Supplementary Figure S1
|
|
- Audra Brooks
- 6 years ago
- Views:
Transcription
1 Supplementary Figure S1 Luciferase ctivity (%) HeLa E2 OHT Figure S1. SENP2 represses estradiol-dependent transcriptional activity in HeLa cells. HeLa cells were transiently transfected with 5 ng prl-cmv-renilla as an internal control, 2 ng psg5-erα and5ngel+reportervectortogetherwith increasing amounts of expression vector. Cells were treated with vehicle (), estradiol (1-8 M) or OHT (1-8 M) for 16 h. Luciferase values were normalized for transfection efficiency with an internal renilla luciferase control, and expressed as a percentage of the activity obtained with cells only transfected with the reporter gene and treated with vehicle. The figure corresponds to a single assay representative of at least three independent experiments.
2 Supplementary Figure S2 ERα (ESR1) Relative mrn levels E2 E2 E2 ERα GFP ctin Figure S2 : SENP2 does not affect ERα expression. MCF7 cells were transiently transfected with either or expression vectors. Cells were treated for 16 h with vehicle () or estradiol (1-8 M), 24 h after transfection. () mrn extracts were subjected to real time PCR assays, using a ERα probe. Values are expressed as relative units and are plotted as the mean ± SD of three independent experiments. () Whole-cell lysates were then subjected to Western blotting analysis with the anti-gfp, the anti-er or the anti-ctin antibodies.
3 Supplementary Figure S ERβ E PR R C R D ERRγ Luciferase ctivity (%) R1881 Luciferase ctivity (%) Figure S3. SENP2 differentially modulates nuclear receptors-dependent transcriptional activity. HeLa cells were transiently transfected with expression vector, 5 ng of prl-cmv-renilla as an internal control, 2 ng of psg5-erβ and5ngofel+reporter vector (), 2 ng of psg5-pr and 5 ng of pfc31 reporter plasmid (), 2 ng of pcmv-r and5ngofpfc31reporterplasmid(c)or2ngofpsg5-errγ and5ngofel+reporter plasmid (D). Cells were treated with vehicle (), E2 (1-8 M) (), R52 (1-8 M) () or R1881 (1-8 M) (C) for 16 h. Luciferase values were normalized for transfection efficiency with an internal renilla luciferase control, and expressed as a percentage of the activity obtained with cells only transfected with the reporter gene. The figure corresponds to a single assay representative of at least three independent experiments.
4 Supplementary Figure S SENP2 Relative mrn levels ps2 (TFF1) E2 25 PR (PGR) Relative mrn levels Relative mrn levels Relative mrn levels Cyclin D1 (CCND1) * Relative mrn levels Cathepsin D (CTSD)
5 Supplementary Figure S4 C pm-senp2 (ng) SiCtrl SiHDC pm-n8 (ng) SiCtrl SiHDC3 Figure S4. SENP2 represses estradiol-dependent transcriptional activity in T47D cells.. T47D cells were transiently transfected with 15ng of, 5 ng of prl-cmv-renilla as an internal control and 5 ng of EL+ reporter vector. Cells were treated with vehicle () or E2 (1-8 M) for 16 hours. Luciferase values were normalized for transfection efficiency with an internal renilla luciferase control, and expressed as a percentage of the activity obtained with -transfected cells treated with vehicle. The figure is expressed from a single assay representative of at least three independent experiments.. T47D cells were transiently transfected with either the or the espression vector and treated with vehicle () or estradiol (E2 1-8 M). mrn extracts were subjected to real-time PCRassays with primers specific to SENP2, ps2, PR, cyclin D1 and cathepsin D. C. T47D cells were first transfected with 7 pmol sictrl or sihdc3 as indicated and then with 5 ng prl- CMV-renilla and 25 ng L8G5 reporter plasmids, 12.5 ng LexVP16 and 15ng pm-senp2 as indicated. Luciferase values are expressed as percentages of the activity in the presence of sictrl.values are expressed in relative units ans plotted as means ± SD of three independant experiments. Student s t test was used for statistical analysis: *p<.1 and p<.1.
