_subsp._equisimilis_1 S._dysgalactiae_subsp._equisimilis_R S._canis_FSL_Z3-227 S._ictaluri_ S._pyogenes_ABC S._pyogenes_ABC S._pyogenes_ABC S._iniae_N.A. S._iniae_SF1 S._iniae_IUSA1 S._urinalis_ S._urinalis_FB127-CNA-2 S._pseudoporcinus_LQ_ S._pseudoporcinus_SPIN_20026 S._porcinus_str._Jelinkova_176 S._parauberis_NCFD_2020 S._suis_05HAS68 S._suis_A7 S._suis_89_1591 S._downei_F Environmental Genomics and Systems Biology, IUNR, ZHAW 20
21 Example of application: Streptococcus agalactiae S. agalactiae is an ubiquitous zoonotic Gram-positive bacterium Reported isolation from a variety of hosts: humans of all age classes, cattle and camels, several fish species and a range of aquatic animals (frogs, crocodiles, seals, dolphins) Commensal of the digestive and genitourinary tracts of humans Has emerged as the leading cause of bacterial neonatal infections in Europe and North America during the 1960s. Environmental Genomics and Systems Biology, IUNR, ZHAW 21
22 S. agalactiae multilocus sequence typing Population snapshot based on all ST s described ( Five main clonal complexes Almost 80% of reported invasive neonatal infections due to one main highly virulent clonal complex (CC17/ST17) The human CCs 19, 1, 10 and 17 are recently all linked but the founder STs are still dominating over time Environmental Genomics and Systems Biology, IUNR, ZHAW 22
23 Genomes in PAPMID database vs. isolates in MALDI-TOF 58 Environmental Genomics and Systems Biology, IUNR, ZHAW 23
24 S. agalactiae ribosomal proteins in MALDI-TOF MS Protein mass: dominant variants From the 57 ribosomal proteins present in S. agalactiae genome, 32 can be reproducibly detected 3 detectable mass shifts of ribosomal proteins in 7 reference strains Dominant protein masses can be used for internal calibration Environmental Genomics and Systems Biology, IUNR, ZHAW 24
25 Ribosomal protein mass variability is linked to main CCs L13 L35 S8 Variability (400 ppm accuracy) Environmental Genomics and Systems Biology, IUNR, ZHAW 25
26 Ribosomal protein mass profiles define 20 lineages Variability (400 ppm accuracy) Environmental Genomics and Systems Biology, IUNR, ZHAW 26
27 Validation statistics of S. agalactiae subtyping Full in silico mass set allowed subtyping of 239 isolates (38 STs) Environmental Genomics and Systems Biology, IUNR, ZHAW 27
28 Example of application: root nodule bacteria Tested with 116 genome sequenced strains A subset of 13 ribosomal protein biomarkers is sufficient for identification Successfully validated on unknown isolates (n>100) from Ivory Coast pigeon pea nodules Environmental Genomics and Systems Biology, IUNR, ZHAW 28
29 Example of application: root nodule bacteria Bradyrhizobium sp. WSM 2793 Ensifer fredii NGR234 Microvirga lotononidis WSM3557 Environmental Genomics and Systems Biology, IUNR, ZHAW 29
30 Example of application: root nodule bacteria 16S rrna MLSA (n=5; bp) ribo MLSA (n=13; bp) MALDI Environmental Genomics and Systems Biology, IUNR, ZHAW 30
31 Application to Pseudomonas isolates biocontrol Very diverse genus Mulet et al. 2010: MLST phylogeny of Pseudomonas sp. plant pathogens soil bioremediation human pathogen Over 218 species are recognized in the genus, 18 subspecies PAPMID: genomes available, covering 75 species Possible to identify successfully: - Pseudomonas fluorescens isolates - Pseudomonas viridiflava isolates - Pseudomonas syringae isolates Environmental Genomics and Systems Biology, IUNR, ZHAW 31
