Supplementary Information for. hnrnp Q mediates a phase-dependent translation-coupled mrna decay of mouse. Period3.
|
|
|
- Homer Griffin Walsh
- 5 years ago
- Views:
Transcription
1 Supplementary Information for hnrnp Q mediates a phase-dependent translation-coupled mrna decay of mouse Period3. Do-Yeon Kim, Eunyee Kwak, Sung-Hoon Kim, Kyung-Ha Lee, Kyung-Chul Woo and Kyong-Tai Kim Supplementary Information contains Supplementary Methods Supplementary Figures: Figure S1-4 and their legends Supplementary Methods RNA affinity purification Streptavidin-biotin RNA-affinity purification of mper3 5 UTR-binding proteins was performed as described previously (1). In brief, whole extracts prepared from NIH3T3 fibroblasts were incubated with or without biotinylated mper3 5 UTR, and subjected to streptavidin resin adsorption. For the competition assay, 5-fold molar excess of competitor was added, prior to the mixing streptavidin resin. Resin-bound proteins were fractionated by SDS-PAGE, and analyzed by immunoblotting.
2 Supplementary References 1. Grosset, C., Chen, C.Y., Xu, N., Sonenberg, N., Jacquemin-Sablon, H. and Shyu, A.B. () A mechanism for translationally coupled mrna turnover: interaction between the poly(a) tail and a c-fos RNA coding determinant via a protein complex. Cell, 13, 29-.
3 Supplementary Figure. 1 Per3 TBP mrna remaining (%) ActD ActD mrna re emaining (%) ActD ActD Supplementary Fig 1. The efficiency of Actinomycin D was not altered by the circadian phase. To confirm whether the transcriptional shut-off by Actinomycin D is affected by circadian phase, other time points were selected. For the decay kinetics of the rising phase, transcription was blocked after h of dexamethasone treatment, instead of 18h. For the decay kinetics of the declining phase, transcription was blocked after 28 h of dexamethasone treatment, instead of 3h.
4 Supplementary Figure. 2 Biotinylation Per Competitor + input Bead only hnrnp Q GAPDH Ponceau S Supplementary Fig 2. Confirmation of hnrnp Q as a mper3 5 UTR binding protein. Supplementary Fig 2. Confirmation of hnrnp Q as a mper3 5 UTR binding protein. To confirm whether hnrnp Q is associated with 5 UTR of mper3, mper3 5 UTR binding proteins were purified from NIH3T3 whole cell extracts, using biotin-labeled mper3 5 UTR mrna. After fractionation by SDS-PAGE, immunoblot analysis was performed with hnrnp Q and GAPDH antibody.
5 A 1 mper3 Supplementary Figure. 3 B 1 mtbp mrna remaining (% %) sicon+gfp sihnrnp Q+GFP sihnrnp Q+GFP-hnRNP Q mr RNA remaining (%) sicon+gfp sihnrnp Q+GFP sihnrnp Q+GFP-hnRNP Q C GFP hnrnp Q (endogenous) GAPDH Supplementary Fig 3. mrna decay kinetics of mper3 was rescued by exogenous hnrnp Q expression. (A) After transfection with either sicon or sihnrnp Q with GFP mock or GFP tagged hnrnp Q, the decay kinetics of endogenous mper3 was analyzed. Cells were treated with nm Dexamethasone, 12 h after transfection. 9hr post synchronization, 5 µg/ml actinomycin D was added. The endogenous mper3 mrna levels were determined using quantitative real-time RT- PCR and normalized to RPL32 mrna levels at the indicated time points. Initial levels of mper3 mrna in each cells were arbitrarily set as. (B) Decay kinetics of TBP mrna was analyzed for negative control. (C) Western blot confirmed endogenous hnrnp Q downregulation and exogenous hnrnp Q expression.
6 Supplementary Figure. 4 A Per3 uorf translation efficiency B 1 reporter mrna stability mrna re emaining (%) Per /NAT Per3 uaug-1 mut/nat Per3 uaug-2 mut/nat Per3 uaug-3 mut/nat Per3 uaug-4 mut/nat Supplementary Fig 4. Upstream AUG mutation does not affect translation regulation and mrna stability. (A) Translation initiation controlled by wild-type or upstream AUG mutant forms of mper3 5 - UTR is analyzed..5µg of reporter plasmid was transiently transfected into NIH3T3 cell lines and translation efficiency of AANAT reporter was measured by the AANAT assay. For transfection control,.1µg of beta-galactosidase plasmid was cotransfected. The AANAT assay and beta-galactosidase assay were performed at 24h after transfection. Per3 uaug- x mut/nats are single nucleotide mutant constructs of Per /NAT (xth uaug was mutated to AAG). (B) After co-transfection of.5µg of AANAT reporters,, the decay kinetics of the reporter mrna was analyzed. Cells were treated with 5 µg/ml actinomycin D, at 18 h after transfection. Each mrna levels was determined by quantitative real-time RT-PCR and normalized to RPL32 mrna levels.
