Supplemental Information. Acclimation of Oxygenic Photosynthesis. to Iron Starvation Is Controlled by the srna IsaR1
|
|
- Domenic Roberts
- 6 years ago
- Views:
Transcription
1 Current Biology, Volume 27 Supplemental Information Acclimation of Oxygenic Photosynthesis to Iron Starvation Is Controlled by the srna IsaR1 Jens Georg, Gergana Kostova, Linda Vuorijoki, Verena Schön, Taro Kadowaki, Tuomas Huokko, Desirée Baumgartner, Maximilian Müller, Stephan Klähn, Yagut Allahverdiyeva, Yukako Hihara, Matthias E. Futschik, Eva-Mari Aro, and Wolfgang R. Hess
2 Figure S1. Conservation of IsaR1 homologs throughout the cyanobacterial phylum. Related to STAR Methods. (A) The locations of isar1 loci are shown alongside a phylogenetic tree based on 16S rrna sequences. The isar1 loci (blue triangles) are frequently associated with upp (orange triangles) and crth (green triangles) genes. The evolutionary distances are in the number of base substitutions per site. Evolutionary analyses were conducted using MEGA 6 [S1]. The organisms chosen for CopraRNA prediction are highlighted with a grey box, and those for which transcriptome data confirmed the presence of IsaR1 are labelled with an asterisk. (B) Multiple ClustalW sequence alignment of the 20 putative IsaR1 homologs from different cyanobacteria used for CopraRNA predictions. Experimentally verified transcripts are indicated by an asterisk. (C) IsaR1 transcript accumulation under different conditions (N-, nitrogen deficiency; Fe-, iron deprivation; cold; heat; HL, high light; exp., exponential growth; stat., stationary phase) with a probe against IsaR1.
3 Figure S2. Analysis of the IsaR1 promoter. Related to Figure 7. (A) Promoter kinetics of the isia and isar1 genes in response to iron depletion. Reporter strains carrying transcriptional fusions of the isia and isar1 upstream sequences with luxab genes were used to monitor in vivo promoter activity in Synechocystis 6803 by bioluminescence detection. The strains were grown in liquid cultures in the presence of 6 µm Fe 2+ to an optical density of 0.8. Iron depletion was then induced by adding 60 µm of the iron-specific chelator DFB at time point 0. Bioluminescence was measured as emitted light counts per second. A strain carrying promoterless luxab genes was used as negative control. Data are the mean ± SD of two replicate cultures. (B) Analysis of the binding of the recombinant FurA protein to the native P isar1 promoter (PisaR1) or the mutated version (PisaR1sub). The -35 element in P isar1 is shown in green letters and the changed nucleotides in orange letters. The red arrow indicates the mobility shifted Fur bound DNA fragment, whereas the black arrow indicates the unbound DNA fragment. (C) The IsaR1 upstream region including the first 2 transcribed nucleotides in Synechocystis 6803 is shown and compared to 31 homologs. The positions of putative -35 and -10 elements are indicated. The Fur binding sequence similar to the one defined for the isia gene in Synechocystis 6803 [S2] is shown on top of the sequence logo and its position indicated by the horizontal black lines underneath. Promoter prediction was done with the MEME webserver version [S3] and standard parameters.
4 Figure S3. Verification of IsaR1 overexpression. Related to the transcriptome analysis as shown in Figure 4. Northern hybridization was performed for triplicate samples to verify ectopic overexpression of IsaR1 (upper part). The gene isar1 was introduced into Synechocystis 6803 on the replicative vector pvz322 under control of the P pete promoter (IsaR1OE). The control strain (WT) was the WT into which plasmid pvz322 was introduced lacking the P pete-isar1 cassette (WT_pVZ). Expression of IsaR1 from this promoter was induced by the addition of 2 µm CuSO 4 in BG11 medium containing the normal iron concentration and samples were taken at the indicated time points. Below is the ethidium bromide stained gel before blotting.
5 Figure S4. Raw fluorescence data from the sgfp assays. Related to Figure 5, Figure 6 and to STAR Methods. Raw GFP Fluorescence of the respective translational 5 UTR-GFP fusion in presence of the control plasmid pjv300 or the srna (IsaR1). For each clone, the fluorescence of 50,000 events was collected by flow cytometry. The events were individually gated for each well to retain the events with a fluorescence lower than or equal to the mean of all fluorescence values plus four times the standard deviation. The mean of the gated events was averaged for 6 independent biological replicates, standard deviation was calculated from these replicates. (A) Confirmed targets with compensatory mutations. (B) Confirmed targets. (C) Negative targets. (D) Targets with a fluorescence at background or slightly above the control plasmid background levels, which made it impossible to conclude a regulatory function of IsaR1.