32 Conclusions and outlooks Establishment of a centralized database for quick bacterial identification based on genome derived data Validation with 100 clinically relevant bacterial species (n = 1 000) with 99.2% specificity and 97.6% sensitivity Confident discrimination of closely related bacterial species High potential for bacterial subtyping and phylogenetic interpretation of spectral data Possibility to detect some antibiotic resistances that reside on ribosomal proteins Allows high coverage for environmental and rare species PAPMID can be easily extended with new genome data Environmental Genomics and Systems Biology, IUNR, ZHAW 32
33 Acknowledgments MABRITEC AG (Riehen, CH): D. Ziegler, G. Vogel ZHAW (Wädenswil, CH): M. Gétaz, M. Palmisano, F. Rezzonico Istituto cantonale di microbiologia (Bellinzona, CH): C. Benagli, M. Tonolla Spiez Labor (Spiez, CH): M. Wittwer Research Insitute of Horticulture (Skierniewice, PL): M. Kałuzna, J. Puławska COST FA 1104 Sustainable production of high-quality cherries for the European market : J. Quero-Garcia, D. Calvi, C. Mounier... thank you for you attention FA 1104 joel.pothier@zhaw.ch Environmental Genomics and Systems Biology, IUNR, ZHAW 33
34 FA 1104 COST 1104 Training School Molecular diagnostics of bacterial diseases September 2015, Wädenswil Environmental Genomics and Systems Biology, IUNR, ZHAW 34
35 Environmental Genomics and Systems Biology, IUNR, ZHAW 35
Diagnostic and Epidemiological Tools for Cherry Pathogenic Bacteria based on Genomics and MALDI-TOF Mass Spectrometry
Diagnostic and Epidemiological Tools for Cherry Pathogenic Bacteria based on Genomics and MALDI-TOF Mass Spectrometry Michela Ruinelli (1), Joël Pothier (1), Jochen Blom (2), Alexander Goesmann (2), Valentin
More informationProviding clear solutions to microbiological challenges TM. cgmp/iso CLIA. Polyphasic Microbial Identification & DNA Fingerprinting
Providing clear solutions to microbiological challenges TM Cert. No. 2254.01 Polyphasic Microbial Identification & DNA Fingerprinting Microbial Contamination Tracking & Trending cgmp/iso-17025-2005 CLIA
More informationCOST FA1104 Training School Molecular diagnostics of bacterial diseases
COST FA1104 Training School Molecular diagnostics of bacterial diseases Zurich University of Applied Sciences School of Life Sciences and Facility Management Institute of Natural Resource Sciences Environmental
More informationMALDI-TOF Mass Spectrometry Hype or Revolution? Will Probert, Ph.D. Microbial Diseases Laboratory Branch California Department of Public Health
MALDI-TOF Mass Spectrometry Hype or Revolution? Will Probert, Ph.D. Microbial Diseases Laboratory Branch California Department of Public Health Matrix Assisted Laser Desorption Ionization (MALDI) Sample
More informationcgmp/iso CLIA Experience Unsurpassed Quality
Cert. No. 2254.01 cgmp/iso-17025-2005 CLIA Experience Unsurpassed Quality Polyphasic Microbial Identification & DNA Fingerprinting Microbial Contamination Tracking & Trending Microbial Identification
More informationChapter 10: Classification of Microorganisms
Chapter 10: Classification of Microorganisms 1. The Taxonomic Hierarchy 2. Methods of Identification 1. The Taxonomic Hierarchy Phylogenetic Tree of the 3 Domains Taxonomic Hierarchy 8 successive taxa
More informationIR Biotyper. Innovation with Integrity. Straight forward strain typing FT-IR
IR Biotyper Straight forward strain typing Innovation with Integrity FT-IR Strain Typing Made Easy Fast, easy-to-apply and economical typing methods are highly demanded in hospital hygiene management for
More informationWhole Genome Sequence Data Quality Control and Validation
Whole Genome Sequence Data Quality Control and Validation GoSeqIt ApS / Ved Klædebo 9 / 2970 Hørsholm VAT No. DK37842524 / Phone +45 26 97 90 82 / Web: www.goseqit.com / mail: mail@goseqit.com Table of
More informationProteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.
Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview
More informationDr. Sabri M. Naser Department of Biology and Biotechnology An-Najah National University Nablus, Palestine
Molecular identification of lactic acid bacteria Enterococcus, Lactobacillus and Streptococcus based on phes, rpoa and atpa multilocus sequence analysis (MLSA) Dr. Sabri M. Naser Department of Biology
More informationExam MOL3007 Functional Genomics
Faculty of Medicine Department of Cancer Research and Molecular Medicine Exam MOL3007 Functional Genomics Tuesday May 29 th 9.00-13.00 ECTS credits: 7.5 Number of pages (included front-page): 5 Supporting
More informationSAMPLE. Interpretive Criteria for Identification of Bacteria and Fungi by Targeted DNA Sequencing
MM18 Interpretive Criteria for Identification of Bacteria and Fungi by Targeted DNA Sequencing This guideline includes information on sequencing DNA targets of cultured isolates, provides a quantitative
More informationA risk based approach to managing environmental excursions
A risk based approach to managing environmental excursions RACI: Monitoring & protecting your GMP facility s Environment 20 th April Ngoc Anh-Thu Phan www.eurofins.com Content Introduction Risk Assessment
More informationMicrobial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B
Microbial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm Overview of Last Lecture Taxonomy (three
More informationMicrobial Culture Collection of Cantacuzino Institute
Microbial Culture Collection of Cantacuzino Institute Present and perspectives of development Olguta Dracea, Camelia Babes, Rodica Oancea, Anca Israil, Irina Codita, Adrian Onu, Gabriel Ionescu Cantacuzino
More informationSNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM
SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400
More informationSNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM
SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400
More informationHKSH Introduces Matrix-Assisted Laser Desorption Ionization Time-of-Flight (MALDI-TOF) Biotyper
HKSH Introduces Matrix-Assisted Laser Desorption Ionization Time-of-Flight (MALDI-TOF) Biotyper Bacterial Identification Speed Doubled with 90% Accuracy (13 September, 2012 Hong Kong) Hong Kong Sanatorium
More informationMicroSEQ Rapid Microbial Identification System
MicroSEQ Rapid Microbial Identification System Giving you complete control over microbial identification using the gold-standard genotypic method The MicroSEQ ID microbial identification system, based
More informationChapter 4B: Methods of Microbial Identification. Chapter Reading pp , ,
Chapter 4B: Methods of Microbial Identification Chapter Reading pp. 118-121, 244-245, 250-251 Biochemical Testing In addition to morphological (i.e., appearance under the microscope) and differential staining
More informationClassification of Microorganisms
PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 10 Classification of Microorganisms The Study of Phylogenetic Relationships Taxonomy is the science
More informationBlood cultures: past, present and future. Dr Natalia Solomon MD, FRCPSC Medical Microbiologist DynaLIFE Dx
Blood cultures: past, present and future Dr Natalia Solomon MD, FRCPSC Medical Microbiologist DynaLIFE Dx Faculty/ Presenter Disclosure Faculty: Dr Natalia Solomon Relationships with commercial interests:
More informationMicroSEQ Rapid Microbial Identifi cation System
APPLICATION NOTE MicroSEQ Rapid Microbial Identifi cation System MicroSEQ Rapid Microbial Identification System Giving you complete control over microbial identifi cation using the gold-standard genotypic
More informationComputing with large data sets
Computing with large data sets Richard Bonneau, spring 2009 Lecture 14 (week 8): genomics 1 Central dogma Gene expression DNA RNA Protein v22.0480: computing with data, Richard Bonneau Lecture 14 places
More informationMOLECULAR TYPING TECHNIQUES
MOLECULAR TYPING TECHNIQUES RATIONALE Used for: Identify the origin of a nosocomial infection Identify transmission of disease between individuals Recognise emergence of a hypervirulent strain Recognise
More informationMass Spectrometry. Kyle Chau and Andrew Gioe
Mass Spectrometry Kyle Chau and Andrew Gioe Computation of Molecular Mass - Mass Spectrum is a plot of intensity as a function of masscharge ratio, m/z. - Mass-charge ratio can be determined through accelerating
More informationPERANAN MIKROBIOLOGI DALAM DIAGNOSIS PENYAKIT INFEKSI. dr. Agus Eka Darwinata, Ph.D.