hnrnp D/AUF1 Rabbit IgG hnrnp M
Mouse IgG Goat IgG Rabbit IgG Mouse IgG hnrnp F Goat IgG Mouse IgG Kb 6 4 3 2 15 5 Supplementary Figure S1. In vivo binding of TERRA-bound RBPs to target RNAs. Immunoprecipitation (IP) assay using 3 mg
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
Supplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde
Supplemental Material Igreja and Izaurralde 1 CUP promotes deadenylation and inhibits decapping of mrna targets Catia Igreja and Elisa Izaurralde Supplemental Materials and methods Functional assays and
HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
hnrnp C promotes APP translation by competing with FMRP for APP mrna recruitment to P bodies
hnrnp C promotes APP translation by competing with for APP mrna recruitment to P bodies Eun Kyung Lee 1, Hyeon Ho Kim 1, Yuki Kuwano 1, Kotb Abdelmohsen 1, Subramanya Srikantan 1, Sarah S. Subaran 2, Marc
Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary figures Supplementary Figure 1: Suv39h1, but not Suv39h2, promotes HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we
Hossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of
Supplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1
Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded
Supplementary Fig. 1
a FL (1-2266) NL (1-1190) CL (1191-2266) HA-ICE1: - HA-ICE1: - - - FLAG-ICE2: + + + + FLAG-ELL: + + + + + + IP: anti-ha FLAG-ICE2 HA-ICE1-FL HA-ICE1-NL HA-ICE1-CL FLAG-ICE2 b IP: anti-ha FL (1-2266) NL
Sarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
Coleman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3363 Supplementary Figure 1 Several WNTs bind to the extracellular domains of PKD1. (a) HEK293T cells were co-transfected with indicated plasmids. Flag-tagged proteins were immunoprecipiated
Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
CRISPR RNA-guided activation of endogenous human genes
CRISPR RNA-guided activation of endogenous human genes Morgan L Maeder, Samantha J Linder, Vincent M Cascio, Yanfang Fu, Quan H Ho, J Keith Joung Supplementary Figure 1 Comparison of VEGF activation induced
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Moutin et al., http://www.jcb.org/cgi/content/full/jcb.201110101/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Tagged Homer1a and Homer are functional and display different
Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.
Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292
SUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
supplementary information
DOI: 10.1038/ncb2172 Figure S1 p53 regulates cellular NADPH and lipid levels via inhibition of G6PD. (a) U2OS cells stably expressing p53 shrna or a control shrna were transfected with control sirna or
Supplementary methods
Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into
supplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
SUPPLEMENTARY MATERIALS
SUPPLEMENTARY MATERIALS Supplementary Table S1: List of primers used for ChIP analysis and Oligo-pull-down assay. Genes Sequence mppargc1a FW 5 -GCGAGGTTTCTGCTTAGTCA-3 (-2317) RV 5 -ACAATGACTAAGCAGAAACCTCG-3
UTR Reporter Vectors and Viruses
UTR Reporter Vectors and Viruses 3 UTR, 5 UTR, Promoter Reporter (Version 1) Applied Biological Materials Inc. #1-3671 Viking Way Richmond, BC V6V 2J5 Canada Notice to Purchaser All abm products are for
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
Supplementary Figures and legend. Heparin affinity purification of extracellular vesicles.