6 Supplementary Figure S5 SENP2 R+/M- ERα R+/M- SENP2 R+/G- HDC3 R+/G- C SENP2 - actin D shctrl shsenp shctrl shsenp2 Dots per cell SENP2 SENP2 Figure S5. In situ proximity ligation assay control experiments.. Each primary antibody against SENP2 and ER was incubated with anti-rabbit PLUS probe and anti-mouse MINUS probe showing no background signal between the two probes and each primary antibody.. Each primary antibody against SENP2 and HDC3 was incubated with anti-rabbit PLUS probe and anti-goat MINUS probe showing no background signal between the two probes and each primary antibody. C. SENP2 rabbit primary antibody and actin mouse primary antibody showed no specific interaction between actin and SENP2. The corresponding probes of anti-rabbit PLUS and anti-mouse MINUS were used in the assay. D. SENP2 expression level was downregulated in shsenp2 MCF7 cells as shown by in situ proximity ligation assay using SENP2 rabbit primary antibody recognized by anti-rabbit PLUS and MINUS probes.
7 Supplementary Figure S6 SENP2 wt (C466S) (W375) ER SUMO1-ER ER SUMO1 GFP SENP2 Input GST SUMO1 wt 35 S SENP2 (C466S) (W375) Figure S6. Characterization of SENP2 catalytic mutants () ERα desumoylation assay. COS7 cells were transfected with 1 µg of expression vector encoding ER, His-SUMO1, Flag-PIS1 and increasing amounts (,5 to 2 µg) of expression vectors encoding or catalytically inactive mutants - SENP2(C466S) and (W375) as indicated. Cells were treated for 16 h with E2 (1-7 M), 24h after transfection. Transfected cells were lysed in the presence of NEM and immunoblotted with the anti- ER monoclonal antibody 1C6 (top), the anti-sumo1 antibody (33-24) (middle) or the anti-gfp antibody (bottom). () Interaction between SENP2 catalytic mutants and SUMO1. GST pull-down assays were carried out using bacterially expressed GST and GST-SUMO1 and 35 S-labeled SENP2, SENP2(C466S) and SENP2(W375). Input represents 1% of the material used for each assay.
8 Supplementary Figure S7 35 E Figure S7. SENP2 represses estradiol-dependent transcriptional activity of non sumoylated ER. HeLa cells were transiently transfected with 5 ng prl-cmvrenilla as an internal control, 2 ng psg5-erα(kv) and 5 ng EL+ reporter vector together with increasing amounts of expression vector. Cells were treated with vehicle () or estradiol (1-8 M) for 16 h. Luciferase values were normalized for transfection efficiency with an internal renilla luciferase control, and expressed as a percentage of the activity obtained with cells only transfected with the reporter gene and treated with vehicle. The figure corresponds to a single assay representative of at least three independent experiments.
9 Supplementary Figure S8 mrn expression (%) sirn Ctrl * HDC3 C * * SiCtrl SiHDC * SiCtrl SiHDC3 * * pm-senp2 pm-n8 Figure S8. HDC3 mediates SENP2 intrinsic repression. () MCF7 cells were transfected with either 7 pmol sictrl or sihdc3. Total RN was extracted 48 h after transfection and 2 µg submitted to reverse transcription. The qpcr was performed with primers specific to HDC3 sequence and data are expressed as the percentage of HDC3 mrn in the presence of sictrl. () MCF7 cells were first transfected with 7 pmol either sictrl or sihdc3 as indicated on day 1 and then with 5 ng prl-cmv-renilla and 25 ng L8G5 reporter plasmids, 12.5 ng LexVP16 and increasing concentration of SENP2-fused Gal4DD expression plasmids on day 2. Luciferase values were expressed as the percentage of activity in the absence of transfected Gal4DD-SENP2 vector. (C). MCF7 cells were transfected as described in except Gal4DD- N8 vectors replaced Gal4DD-SENP2 vectors. Luciferase values were expressed as the percentage of activity in the absence of transfected Gal4DD-N8 vector. Figures are representative of at least three independent experiments. Student t test was used for statistical analysis: *p <.1, p <.1 and *p <.5.