PERANAN MIKROBIOLOGI DALAM DIAGNOSIS PENYAKIT INFEKSI dr. Agus Eka Darwinata, Ph.D. CLINICAL MICROBIOLOGY Clinical microbiology is the discipline of detection, characterization, and quantification of
More informationBacterial Genetics. Stijn van der Veen
Bacterial Genetics Stijn van der Veen Differentiating bacterial species Morphology (shape) Composition (cell envelope and other structures) Metabolism & growth characteristics Genetics Differentiating
More informationMicroSEQ TM ID Rapid Microbial Identification System:
MicroSEQ TM ID Rapid Microbial Identification System: the complete solution for reliable genotypic microbial identification 1 The world leader in serving science Rapid molecular methods for pharmaceutical
More informationAthanassios Tsakris Medical School, University of Athens Greece
Athanassios Tsakris Medical School, University of Athens Greece Each hour of delay (over the first 6 hours) resulting in a 7.6% decrease in survival «In septic shock, time is life» Kumar A, Crit Care Med
More informationTaxonomy. Classification of microorganisms 3/12/2017. Is the study of classification. Chapter 10 BIO 220
Taxonomy Is the study of classification Organisms are classified based on relatedness to each other Chapter 10 BIO 220 Fig. 10.1 1 Species Binomial nomenclature for species identification A eukaryotic
More informationAntonio Del Casale. Microbion srl Verona University Spin-off - Italy
Antonio Del Casale Microbion srl Verona University Spin-off - Italy Food Matters Live 19 November 2014 Microbion Verona University Spin-off Biodiversity services & products Finds the best performing microbes
More informationBruker Introduces Bologna Work ow for Rapid and Cost-E ective Clinical Microbiology Diagnosis of Bloodstream Infections with Broad Species Coverage
NEWS RELEASE Bruker Introduces Bologna Work ow for Rapid and Cost-E ective Clinical Microbiology Diagnosis of Bloodstream Infections with Broad Species Coverage 4/20/2018 60-90 Minute Microbial ID of 2,700
More informationrapiflex Innovation with Integrity Designed for Molecules that Matter. MALDI TOF/TOF
rapiflex Designed for Molecules that Matter. Innovation with Integrity MALDI TOF/TOF rapiflex TM The first MALDI-TOF/TOF that adapts to your needs. The rapiflex is the most advanced MALDI TOF/TOF system
More informationFUTURE PROSPECTS IN MOLECULAR INFECTIOUS DISEASES DIAGNOSIS
FUTURE PROSPECTS IN MOLECULAR INFECTIOUS DISEASES DIAGNOSIS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC hodinka@greenvillemed.sc.edu
More informationMochamad Nurcholis. Food Technology Department Agricuktural Technology Faculty Brawijaya University 2013
Mochamad Nurcholis Food Technology Department Agricuktural Technology Faculty Brawijaya University 2013 Microbial Identification Type Conventional Identification DNA Hybridization PCR Amplification DNA
More informationAdvances in detecting pathogens in foods. Roy Betts Head of Microbiology
Advances in detecting pathogens in foods Roy Betts Head of Microbiology Test Methods - why are they important? Everything we know about the microbiology of our food is based on testing We make very big
More informationRapid Bacterial Identification Using a Mass Spectrometry Based Molecular Diagnostics Approach: Evaluation of the Iridica Platform
Rapid Bacterial Identification Using a Mass Spectrometry Based Molecular Diagnostics Approach: Evaluation of the Iridica Platform Alec Saitman, PhD, Jane Y. Yang PhD, Sharon Reed, David Pride, Michele
More informationMicrobial Identification for the Environmental Monitoring Arena Using MALDI-TOF
Microbial Identification for the Environmental Monitoring Arena Using MALDI-TOF Anne M. Russell, Ph.D. Senior Staff Scientist EMD anne.russell@crl.com Presentation Overview 1. Accugenix - History and Market
More informationContents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...
Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result
More informationAdvances in analytical biochemistry and systems biology: Proteomics
Advances in analytical biochemistry and systems biology: Proteomics Brett Boghigian Department of Chemical & Biological Engineering Tufts University July 29, 2005 Proteomics The basics History Current
More informationMultilocus Sequence Typing - MLST. Characterisation of bacteria. Hospital outbreak of resistant bacteria. Community outbreak of diarrhoea
Multilocus Sequence Typing - MLST Slides from Andreas Petersen Slide 1 Characterisation of bacteria Hospital outbreak of resistant bacteria Community outbreak of diarrhoea Global spread of respiratory
More informationRiboPrinter microbial characterization system
DuPont Qualicon RiboPrinter microbial characterization system Staphylococcus epidermidis RiboGroup 102-45-3 OK. You found it. Now what? DuPont Qualicon 1.800.863.6842 2 RiboPrinter microbial characterization
More informationInsight into microbial world molecular biology research in environmental microbiology
Insight into microbial world molecular biology research in environmental microbiology Aleksandra Ziembi ska The Silesian University of Technology, Environmental Biotechnology Department aleksandra.ziembinska@polsl.pl
More informationProMass HR Applications!
ProMass HR Applications! ProMass HR Features Ø ProMass HR includes features for high resolution data processing. Ø ProMass HR includes the standard ProMass deconvolution algorithm as well as the full Positive
More informationMarker types. Potato Association of America Frederiction August 9, Allen Van Deynze
Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,
More information1-Microbial Taxonomy: classification nomenclature identification
Part 1 Basic Medical Microbiology 1-Microbial Taxonomy: Taxonomy is the area of biologic science comprising three distinct, but highly interrelated, disciplines that include classification, nomenclature,
More informationMicrobial Metabolism Systems Microbiology
1 Microbial Metabolism Systems Microbiology Ching-Tsan Huang ( 黃慶璨 ) Office: Agronomy Hall, Room 111 Tel: (02) 33664454 E-mail: cthuang@ntu.edu.tw MIT OCW Systems Microbiology aims to integrate basic biological
More informationProteomics. Proteomics is the study of all proteins within organism. Challenges
Proteomics Proteomics is the study of all proteins within organism. Challenges 1. The proteome is larger than the genome due to alternative splicing and protein modification. As we have said before we
More informationProteomics and some of its Mass Spectrometric Applications
Proteomics and some of its Mass Spectrometric Applications What? Large scale screening of proteins, their expression, modifications and interactions by using high-throughput approaches 2 1 Why? The number
More informationCONTENTS. Introduction to Sequenom Overview MassARRAY System. Publications xR Sequenom Bioscience. All rights reserved.
CONTENTS Introduction to Sequenom Overview MassARRAY System iplex Biochemistry Publications Sequenom GmbH - brief history Founded in 1994 as Sequenom GmbH in Hamburg (DE) By Hubert Köster and Charles Cantor
More information280 Index. Bacteriophage typing, discrimination, 18 reaction difference rule, 19, 23, 24 reproducibility, 18, 19 selection of bacteriophage, 17
Index Antibiotic, 1-4 factors affecting activity, 3 minimum inhibitory concentration (MIC), 1, 3 solubility, 2, 4 Antibiotic resistance profiling, 1-4 antibiogram, 2 breakpoint method, 2 Antibodies, enzyme
More informationGenomic epidemiology of bacterial pathogens. Sylvain BRISSE Microbial Evolutionary Genomics, Institut Pasteur, Paris
Genomic epidemiology of bacterial pathogens Sylvain BRISSE Microbial Evolutionary Genomics, Institut Pasteur, Paris Typing Population genetics Analysis of strain diversity within species Aim: Local epidemiology?
More informationAbstract... i. Committee Membership... iii. Foreword... vii. 1 Scope Introduction Standard Precautions References...
Vol. 28 No. 12 Replaces MM18-P Vol. 27 No. 22 Interpretive Criteria for Identification of Bacteria and Fungi by DNA Target Sequencing; Approved Guideline Sequencing DNA targets of cultured isolates provides
More informationSYSTEMS. MassARRAY System. Uncompromised Molecular Testing. For Research Use Only. Not for use in diagnostic procedures.