Supplementary Figures and legend Heparin affinity purification of extracellular vesicles. Leonora Balaj 1, Nadia A. Atai 1,2, Weilin Chen 1, Dakai Mu 1, Bakhos A. Tannous 1, Xandra O. Breakefield 1, Johan
Supplementary Figures and Figure legends
Supplementary Figures and Figure legends 3 Supplementary Figure 1. Conditional targeting construct for the murine Satb1 locus with a modified FLEX switch. Schematic of the wild type Satb1 locus; the conditional
TITLE: Restoration of Wild-Type Activity to Mutant p53 in Prostate Cancer: A Novel Therapeutic Approach
AD Award Number: W81XWH-05-1-0109 TITLE: Restoration of Wild-Type Activity to Mutant p53 in Prostate Cancer: A Novel Therapeutic Approach PRINCIPAL INVESTIGATOR: James Manfredi, Ph.D. CONTRACTING ORGANIZATION:
Supplementary
Supplementary information Supplementary Material and Methods Plasmid construction The transposable element vectors for inducible expression of RFP-FUS wt and EGFP-FUS R521C and EGFP-FUS P525L were derived
Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
Table I. Primers used in quantitative real-time PCR for detecting gene expressions in mouse liver tissues
Table I. Primers used in quantitative real-time PCR for detecting gene expressions in mouse liver tissues Gene name Forward primer 5' to 3' Gene name Reverse primer 5' to 3' CC_F TGCCCTGTTGGGGTTG CC_R
(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
Supplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.
Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected
Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the
Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.
Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
Supplemental Table S1. RT-PCR primers used in this study
Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------
Technical tips Session 4
Technical tips Session 4 Biotinylation assay: Streptavidin is a small bacterial protein that binds with high affinity to the vitamin biotin. This streptavidin-biotin combination can be used to link molecules
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
Supplemental Figure Legends:
Supplemental Figure Legends: Fig S1. GFP-ABRO1 localization. U2OS cells were infected with retrovirus expressing GFP- ABRO1. The cells were fixed with 3.6% formaldehyde and stained with antibodies against
Supplementary information
Supplementary information Table of Content: Supplementary Results... 2 Supplementary Figure S1: Experimental validation of AP-MS results by coimmunprecipitation Western blot analysis.... 3 Supplementary
SUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3
SUPPLEMENTARY INFORMATION
doi:10.1038/nature15713 Supplementary Table 1. The DNAs used in this study D1 D2 D3 D4 D5 D6 D7 D8 D9 D10 12-bp FAM-18-bp biotinylated 26-bp s Biotin-free 26-bp s 58-bpDNA 58-bpDNA AT-rich 58-bpDNA CG-rich
Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17
Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,
Transcriptional Regulation (Gene Regulation)
Experimental Techniques in Biomedical Sciences 의생명과학실험기법 Transcriptional Regulation (Gene Regulation) 4/17/13 Jeong Hoon Kim (jeongkim@skku.edu) Department of Health Sciences and Technology, SKKU Graduate
Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids.
Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids. The cells were harvested 72 h after transfection. FLAG-tagged deubiquitinases
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter
Supplement Supporting Materials and Methods Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter were independently generated using a two-step PCR method. The Smad4 binding site
Engineering splicing factors with designed specificities
nature methods Engineering splicing factors with designed specificities Yang Wang, Cheom-Gil Cheong, Traci M Tanaka Hall & Zefeng Wang Supplementary figures and text: Supplementary Figure 1 Supplementary
Supplementary Information for. Regulation of Rev1 by the Fanconi Anemia Core Complex
Supplementary Information for Regulation of Rev1 by the Fanconi Anemia Core Complex Hyungjin Kim, Kailin Yang, Donniphat Dejsuphong, Alan D. D Andrea* *Corresponding Author: Alan D. D Andrea, M.D. Alan_dandrea@dfci.harvard.edu
The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and
SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11070 Supplementary Figure 1 Purification of FLAG-tagged proteins. a, Purification of FLAG-RNF12 by FLAG-affinity from nuclear extracts of wild-type (WT) and two FLAG- RNF12 transgenic
Gene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG
Supplemental Data EXPERIMENTAL PROCEDURES Plasmids and Antibodies- Full length cdna of INT11 or INT12 were cloned into ps- Flag-SBP vector respectively. Anti-RNA pol II (RPB1) was purchased from Santa
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom
Supplementary Information. A novel human endogenous retroviral protein inhibits cell-cell fusion. Supplementary Figures:
Supplementary Information A novel human endogenous retroviral protein inhibits cell-cell fusion Jun Sugimoto, Makiko Sugimoto, Helene Bernstein, Yoshihiro Jinno and Danny J. Schust Supplementary Figures:
mir-24-mediated down-regulation of H2AX suppresses DNA repair
Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn
ENCODE RBP Antibody Characterization Guidelines
ENCODE RBP Antibody Characterization Guidelines Approved on November 18, 2016 Background An integral part of the ENCODE Project is to characterize the antibodies used in the experiments. This document
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3209 Supplementary Figure 1 IR induces the association of FH with chromatin. a, U2OS cells synchronized by thymidine double block (2 mm) underwent no release (G1 phase) or release for 2
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
Supplementary Information
Supplementary Information Sam68 modulates the promoter specificity of NF-κB and mediates expression of CD25 in activated T cells Kai Fu 1, 6, Xin Sun 1, 6, Wenxin Zheng 1, 6, Eric M. Wier 1, Andrea Hodgson
This is the author's accepted version of the manuscript.