10 Supplementary Figure S9 Proliferation (%) MCF7 shctrl shsenp2 Proliferation (%) MCF7 (W375) ( N8) Figure S9. SENP2 affects MCF7 cell proliferation. Proliferation of MCF7 cells stably transfected or not with shctrl, shsenp2,,, (W375) or (ΔN8) was measured over 6 days, under treatment. Changes in impedance on the E-plate (Roche) were displayed as a cell index value (CI). CI values of quadruplicates were plotted and normalized to the last value before addition of. Relative proliferation values were expressed as a percentage of the normalized CI obtained at day (D). Figures are representative of at least three independent experiments.
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated
More informationTable I. Primers used in quantitative real-time PCR for detecting gene expressions in mouse liver tissues
Table I. Primers used in quantitative real-time PCR for detecting gene expressions in mouse liver tissues Gene name Forward primer 5' to 3' Gene name Reverse primer 5' to 3' CC_F TGCCCTGTTGGGGTTG CC_R
More informationSupplementary Information
Supplementary Information MLL histone methylases regulate expression of HDLR- in presence of estrogen and control plasma cholesterol in vivo Khairul I. Ansari 1, Sahba Kasiri 1, Imran Hussain 1, Samara
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationTranscriptional Repression of Estrogen Receptor Signaling by SENP2 in Breast Cancer Cells
ORIGINAL RESEARCH Transcriptional Repression of Estrogen Receptor Signaling by in Breast Cancer Cells Thiziri Nait Achour, Stéphanie Sentis, Catherine Teyssier, Amandine Philippat, Annick Lucas, Laura
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More information- NaCr. + NaCr. α H3K4me2 α H3K4me3 α H3K9me3 α H3K27me3 α H3K36me3 H3 H2A-2B H4 H3 H2A-2B H4 H3 H2A-2B H4. α Kcr. (rabbit) α Kac.
+ NaCr NaCr + NaCr NaCr Peptides 10ng 50ng 250ng K α Pan (mouse) Pan (mouse) 10ng 50ng 250ng α Pan (rabbit) C 10ng 50ng 250ng α Pan (mouse) 0 1.25 2.5 5 10 20 40 (mm) NaCr 24h α Pan (rabbit) α K4me2 α
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified
More informationX2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP
FRET efficiency.7.6..4.3.2 X2-C/X1-Y X2-C/VCAM-Y.1 1 2 3 Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently
More informationSupplementary Information
Supplementary Information promotes cancer cell invasion and proliferation by receptor-mediated endocytosis-dependent and -independent mechanisms, respectively Kensaku Shojima, Akira Sato, Hideaki Hanaki,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary figures Supplementary Figure 1: Suv39h1, but not Suv39h2, promotes HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationOnline Supplementary Information
Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan
More informationTranslation of HTT mrna with expanded CAG repeats is regulated by
Supplementary Information Translation of HTT mrna with expanded CAG repeats is regulated by the MID1-PP2A protein complex Sybille Krauß 1,*, Nadine Griesche 1, Ewa Jastrzebska 2,3, Changwei Chen 4, Désiree
More informationKhaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression
Khaled_Fig. S Variance from mean mrna expression.8 2 MITF.6 TYROSINASE.4 R²=.73.2.8.6.4.2.8.6.4.2.8.6.4.2 MALME3M SKMEL28 UACC257 MITF PDE4D R²=.63 4.5 5 MITF 3.5 4 PDE4B 2.5 3 R²=.2.5 2.5.8.6.4.2.8.6.4.2
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationSupporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
More informationIKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
More informationSupplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells
Molecular Cell, Volume 68 Supplemental Information Mitophagy Controls the Activities of Tumor Suppressor to Regulate Hepatic Cancer Stem Cells Kai Liu, Jiyoung Lee, Ja Yeon Kim, Linya Wang, Yongjun Tian,
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
More informationSupplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling
Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling development. a. Exogenous BR application overcomes the hypersensitivity of bzr1-1d seedlings to ABA. Seed germination
More informationSupplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1
Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationNature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
More informationMaterials and methods
EMBOJ-25-6235, revised version SUPPLEMENTARY INFORMATION Materials and methods Plasmid constructions pbt-har NTD 1556 (har amino acids 1556 fused to λci) was constructed by PCR with the following primers
More informationGFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More informationSupplemental Materials and Methods
Supplemental Materials and Methods Antibodies: Anti-SRF (cat# Sc-335) and anti-igf1r (sc-712) (Santa Cruz Biotech), and anti- ADAM-10 (14-6211) were from e-bioscience, anti-ku70 (cat# MS-329-P) (Labvision),
More informationSUPPLEMENTARY ONLINE MATERIAL
SUPPLEMENTARY ONLINE MATERIAL The SUMO protease SENP7 is a critical component to ensure HP1 enrichment at pericentric heterochromatin Christèle Maison*, Kelly Romeo*, Delphine Bailly, Marion Dubarry, Jean-Pierre
More informationSupplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
More informationSupplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
More informationSupplementary Information
Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative
More informationSupplementary Figure 1: MYCER protein expressed from the transgene can enhance
Relative luciferase activity Relative luciferase activity MYC is a critical target FBXW7 MYC Supplementary is a critical Figures target 1-7. FBXW7 Supplementary Material A E-box sequences 1 2 3 4 5 6 HSV-TK
More informationSupplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr
Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then
More informationSupplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationNTM486-04, NTM174-04,
Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.
More informationColeman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
More informationTable S1. Primers used in RT-PCR studies (all in 5 to 3 direction)
Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction) Epo Fw CTGTATCATGGACCACCTCGG Epo Rw TGAAGCACAGAAGCTCTTCGG Jak2 Fw ATCTGACCTTTCCATCTGGGG Jak2 Rw TGGTTGGGTGGATACCAGATC Stat5A Fw TTACTGAAGATCAAGCTGGGG
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationPIAS Proteins Modulate Transcription Factors by Functioning as SUMO-1 Ligases
MOLECULAR AND CELLULAR BIOLOGY, July 2002, p. 5222 5234 Vol. 22, No. 14 0270-7306/02/$04.00 0 DOI: 10.1128/MCB.22.14.5222 5234.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved.
More informationSupplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17
Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,
More informationToll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila
Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental
More informationHossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
More informationSupplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina
More informationof signal transduction pathways?
CELL BIOLOGY Signal Transduction + How do you study activation of signal transduction pathways? + IDENTIFICATION OF PATHWAY-SPECIFIC TRANSCRIPTION ACTIVATION + EASIER, FASTER THAN BLOTTING OR GEL-SHIFT
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationSupplementary Figure S1
Supplementary Figure S1 Figure S1. CENP- FP constructs target to centromeres irrespective of site of tagging. FP- CENP and CENP- FP constructs were transfected into U2OS cells and counterstained with anti-
More informationJournal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
More informationHeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid
SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Design and sequence of system 1 for targeted demethylation.