SYSTEMS MassARRAY System Uncompromised Molecular Testing For Research Use Only. Not for use in diagnostic procedures. The MassARRAY System Challenges in Molecular Testing Are you tired of managing trade-offs
More informationSYSTEMS. MassARRAY System. Uncompromised Molecular Testing. For Research Use Only. Not for use in diagnostic procedures.
SYSTEMS MassARRAY System Uncompromised Molecular Testing For Research Use Only. Not for use in diagnostic procedures. The MassARRAY System Challenges in Molecular Testing Are you tired of managing trade-offs
More informationRiboPrinter microbial characterization system
DuPont Qualicon RiboPrinter microbial characterization system Staphylococcus epidermidis RiboGroup 102-45-3 DEDICATED TO MICROBIOLOGY OK. You found it. Now what? RiboPrinter microbial characterization
More informationngs metagenomics target variation amplicon bioinformatics diagnostics dna trio indel high-throughput gene structural variation ChIP-seq mendelian
Metagenomics T TM storage genetics assembly ncrna custom genotyping RNA-seq de novo mendelian ChIP-seq exome genomics indel ngs trio prediction metagenomics SNP resequencing bioinformatics diagnostics
More informationCHAPTER 24. Immunology
CHAPTER 24 Diagnostic i Microbiology and Immunology Growth-Dependent Diagnostic Methods Isolation of Pathogens from Clinical Specimens Proper sampling and culture of a suspected pathogen is the most reliable
More informationMassARRAY System MASSARRAY SYSTEM ACCELERATING RESEARCH
SENSITIVITY ACCELERATING RESEARCH SPEED SPECIFICITY ACCURACY No compromise MASSARRAY SYSTEM Genotyping Somatic mutation profiling Methylation analysis Quantitative gene expression and copy number variant
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationComparative genomics of clinical isolates of Pseudomonas fluorescens, including the discovery of a novel disease-associated subclade.
Comparative genomics of clinical isolates of Pseudomonas fluorescens, including the discovery of a novel disease-associated subclade. by Brittan Starr Scales A dissertation submitted in partial fulfillment
More informationSGN-6106 Computational Systems Biology I
SGN-6106 Computational Systems Biology I A View of Modern Measurement Systems in Cell Biology Kaisa-Leena Taattola 21.2.2007 1 The cell a complex system (Source: Lehninger Principles of Biochemistry 4th
More informationGenetic Adaptation II. Microbial Physiology Module 3
Genetic Adaptation II Microbial Physiology Module 3 Topics Topic 4: Topic 5: Transposable Elements Exchange of Genetic Material Between Organisms Topic 5a: Protection Against Foreign DNA Aims and Objectives
More informationCapabilities & Services
Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro
More informationOutline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information
From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class
More informationTooling up for Functional Genomics
Tooling up for Functional Genomics Michael Abberton, Iain Donnison, Phil Morris, Helen Ougham, Mark Robbins, Howard Thomas From model to crop species 6 Genomes and genome mapping 7 The transcriptome 7
More informationA Highly Accurate Mass Profiling Approach to Protein Biomarker Discovery Using HPLC-Chip/ MS-Enabled ESI-TOF MS
Application Note PROTEOMICS METABOLOMICS GENOMICS INFORMATICS GLYILEVALCYSGLUGLNALASERLEUASPARG CYSVALLYSPROLYSPHETYRTHRLEUHISLYS A Highly Accurate Mass Profiling Approach to Protein Biomarker Discovery
More informationSelenium nanoparticles and their utilization in scaffolds. Prof. RNDr. Vojtech Adam, Ph.D. Mgr. Dagmar Hegerova, Ph.D. Mendel University in Brno