This is the author's accepted version of the manuscript. The definitive version is published in Nature Communications Online Edition: 2015/4/16 (Japan time), doi:10.1038/ncomms7780. The final version published
SUPPLEMENTAL FIGURES AND TABLES
SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2
Single-Molecule Imaging Reveals Dynamics of CREB Transcription Factor Bound to Its Target Sequence
Supplementary Information Single-Molecule Imaging Reveals Dynamics of CREB Transcription Factor Bound to Its Target Sequence Noriyuki Sugo, Masatoshi Morimatsu, Yoshiyuki Arai, Yoshinori Kousoku, Aya Ohkuni,
Legend for Supplemental Figures and Tables
Legend for Supplemental Figures and Tables Supplemental Fig. 1. Negative regulation of the CYP27B1 promoter in a ligand-dependent manner (A) OK-P cells were transfected with pcdna-trα, pcdna-trβ1 or pcdna3
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
Selected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
fibrils, however, oligomeric structures and amorphous protein aggregates were
Supplementary Figure 1: Effect of equimolar EGCG on αs and Aβ aggregate formation. A D B E αs C F Figure S1: (A-C) Analysis of EGCG treated αs (1 µm) aggregation reactions by EM. A 1:1 molar ratio of EGCG
A Repressor Complex Governs the Integration of
Developmental Cell 15 Supplemental Data A Repressor Complex Governs the Integration of Flowering Signals in Arabidopsis Dan Li, Chang Liu, Lisha Shen, Yang Wu, Hongyan Chen, Masumi Robertson, Chris A.
Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95
Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:
The Ups & Downs of Gene Expression:
The Ups & Downs of Gene Expression: Using Lipid-Based Transfection and RT-qPCR to Deliver Perfect Knockdown and Achieve Optimal Expression Results Hilary Srere, Ph.D. Topics What is RNAi? Methods of Delivery
Why does this matter?
Background Why does this matter? Better understanding of how the nucleosome affects transcription Important for understanding the nucleosome s role in gene expression Treats each component and region of
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature05841 SUPPLEMENTARY INFORMATION www.nature.com/nature 1 www.nature.com/nature 2 www.nature.com/nature 3 www.nature.com/nature 4 a Hours of Development: eif-6(rnai): 4 wildtype 30 4 lin-4
Nature Structural & Molecular Biology: doi: /nsmb.3018
Supplementary Figure 1 Validation of genetic complementation assay in Bmal1 / Per2 Luc fibroblasts. (a) Only Bmal1, not Bmal2, rescues circadian rhythms from cells. Cells expressing various Bmal constructs
Phenotypic lentivirus screens to identify functional single domain antibodies
ARTICLE NUMBER: 16080 DOI: 10.1038/NMICROBIOL.2016.80 Phenotypic lentivirus screens to identify functional single domain antibodies Florian I. Schmidt, Leo Hanke, Benjamin Morin, Rebeccah Brewer, Vesna
A RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1
A H2AX DAPI H2AX DAPI Merge Cont sirna Figure S1: Accumulation of RRM1 at DNA damage sites (A) HeLa cells were subjected to in situ detergent extraction without IR irradiation, and immunostained with the
a. Increased active HPSE (50 kda) protein expression upon infection with multiple herpes viruses: bovine
Fold change vs uninfeced MOI 0.1 MOI 1 MOI 0.1 MOI 1 MOI 0.001 MOI 0.01 Fold change vs uninfected a 6 4 2 50 kda HPSE * ** * * BHV PRV HSV-2 333 ** * 0 - + + - + + - + + b 50 kda HPSE 3 2 ** *** mock inf
Supplementary information
Supplementary information The E3 ligase RNF8 regulates KU80 removal and NHEJ repair Lin Feng 1, Junjie Chen 1 1 Department of Experimental Radiation Oncology, The University of Texas M. D. Anderson Cancer
Supplementary information for: Mutant p53 gain-of-function induces epithelial-mesenchymal transition. through modulation of the mir-130b-zeb1 axis
Supplementary information for: Mutant p53 gain-of-function induces epithelial-mesenchymal transition through modulation of the mir-3b-zeb axis AUTHORS: Peixin Dong, Mihriban Karaayvaz, Nan Jia, Masanori
Different Upstream Activators Stimulate Transcription Through Distinct Coactivator Complexes
Supplemental Material for Different Upstream Activators Stimulate Transcription Through Distinct Coactivator Complexes Dong-ki Lee, Soyoun Kim, and John T. Lis Due to be published as a Research Communication
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-06-1-0323 TITLE: Checkpoint Functions of the BRCA1/BARD1 Tumor Suppressor PRINCIPAL INVESTIGATOR: Ami Modi CONTRACTING ORGANIZATION: Columbia University New York, NY 10032 REPORT
Isolation of the recombinant middle and head + middle modules.