Supplementary Figure 1 Design and sequence of system 1 for targeted demethylation. (a) Design of system 1 for targeted demethylation. TET1CD was fused to a catalytic inactive Cas9 nuclease (dcas9) and
More informationJae Myoung Suh, Daniel Zeve, Renee McKay, Jin Seo, Zack Salo, Robert Li, Michael Wang, and Jonathan M. Graff
Cell Metabolism, Volume 6 Supplemental Data Adipose Is a Conserved, Dosage-Sensitive Antiobesity Gene Jae Myoung Suh, Daniel Zeve, Renee McKay, Jin Seo, Zack Salo, Robert Li, Michael Wang, and Jonathan
More informationSOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency
Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko
More informationSupplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
More informationpgbkt7 Anti- Myc AH109 strain (KDa) 50
pgbkt7 (KDa) 50 37 Anti- Myc AH109 strain Supplementary Figure 1. Protein expression of CRN and TDR in yeast. To analyse the protein expression of CRNKD and TDRKD, total proteins extracted from yeast culture
More informationFigure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana.
SUPPLEMENTARY FIGURES Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. YFP:, :CFP, HA: and (A) and HA, CFP and YFPtagged and AVR1-CO39 (B) were expressed
More informationDescription of Supplementary Files. File name: Supplementary Information Description: Supplementary figures and supplementary tables.
Description of Supplementary Files File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Supplementary Data 1 Description: Differential expression
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationsupplementary information
DOI: 10.1038/ncb2017 Figure S1 53BP1 sirna results in a heterochromatic DSB repair defect. Panel A: NIH3T3 cells were transfected with murine 53BP1 sirna. 48 hrs later, cells were irradiated with 3 Gy
More informationIdentification of a Family of Mastermind-Like Transcriptional Coactivators for Mammalian Notch Receptors
MOLECULAR AND CELLULAR BIOLOGY, Nov. 2002, p. 7688 7700 Vol. 22, No. 21 0270-7306/02/$04.00 0 DOI: 10.1128/MCB.22.21.7688 7700.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved.
More information42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)
SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca
More informationFamilial Cancer Predisposition Syndromes. Retinoblastoma (RB) 13q14 Familial Adenomatous Polyposis (APC) 5q21
Familial Cancer Predisposition Syndromes Retinoblastoma (RB) 13q14 Familial Adenomatous Polyposis (APC) 5q21 Retinoblastoma Eye Retinal Epithelium develops in the first five years of life Retinoblastoma
More informationSupplemental Data. Lee et al. Plant Cell. (2010) /tpc Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2.
Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2. (A) Protein structures of DWA1 and DWA2. WD40 region was determined based on the NCBI conserved domain databases (B, C) Schematic representation
More informationSupplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2
Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,
More informationSupplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
More informationCRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611
Data Sheet CRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611 Background The main role of the camp response element, or CRE, is mediating the effects of Protein Kinase A (PKA)
More informationSupplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with
Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated
More information(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.
SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/323/5910/124/dc1 Supporting Online Material for Regulation of Neuronal Survival Factor MEF2D by Chaperone-Mediated Autophagy Qian Yang, Hua She, Marla Gearing, Emanuela
More informationT1: Pure spongia-13(16),14-dien-19-oic acid (T1) (514 mg) was obtained from a Spongia sp.
Supplementary Materials and Methods Synthesis of spongian diterpenoids T1: Pure spongia-13(16),14-dien-19-oic acid (T1) (514 mg) was obtained from a Spongia sp. (sample # 47612) as follows. 45 g dry weight
More informationJung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
More informationab G alpha i Activation Assay Kit
ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version
More informationSuperPrep Cell Lysis & RT Kit for qpcr
SuperPrep Cell Lysis & RT Kit for qpcr 1402 F1267K SuperPrep Cell Lysis & RT Kit for qpcr SCQ-101 100 reactions Store at -20 C SuperPrep Cell Lysis Kit for qpcr SCQ-201 100 preparations Store at -20 C
More informationSupplemental Information
Supplemental Information Genetic and Functional Studies Implicate HIF1α as a 14q Kidney Cancer Suppressor Gene Chuan Shen, Rameen Beroukhim, Steven E. Schumacher, Jing Zhou, Michelle Chang, Sabina Signoretti,
More informationSupplementary Figures and Legends
Supplementary Figures and Legends Figure S1. Tests of the optical alignment and focal properties of the confocal microscope. (A) Images of the optical cross-section of fluorescent microspheres differing
More informationRevision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines
Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Further information can be found at: http://stke.sciencemag.org/sites/default/files/researcharticlerevmsinstructions_0.pdf.
More informationChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System
ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System Liyan Pang, Ph.D. Application Scientist 1 Topics to be Covered Introduction What is ChIP-qPCR? Challenges Facing Biological
More informationSupplementary information
Supplementary information Inhibition of mitochondrial dysfunction and neuronal cell death in models of Huntington s disease and in HD patients-derived cells Xing Guo 1,#, Marie-Helene Disatnik 3,#, Marie
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1.
Supplementary Figure 1. Characterization and high expression of Lnc-β-Catm in liver CSCs. (a) Heatmap of differently expressed lncrnas in Liver CSCs (CD13 + CD133 + ) and non-cscs (CD13 - CD133 - ) according
More informationHCT116 SW48 Nutlin: p53
Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
More informationInt. J. Mol. Sci. 2016, 17, 1259; doi: /ijms
S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,
More informationTE5 KYSE510 TE7 KYSE70 KYSE140
TE5 KYSE5 TT KYSE7 KYSE4 Supplementary Figure. Hockey stick plots showing input normalized, rank ordered H3K7ac signals for the candidate SE-associated lncrnas in this study. Rpm Rpm Rpm Chip-seq H3K7ac
More informationJunhong Han, Yu-ichi Tsukada, Eiji Hara, Naomi Kitamura, and Toshiaki Tanaka
THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 280, No. 36, Issue of September 9, pp. 31548 31556, 2005 2005 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Hepatocyte
More informationPeter Dy, Weihuan Wang, Pallavi Bhattaram, Qiuqing Wang, Lai Wang, R. Tracy Ballock, and Véronique Lefebvre
Developmental Cell, Volume 22 Supplemental Information Sox9 Directs Hypertrophic Maturation and Blocks Osteoblast Differentiation of Growth Plate Chondrocytes Peter Dy, Weihuan Wang, Pallavi Bhattaram,
More informationGibco Life Technologies, Frederick, MD. Rockford, IL. R&D Systems, Minneapolis, 6057-NG-025. R&D Systems, Minneapolis,
Supplementary Table 1. Reagents Reagents were made up as concentrated stock and aliquots stored at -20 or -80. Reagent Source Catalog Number Recombinant Human IL1 Receptor PeproTech, Rocky Hill, NJ 200-01RA
More informationSupplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationCIGNAL REPORTER ASSAYS & ARRAYS
CIGNAL REPORTER ASSAYS & ARRAYS TM Cell-Based for Measuring Activity Cancer Cell Cycle Cytokines / Inflammation Neuroscience Stem Cell / Development Toxicology Focus on your CIGNAL TM REPORTER ASSAY SYSTEM
More informationProduct: Arrest-In TM Transfection Reagent for RNAi
Product: Arrest-In TM Transfection Reagent for RNAi Catalog #: ATR1740, ATR1741, ATR1742, ATR1743 Product Description Arrest-In transfection reagent is a proprietary polymeric formulation, developed and
More informationFigure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9
Supplementary Information Ultrasensitive antibody detection by agglutination-pcr (ADAP) Cheng-ting Tsai 1 *, Peter V. Robinson 1 *, Carole A. Spencer 2 and Carolyn R. Bertozzi 3,4ǂ Department of 1 Chemistry,
More informationSupplemental Data. Steiner et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. SPY does not interact with free GST. Invitro pull-down assay using E. coli-expressed MBP-SPY and GST, GST-TCP14 and GST-TCP15. MBP-SPY was used as bait and incubated with equal amount
More informationSupporting Information
Supporting Information Horie et al. 10.1073/pnas.1008499107 SI Materials and Methods ell ulture and Reagents. THP-1 cells were obtained from the American Type ell ollection. THP-1 cells were transformed
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More information