6 Figure S5. Fold repression data from the sgfp assays. Related to Figure 5 and Figure 6. The fold repression was calculated as the ratio of the mean sgfp fluorescence of the respective translational 5 UTR sgfp fusion in the presence of the control plasmid pjv300 and a plasmid for the overexpression of the respective srna, after the subtraction of the background fluorescence. The background fluorescence was measured with the control plasmids pxg-0 (with a luciferase gene instead of GFP) and pjv300, from which a short nonsense transcript is transcribed instead of a specific srna. The error of the fold repression was calculated considering error propagation under the assumption that the values could be correlated. (A-C) Fold-repression values corresponding to the raw fluorescence values from Figure S4A-C. (D) Fold-repression values from 5 UTRs shown in Figure S4D with a fold repression >1.5, but a large error due to fluorescence close to background. (E) Predicted interaction between IsaR1 and the sodb 5 UTR. The start codon is shown in blue and the compensatory point mutations are indicated in orange.
7 Figure S6. Western Blot of PsaB in IsaR1OE and WT_pVZ. Related to Figure S4 and Figure 7. The PsaB subunit of PSI is negatively affected by IsaR1 overexpression. Western blot with time series of induction of ectopic expression of IsaR1 by copper addition. As a control for the linear range of the detected signal, the samples from the 0 h time point were diluted to 50% of the total protein concentration. The standard deviations are based on 3 independent biological replicates. Quantification was performed separately for the wild type and the IsaR1OE strains and the 0 h intensities were set to 100%.
8 Figure S7. Predicted interaction sites for IsaR1 targets supported by the sgfp reporter gene assay (related to Figures 5, 6, S4 and S5). The secondary structure (dg = kcal mol -1 ) is predicted to consist of a major Rho-independent terminator encompassing most of the molecule and a 5 domain functioning as a single seed region. Nucleotide positions predicted by IntaRNA to be involved in the interactions are shown in red, note that these might extend into the following stem in case of sufb (Figure 6D) and petf (Figure 5D). Experimentally tested point mutations interrupting these interaction are indicated by red boxes. A weak hair pin motif in the 5 region is indicated by brackets. The mfold web server [S4] was used for the prediction.
9 Supplemental References S1. Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S. (2013). MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 30, S2. Kunert, A., Vinnemeier, J., Erdmann, N., and Hagemann, M. (2003). Repression by Fur is not the main mechanism controlling the iron-inducible isiab operon in the cyanobacterium Synechocystis sp. PCC FEMS Microbiol. Lett. 227, S3. Bailey, T.L., and Elkan, C. (1994). Fitting a mixture model by expectation maximization to discover motifs in bipolymers. In Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology (AAAI Press, Menlo Park, California), pp Available at: [Accessed November 12, 2016]. S4. Zuker, M. (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, S5. Wright, P.R., Richter, A.S., Papenfort, K., Mann, M., Vogel, J., Hess, W.R., Backofen, R., and Georg, J. (2013). Comparative genomics boosts target prediction for bacterial small RNAs. Proc. Natl. Acad. Sci. U. S. A. 110, E S6. Wright, P.R., Georg, J., Mann, M., Sorescu, D.A., Richter, A.S., Lott, S., Kleinkauf, R., Hess, W.R., and Backofen, R. (2014). CopraRNA and IntaRNA: predicting small RNA targets, networks and interaction domains. Nucleic Acids Res. 42, W S7. Kopf, M., Klähn, S., Scholz, I., Matthiessen, J.K.F., Hess, W.R., and Voß, B. (2014). Comparative analysis of the primary transcriptome of Synechocystis sp. PCC DNA Res. 21, S8. Hernández-Prieto, M.A., Schön, V., Georg, J., Barreira, L., Varela, J., Hess, W.R., and Futschik, M.E. (2012). Iron deprivation in Synechocystis: inference of pathways, non-coding RNAs, and regulatory elements from comprehensive expression profiling. G3 Bethesda Md 2,
Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationGong Y M, et al. Chin Sci Bull March (2012) Vol.57 No.7 761
Gong Y M, et al. Chin Sci Bull March (2012) Vol.57 No.7 761 and Anabaena, however, are not identified yet. As a cisencoded antisense RNA, aftsh may accelerate the downregulation of in developing heterocysts.