Supplementary Figure 1 Isolation of the recombinant middle and head + middle modules. (a) Scheme illustrating the multi-step purification protocol for the reconstituted middle module. Extract from infected
SUPPLEMENTARY INFORMATION
DOI:.38/ncb327 a b Sequence coverage (%) 4 3 2 IP: -GFP isoform IP: GFP IP: -GFP IP: GFP Sequence coverage (%) 4 3 2 IP: -GFP IP: GFP 33 52 58 isoform 2 33 49 47 IP: Control IP: Peptide Sequence Start
Supplementary Figure 1. ips_3y+mir-302b. ips_3y+mir-372. ips_3y+mir-302b + mir-372. ips_4y. ips_4y+mir-302b. ips_4y + mir-372
Supplementary Figure 1 ips_3y+mir-32b ips_3y+ ips_3y+mir-32b + ips_4y ips_4y+mir-32b ips_4y + Nature Biotechnology: doi:1.138/nb.t.1862 TRA-1-6 DAPI Oct3/4 Supplementary Figure 1: ips cells derived from
b alternative classical none
Supplementary Figure. 1: Related to Figure.1 a d e b alternative classical none NIK P-IkBa Total IkBa Tubulin P52 (Lighter) P52 (Darker) RelB (Lighter) RelB (Darker) HDAC1 Control-Sh RelB-Sh NF-kB2-Sh
Description of Supplementary Files. File name: Supplementary Information Description: Supplementary figures and supplementary tables.
Description of Supplementary Files File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Supplementary Data 1 Description: Differential expression
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
Supplemental Table/Figure Legends
MiR-26a is required for skeletal muscle differentiation and regeneration in mice Bijan K. Dey, Jeffrey Gagan, Zhen Yan #, Anindya Dutta Supplemental Table/Figure Legends Suppl. Table 1: Effect of overexpression
Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells.
Supplementary Fig. 1 Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells. (a) FRTL-5 cells were treated with 1 mm dibutyryl camp for 24 h, and the lysates
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection
Post-translational modification
Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3562 In the format provided by the authors and unedited. Supplementary Figure 1 Glucose deficiency induced FH-ATF2 interaction. In b-m, immunoblotting or immunoprecipitation analyses were
[KCl] Heated. No SS III. No NE. unspliced spliced. b kda
![[KCl] Heated. No SS III. No NE. unspliced spliced. b kda](/thumbs/86/93796483.jpg "[KCl] Heated. No SS III. No NE. unspliced spliced. b kda")
rrna level a 1 MDQGYGGYGA WSAGPANTQG AYGTGVASWQ GYENYNYYGA QNTSVTTGAT YSYGPASWEA 61 AKANDGGLAA GAPAMHMASY GPEPCTDNSD SLIAKINQRL DMMSKEGGRG GSGGGGEGIQ 121 DRESSFRFQP FESYDSRPCL PEHNPYRPSY SYDYEFDLGS DRNGSFGGQY
Supplementary Figures 1-12
Supplementary Figures 1-12 Supplementary Figure 1. The specificity of anti-abi1 antibody. Total Proteins extracted from the wild type seedlings or abi1-3 null mutant seedlings were used for immunoblotting
Figure legends for supplement
Figure legends for supplement Supplemental Figure 1 Characterization of purified and recombinant proteins Relevant fractions related the final stage of the purification protocol(bingham et al., 1998; Toba
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
Supplementary information; Mungamuri et al., 2006
Supplementary information; Mungamuri et al., 6 Antibodies used for western blotting: The following antibodies were used for western blotting: antiser473 Akt (#4), antiakt (#97), antiser9 Gsk 3b (#9336),