Selenium nanoparticles and their utilization in scaffolds Prof. RNDr. Vojtech Adam, Ph.D. Mgr. Dagmar Hegerova, Ph.D. Mendel University in Brno 2 Content 1. Nanoparticles silver, selenium Staphylococcus
More informationFrom Proteomics to Systems Biology. Integration of omics - information
From Proteomics to Systems Biology Integration of omics - information Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - data What
More informationMethods that do not require growth in laboratory PCR
Methods that do not require growth in laboratory PCR Nucleotide sequencing MLST/MLVST Profiles Microarrays Polymerase Chain Reaction [PCR] Use to find a rare sequence in a pool of many different sequences
More informationMicrobial Community Assembly and Dynamics:.from AMD biofilms to colonization of the premature infant gut
Microbial Community Assembly and Dynamics:.from AMD biofilms to colonization of the premature infant gut Jill Banfield Talk Overview i) AMD microbial biofilms: an example of reproducible community assembly
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationFACTORS THAT AFFECT PROTEIN IDENTIFICATION BY MASS SPECTROMETRY HAOFEI TIFFANY WANG. (Under the Direction of Ron Orlando) ABSTRACT
FACTORS THAT AFFECT PROTEIN IDENTIFICATION BY MASS SPECTROMETRY by HAOFEI TIFFANY WANG (Under the Direction of Ron Orlando) ABSTRACT Mass spectrometry combined with database search utilities is a valuable
More informationWHO, HOW AND WHERE? MICROBIAL ECOLOGY USING RAMAN SPECTROSCOPY DR DANIEL READ CENTRE FOR ECOLOGY & HYDROLOGY, WALLINGFORD 109
WHO, HOW AND WHERE? MICROBIAL ECOLOGY USING RAMAN SPECTROSCOPY DR DANIEL READ CENTRE FOR ECOLOGY & HYDROLOGY, WALLINGFORD 109 Y (µm) 1 µm X (µm) 55 Progress in science depends on new techniques, new discoveries
More informationSolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze
SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David
More informationApplication of Different Typing Methods for Detection of Microbial Contamination of Biological Products and Clean Rooms
Application of Different Typing Methods for Detection of Microbial Contamination of Biological Products and Clean Rooms Pejvak Khaki Department of Microbiology Razi Vaccine & Serum Research Institute Karaj,
More informationAnswers, Simple and Streamlined. Solutions for Biotherapeutic Intact Mass Analysis
Answers, Simple and Streamlined Solutions for Biotherapeutic Intact Mass Analysis Expert Functionality for Mass Spec Non-Experts SCIEX OS on the X500B QTOF system dramatically improves the user experience,
More informationIntroducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight
Introducing QIAseq Accelerate your NGS performance through Sample to Insight solutions Sample to Insight From Sample to Insight let QIAGEN enhance your NGS-based research High-throughput next-generation
More informationAuthors: Vivek Sharma and Ram Kunwar
Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be
More informationExpand Your Research with Metabolomics and Proteomics. Christine Miller Omics Market Manager ASMS 2017
Expand Your Research with Metabolomics and Proteomics Christine Miller Omics Market Manager ASMS 2017 New Additions to Agilent Omics Workflows Acquisition Ion Mobility Q-TOF IM All Ions MS/MS Find Features
More informationMicrobiological diagnosis of Bacillus anthracis. Member of the Bacillus cereus group
Microbiological diagnosis of Bacillus anthracis The first bacterium shown to be the cause of a disease: 1877 by Robert Koch Member of the Bacillus cereus group B. cereus B. anthracis B. thuringiensis B.