More informationUnit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationMaterials and methods. by University of Washington Yeast Resource Center) from several promoters, including
Supporting online material for Elowitz et al. report Materials and methods Strains and plasmids. Plasmids expressing CFP or YFP (wild-type codons, developed by University of Washington Yeast Resource Center)
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationSupplemental Information. Natural RNA Polymerase Aptamers. Regulate Transcription in E. coli
Molecular Cell, Volume 67 Supplemental Information Natural RNA Polymerase Aptamers Regulate Transcription in E. coli Nadezda Sedlyarova, Philipp Rescheneder, Andrés Magán, Niko Popitsch, Natascha Rziha,
More information% Viability. isw2 ino isw2 ino isw2 ino isw2 ino mM HU 4-NQO CPT
a Drug concentration b 1.3% MMS nhp1 nhp1 8 nhp1 mag1.5% MMS.3% MMS nhp1 nhp1 ino8 9 ino8 9 % Viability 4.5% MMS ino8 9 ino8 9 2.5.1.15 % MMS c d nhp1 nhp1 nhp1 nhp1 nhp1 nhp1 Control (YPD) γ IR (1 gy)
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationAnswers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth.
Answers to Module 1 Short Answers 1) What is an obligate aerobe? An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. What about facultative anaerobe? 2) Distinguish
More informationSupplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with
Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More information2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.
AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationSelf-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora
More informationOptimizing Synthetic DNA for Metabolic Engineering Applications. Howard Salis Penn State University
Optimizing Synthetic DNA for Metabolic Engineering Applications Howard Salis Penn State University Synthetic Biology Specify a function Build a genetic system (a DNA molecule) Genetic Pseudocode call producequorumsignal(luxi
More informationSolutions to Quiz II
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Solutions to 7.014 Quiz II Class Average = 79 Median = 82 Grade Range % A 90-100 27 B 75-89 37 C 59 74 25 D 41 58 7 F 0 40 2 Question 1
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationProblem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationSupplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
More informationLearning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance
Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationHossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
More informationSUPPLEMENTAL MATERIALS
SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationSupporting Information
Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany RNA ligands that distinguish metabolite-induced conformations in the TPP riboswitch Günter Mayer, Marie-Sophie L. Raddatz, Julia D. Grunwald,
More informationLink between iron homeostasis, oxidative mutagenesis and antibiotic resistance evolution
Thesis of the PhD dissertation Link between iron homeostasis, oxidative mutagenesis and antibiotic resistance evolution Orsolya Katinka Méhi Supervisor: Dr. Csaba Pál, senior research associate PhD School
More informationColeman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
More informationmeasuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
More informationSupplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated
More informationproduces an RNA copy of the coding region of a gene
1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the
More informationAssembling Protein Molecules
How Does Dna Provide Instructions For Assembling Protein Molecules What does the information in DNA molecules provide instructions for? A. Assembling B. Assembling protein molecules into amino acids. C.
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationDNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted
DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines
More informationBiology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.
Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
More informationThe Two-Hybrid System
Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe
More informationMolecular Genetics. Before You Read. Read to Learn
12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase
More informationHeme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive
Supplemental Data Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive gene-2 Caiyong Chen 1, Tamika K. Samuel 1, Michael Krause 2, Harry A. Dailey 3, and Iqbal
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More informationZool 3200: Cell Biology Exam 2 2/20/15
Name: TRASK Zool 3200: Cell Biology Exam 2 2/20/15 Answer each of the following short and longer answer questions in the space provided; circle the BEST answer or answers for each multiple choice question
More informationRead the question carefully before answering. Think before you write. If I can not read your handwriting, I will count the question wrong.
Name KEY Note Total points added up to only 98 points so everyone received 2 free points to make total points 100. Biology 201 (Genetics) Exam #3 23 November 2004 Read the question carefully before answering.
More informationActivation of a Floral Homeotic Gene in Arabidopsis
Activation of a Floral Homeotic Gene in Arabidopsis Busch, M.A., Bomblies, K., Weigel, D. kuleuven-kortrijk.be Simon Olthof Louie Christodoulidis 1 In Arabidopsis flowers, appearance is based, in part,
More informationDNA Transcription. Visualizing Transcription. The Transcription Process
DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription
More informationFigure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana.
SUPPLEMENTARY FIGURES Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. YFP:, :CFP, HA: and (A) and HA, CFP and YFPtagged and AVR1-CO39 (B) were expressed
More informationMIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.
MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationCh. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
More informationSupplemental Materials and Methods
Supplemental Materials and Methods Proteins and reagents Proteins were purified as described previously: RecA, RecQ, and SSB proteins (Harmon and Kowalczykowski 1998); RecF protein (Morimatsu and Kowalczykowski
More informationFundamentals of Genetics. 4. Name the 7 characteristics, giving both dominant and recessive forms of the pea plants, in Mendel s experiments.
