Scikit-ribo reveals precise codon-level translational control by dissecting ribosome pausing and codon elongation

Size: px
Start display at page:

Download "Scikit-ribo reveals precise codon-level translational control by dissecting ribosome pausing and codon elongation"

Transcription

1 Scikit-ribo reveals precise codon-level translational control by dissecting ribosome pausing and codon elongation Han Fang October 26, 2016 Biological Data Science

2 The hidden treasure in genomics Replication Transcription Translation DNA RNA Protein RNA Polymerase Ribosome

3 The hidden treasure in genomics Replication Transcription Translation DNA RNA Protein RNA Polymerase Ribosome

4 What is ribosome profiling (Riboseq)? Ingolia et al. Science. (2009) Ingolia. Nat Rev Genet. (2014)

5 What is ribosome profiling (Riboseq)? Normal translation efficieny (TE) Ingolia et al. Science. (2009) Ingolia. Nat Rev Genet. (2014)

6 What is ribosome profiling (Riboseq)? Normal translation efficieny (TE) Less efficient translation More efficient translation Ingolia et al. Science. (2009) Ingolia. Nat Rev Genet. (2014)

7 Calculate translational efficiency (TE) Less efficient translation Normal translation efficieny (TE) More efficient translation log 2 (TE) < 0 log 2 (TE)=0 log 2 (TE) > 0 TE = Riboseq rpkm RNAseq rpkm

8 Hypothesis: TE distribution could be skewed by ribosome pausing events. Ribosome footprints without bias Ribosome footprints with pausing

9 Simulated S. cerevisiae data Null distribution

10 Simulated S. cerevisiae data - TE distribution are negatively-skewed by ribosome pausing events Null distribution With ribosome pausing sites Randomly imputed ribosome pausing sites to 20% of the genes

11 Ribosome pausing sites (peaks) finding by negative binomial mixture model Y P (X i i,µ i,k i,r i )= Y j i NB(X ij µ i,r i )+(1 i )NB(X ij k i µ i,r i ), Yifei Huang for gene i at position j, where k 5 H 0 : =1 H : =1 H 1 : 6= 1 Yes Bimodal distribution, i.e. potential pausing sites Posterior probability > cutoff No Yes Peak/Pausing sites Given a gene Likelihood ratio test Bonferroni adjusted p-value < 0.05 No Unimodal distribution, i.e. no pausing Not a pausing site

12 Ribosome pausing sites (peaks) finding by negative binomial mixture model Y P (X i i,µ i,k i,r i )= Y j i NB(X ij µ i,r i )+(1 i )NB(X ij k i µ i,r i ), Yifei Huang for gene i at position j, where k 5 H 0 : =1 H : =1 H 1 : 6= 1 Yes Bimodal distribution, i.e. potential pausing sites Posterior probability > cutoff No Yes Peak/Pausing sites Given a gene Likelihood ratio test Bonferroni adjusted p-value < 0.05 No Unimodal distribution, i.e. no pausing Not a pausing site # genes # genes (rpkm > 100) # genes with pausing # ribosome pausing sites identified

13 mrna with stronger secondary structure tend to have ribosome pausing events p-value< 2*10-16 Secondary structure score No Yes PARS scores obtained from Kerteszet al. Nature (2010)

14 mrna with stronger secondary structure tend to have ribosome pausing events p-value< 2*10-16 Secondary structure score PARS scores ribosome counts PARS_score position ribosome_pausing FALSE TRUE No Yes position PARS scores obtained from Kerteszet al. Nature (2010)

15 mrna with stronger secondary structure tend to have ribosome pausing events p-value< 2*10-16 Secondary structure score PARS scores ribosome counts PARS_score position ribosome_pausing FALSE TRUE No Yes position PARS scores obtained from Kerteszet al. Nature (2010)

16 Simplifying the generalized linear model (GLM) RNA count

17 Simplifying the generalized linear model (GLM) RNA count Secondary structure count

18 Simplifying the generalized linear model (GLM) RNA count Secondary structure count Dwell time (1/speed) count Translation count