More informationAutomated methods in the Microbiology Lab-Issues and Troubleshooting! Presented By: Dr B. Oboudi
In the name of GOD Automated methods in the Microbiology Lab-Issues and Troubleshooting! Presented By: Dr B. Oboudi Overview Background/history Plate streakers and Gram stainers Blood cultures Automated
More informationPROTEOMICS: UNIVERSAL BIOMARKERS FOR INHERITED AND INFECTIOUS DISEASES. Alvin Fox, Karen Fox, and Marvin Vestal
Journal of the South Carolina Academy of Science 6(1)5-11 Spring 2008 PROTEOMICS: UNIVERSAL BIOMARKERS FOR INHERITED AND INFECTIOUS DISEASES Alvin Fox, Karen Fox, and Marvin Vestal University of South
More informationMICROBIOME STANDARDS & RESEARCH SOLUTIONS
THE ESSENTIALS OF LIFE SCIENCE RESEARCH GLOBALLY DELIVERED MICROBIOME STANDARDS & RESEARCH SOLUTIONS Mock Microbial Communities Site-specific Standards STANDARDIZE YOUR WORKFLOW AND OPTIMIZE ASSAY PERFORMANCE
More informationАquaphotomics in biotechnology - new tools and opportunities
Аquaphotomics in biotechnology - new tools and opportunities Prof. Albert Krastanov UNIVERSITY OF FOOD TECHNOLOGIES AQUAPHOTOMICS time-efficient allows rapid, chemical-free, noninvasive in vivo assessment
More informationSystems Biology and Systems Medicine
CHAPTER 5 Systems Biology and Systems Medicine INTRODUCTION A new approach to biology, termed systems biology, has emerged over the past 15 years or so an approach that looks - - have transformed systems
More informationSuperior accuracy and speed MicroSEQ Rapid Microbial Identification System
Superior accuracy and speed MicroSEQ Rapid Microbial Identification System Featuring the 3500 Genetic Analyzer Achieve right-the-fi rst-time microbial identifi cation Next-generation, high-throughput comparative
More informationautoflex max Practical Power, Maximum Utility Innovation with Integrity MALDI-TOF MS
autoflex max Practical Power, Maximum Utility Innovation with Integrity MALDI-TOF MS Wide application versatility with enhanced dynamic range The autoflex max series is based on Bruker s robust and efficient
More informationAnnex to the Accreditation Certificate D PL according to DIN EN ISO/IEC 17025:2005
Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D PL 13372 01 00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 22.05.2014 to 25.03.2017
More informationName: Ally Bonney. Date: January 29, 2015 February 24, Purpose
Name: Ally Bonney Title: Genome sequencing and annotation of Pseudomonas veronii isolated from Oregon State University soil and 16S rrna characterization of Corvallis, OR soil microbial populations Date:
More informationApplications of Next Generation Sequencing in Metagenomics Studies
Applications of Next Generation Sequencing in Metagenomics Studies Francesca Rizzo, PhD Genomix4life Laboratory of Molecular Medicine and Genomics Department of Medicine and Surgery University of Salerno
More informationIsotopic Resolution of Chromatographically Separated IdeS Subunits Using the X500B QTOF System
Isotopic Resolution of Chromatographically Separated IdeS Subunits Using the X500B QTOF System Fan Zhang 2, Sean McCarthy 1 1 SCIEX, MA, USA, 2 SCIEX, CA USA Analysis of protein subunits using high resolution
More informationChapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
More informationIsolation and Characterization of Two Antibiotic-Producing Bacteria
Isolation and Characterization of Two Antibiotic-Producing Bacteria Madeline Gibson Abstract The discovery of antibiotics with novel mechanisms has plateaued in the last twenty years. As antibiotics are
More informationAdvanced Technology in Phytoplasma Research
Advanced Technology in Phytoplasma Research Sequencing and Phylogenetics Wednesday July 8 Pauline Wang pauline.wang@utoronto.ca Lethal Yellowing Disease Phytoplasma Healthy palm Lethal yellowing of palm
More informationThe right answer, every time
MICROSEQ MICROBIAL IDENTIFICATION SYSTEM The right answer, every time Definitive identification of bacterial and fungal isolates. Accuracy adds confidence. When microbial contamination poses problems,
More informationBioinformatics (Lec 19) Picture Copyright: the National Museum of Health
3/29/05 1 Picture Copyright: AccessExcellence @ the National Museum of Health PCR 3/29/05 2 Schematic outline of a typical PCR cycle Target DNA Primers dntps DNA polymerase 3/29/05 3 Gel Electrophoresis
More informationDARPA Integrated Chemical and Biological Detection System
M. DONLON AND J. JACKMAN DARPA Integrated Chemical and Biological Detection System Mildred Donlon and Joany Jackman The threat of attack on military and civilian targets with chemical and biological weapons
More informationVyužití cílené proteomiky pro kontrolu falšování potravin: identifikace peptidových markerů v mase pomocí LC- Q Exactive MS/MS
Využití cílené proteomiky pro kontrolu falšování potravin: identifikace peptidových markerů v mase pomocí LC- Q Exactive MS/MS Michal Godula Ph.D. Thermo Fisher Scientific The world leader in serving science
More information