Fundamentals of Genetics 1. What scientist is responsible for our study of heredity? 2. Define heredity. 3. What plant did Mendel use for his hereditary experiments? 4. Name the 7 characteristics, giving
More informationSupplementary Materials
Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran
More informationSupplementary Figures Montero et al._supplementary Figure 1
Montero et al_suppl. Info 1 Supplementary Figures Montero et al._supplementary Figure 1 Montero et al_suppl. Info 2 Supplementary Figure 1. Transcripts arising from the structurally conserved subtelomeres
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationActivation of a Floral Homeotic Gene in Arabidopsis
Activation of a Floral Homeotic Gene in Arabidopsis By Maximiliam A. Busch, Kirsten Bomblies, and Detlef Weigel Presentation by Lis Garrett and Andrea Stevenson http://ucsdnews.ucsd.edu/archive/graphics/images/image5.jpg
More informationSupplemental Information
Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure
More informationa. Primers were purchased from Display Systems Biotech and are listed numerically to differentiate them
Table 2-1. Random upstream primers used in fluorescence differential display. Upstream primer a Sequence 1 5 GATCATAGCC 2 5 CTGCTTGATG 3 5 GATCCAGTAC 4 5 GATCGCATTG 5 5 AAACTCCGTC 6 5 TGGTAAAGGG 7 5 GATCATGGTC
More informationAlternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
More informationGTTCGGGTTCC TTTTGAGCAG
Supplementary Figures Splice variants of the SIP1 transcripts play a role in nodule organogenesis in Lotus japonicus. Wang C, Zhu H, Jin L, Chen T, Wang L, Kang H, Hong Z, Zhang Z. 5 UTR CDS 3 UTR TCTCAACCATCCTTTGTCTGCTTCCGCCGCATGGGTGAGGTCATTTTGTCTAGATGACGTGCAATTTACAATGA
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationsides of the aleurone (Al) but it is excluded from the basal endosperm transfer layer
Supplemental Data. Gómez et al. (2009). The maize transcription factor MRP-1 (Myb-Related-Protein-1) is a key regulator of the differentiation of transfer cells. Supplemental Figure 1. Expression analyses
More informationSequence Analysis Lab Protocol
Sequence Analysis Lab Protocol You will need this handout of instructions The sequence of your plasmid from the ABI The Accession number for Lambda DNA J02459 The Accession number for puc 18 is L09136
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationApplications and Uses. (adapted from Roche RealTime PCR Application Manual)
What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10163 Supplementary Table 1 Efficiency of vector construction. Process wells recovered efficiency (%) Recombineering* 480 461 96 Intermediate plasmids 461 381 83 Recombineering efficiency
More informationSupporting Information
Supporting Information Yuan et al. 10.1073/pnas.0906869106 Fig. S1. Heat map showing that Populus ICS is coregulated with orthologs of Arabidopsis genes involved in PhQ biosynthesis and PSI function, but
More informationIntroduction to Molecular Biology
Introduction to Molecular Biology Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 2-1- Important points to remember We will study: Problems from bioinformatics. Algorithms used to solve
More informationChapter 4: How Cells Work
Chapter 4: How Cells Work David Shonnard Department of Chemical Engineering 1 Presentation Outline: l l l l l Introduction : Central Dogma DNA Replication: Preserving and Propagating DNA Transcription:
More informationSupplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with
Supplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with transcription buffer with or without a high salt concentration
More informationWhat Are the Chemical Structures and Functions of Nucleic Acids?
THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationNAME TA SEC Problem Set 4 FRIDAY October 15, Answers to this problem set must be inserted into the box outside
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 4 FRIDAY October 15,
More informationMolecular Cloning. Joseph Sambrook. David W. Russell A LABORATORY MANUAL COLD SPRING HARBOR LABORATORY PRESS VOLUME.
VOLUME Molecular Cloning A LABORATORY MANUAL THIRD EDITION www.molecularcloning.com Joseph Sambrook PETER MACCALLUM CANCER INSTITUTE AND THE UNIVERSITY OF MELBOURNE, AUSTRALIA David W. Russell UNIVERSITY
More informationFigure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.
Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out
More informationBio Rad PCR Song Lyrics
Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.
More informationRapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours
Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/35 *AP is a registered trademark of the College Board, which does not
More informationContents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...
Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result
More informationA 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells
Plant Cell, Tissue and Organ Culture (PCTOC) A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells Anna Týcová a,b, Rajen J. J. Piernikarczyk c, Michael
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationMicrobial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B
Microbial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm Overview of Last Lecture Taxonomy (three
More informationGaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo
Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Rampyari Raja Walia and Bakhos A. Tannous 1 2 1 Pluristem Innovations, 1453
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationEnhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
More informationChapter 9 Genetic Engineering
Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation
More information7 Gene Isolation and Analysis of Multiple
Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple
More informationa Award Number: W81XWH TITLE:
AD Award Number: W81XWH-04-1-0138 TITLE: Imaging Metastatic Prostate Cancer After Genetic Manipulation of Transcriptional Memory Regulators EZH2 and EED PRINCIPAL INVESTIGATOR: Lily Wu, M.D., Ph.D. CONTRACTING
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationQuantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
More information