19 Simplifying the generalized linear model (GLM) RNA count Secondary structure count Dwell time (1/speed) count Translation efficiency (TE) count

20 Joint inference of protein TE and codon dwell time using GLM, while accounting for secondary structure GLM for joint inference of TE and codon dwell time: Y ij NB(mean = µ ij,dispersion= ), for gene i, position j g(µ ij )= 0 + x i m + t i + c k + sx ij {z} {z} {z} {z } mrna TE codon secondary structure where g(.) is a log link function, µ ij = E(Y ij ), x i m is mrna abundance for gene i, i t is translational e ciency for gene i, k c is dwell time for codon k, sx ij is secondary structure e ect at position j for gene i.

21 Scikit-ribo perfectly reproduced relative codon dwell time from Weinberg et al

22 Scikit-ribo perfectly reproduced relative codon dwell time from Weinberg et al Rarest codons CGA CGG CCG

23 Significant correlation between trna abundance and codon elongation rates

24 GLM estimates vs. RPKM-based estimates reveals systematic bias in typical Riboseq analysis

25 GLM estimates vs. RPKM-based estimates reveals systematic bias in typical Riboseq analysis Highly structured mrna genes The rpkm based approach overestimated TE of highly structured mrna, while the rest of the mrna were slightly under-estimated, as hypothesized.

26 Accurate TE estimation supported by proportional synthesis for heterodimeric complexes in S. cerevisiae.

27 Summary Discussed: 1) Introduced scikit-ribo for joint analysis of Riboseq and RNAseq data. 2) Identified biases in Riboseq data due to ribosome pausing. 3) Corrected biases and revealed underlying biology 4) Joint inference of codon elongation rate and protein TE 5) Revealed precise translational control at codon level Ribosome A-site position predicition A-site codon localization Ribosome pausing site calling Translation efficiency inference

28 Acknowledgments Lyon Lab Max Doerfel Yiyang Wu Jonathan Crain Jason O Rawe Schatz Lab Fritz Sedlazeck Tyler Garvin James Gurtowski Maria Nattestad Srividya Ramakrishnan Gholson Lyon Michael Schatz CSHL JHU UCSF Rutgers Stony Brook University Yifei Huang Adam Siepel Noah Dukler Rachel Green Jonathan Weissman Joshua Dunn David Weinberg Premal Shah Rob Patro

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance

More information

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

More information

Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis

Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis Name: Date: Period: Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis ***Completing this study guide in its entirety will result in extra credit on the exam. You must show me the DAY OF the

More information

Ch Molecular Biology of the Gene

Ch Molecular Biology of the Gene Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it

More information

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

less sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput

less sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput Chapter 11: Gene Expression The availability of an annotated genome sequence enables massively parallel analysis of gene expression. The expression of all genes in an organism can be measured in one experiment.

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

7.2 Protein Synthesis. From DNA to Protein Animation

7.2 Protein Synthesis. From DNA to Protein Animation 7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)

More information

DNA Structure and Replication, and Virus Structure and Replication Test Review

DNA Structure and Replication, and Virus Structure and Replication Test Review DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks

More information

Gene Expression. Student:

Gene Expression. Student: Gene Expression Student: 1. A ribozyme is A. a section of the DNA that is expressed in the mrna. B. a self-splicing intron that acts like an enzyme. C. a complex made up of many ribosomes replicating the

More information

Hybrid Error Correction and De Novo Assembly with Oxford Nanopore

Hybrid Error Correction and De Novo Assembly with Oxford Nanopore Hybrid Error Correction and De Novo Assembly with Oxford Nanopore Michael Schatz Jan 13, 2015 PAG Bioinformatics @mike_schatz / #PAGXXIII Oxford Nanopore MinION Thumb drive sized sequencer powered over

More information

Protein Synthesis. DNA to RNA to Protein

Protein Synthesis. DNA to RNA to Protein Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6. Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)

More information

Protein Synthesis Making Proteins

Protein Synthesis Making Proteins Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

Chapter 13 - Concept Mapping

Chapter 13 - Concept Mapping Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin

More information

Protein Synthesis. Lab Exercise 12. Introduction. Contents. Objectives

Protein Synthesis. Lab Exercise 12. Introduction. Contents. Objectives Lab Exercise Protein Synthesis Contents Objectives 1 Introduction 1 Activity.1 Overview of Process 2 Activity.2 Transcription 2 Activity.3 Translation 3 Resutls Section 4 Introduction Having information

More information

DNA - DEOXYRIBONUCLEIC ACID

DNA - DEOXYRIBONUCLEIC ACID DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating

More information

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA

More information

Chapter 12. DNA TRANSCRIPTION and TRANSLATION

Chapter 12. DNA TRANSCRIPTION and TRANSLATION Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

TRANSCRIPTION AND TRANSLATION

TRANSCRIPTION AND TRANSLATION TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information

How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information DNA: CH 13 How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information Discovering DNA s Function 1928: Frederick Griffith studied

More information

1. Page 90: Cellular Metabolism Explain what the everyday use of the word metabolism means to you.

1. Page 90: Cellular Metabolism Explain what the everyday use of the word metabolism means to you. Biology 100 Winter 2013 North Seattle Community College Reading Guide 10 Metabolism, Enzymes, and Building a Protein Reading: 1) Chapter 5 (various pages) in Microbiology Demystified 2) Chapter 7 (various

More information

DNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan

DNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose

More information

BIO 101 : The genetic code and the central dogma

BIO 101 : The genetic code and the central dogma BIO 101 : The genetic code and the central dogma NAME Objectives The purpose of this exploration is to... 1. design experiments to decipher the genetic code; 2. visualize the process of protein synthesis;

More information

Analysis of Biological Sequences SPH

Analysis of Biological Sequences SPH Analysis of Biological Sequences SPH 140.638 swheelan@jhmi.edu nuts and bolts meet Tuesdays & Thursdays, 3:30-4:50 no exam; grade derived from 3-4 homework assignments plus a final project (open book,

More information

RNA & PROTEIN SYNTHESIS

RNA & PROTEIN SYNTHESIS RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide

More information

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the

More information

Bundle 6 Test Review

Bundle 6 Test Review Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic

More information

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells

More information

Machine learning applications in genomics: practical issues & challenges. Yuzhen Ye School of Informatics and Computing, Indiana University

Machine learning applications in genomics: practical issues & challenges. Yuzhen Ye School of Informatics and Computing, Indiana University Machine learning applications in genomics: practical issues & challenges Yuzhen Ye School of Informatics and Computing, Indiana University Reference Machine learning applications in genetics and genomics

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

Standards: SC.912.L.16.5: Explain the basic processes of transcription and translation, and how they result in the expression of genes.

Standards: SC.912.L.16.5: Explain the basic processes of transcription and translation, and how they result in the expression of genes. Delicious DNA: Transcription and Translation Simulation Using an Edible Model Authors: Darcy Holoweski and Catherine Quist Standards: SC.912.L.16.5: Explain the basic processes of transcription and translation,

More information

Four different segments of a DNA molecule are represented below.

Four different segments of a DNA molecule are represented below. Four different segments of a DNA molecule are represented below. There is an error in the DNA in which molecule? A. segment 1 only B. segment 3 only C. segment 2 and 3 D. segment 2 and 4 Explain the basic

More information

Ch 10.4 Protein Synthesis

Ch 10.4 Protein Synthesis Ch 10.4 Protein Synthesis I) Flow of Genetic Information A) DNA is made into RNA which undergoes transcription and translation to be made into a protein. II) RNA Structure and Function A) RNA contains

More information

Chapter 10: Gene Expression and Regulation

Chapter 10: Gene Expression and Regulation Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

The Chemistry of Genes

The Chemistry of Genes The Chemistry of Genes Adapted from Success in Science: Basic Biology Key Words Codon: Group of three bases on a strand of DNA Gene: Portion of DNA that contains the information needed to make a specific

More information

DNA Model Stations. For the following activity, you will use the following DNA sequence.

DNA Model Stations. For the following activity, you will use the following DNA sequence. Name: DNA Model Stations DNA Replication In this lesson, you will learn how a copy of DNA is replicated for each cell. You will model a 2D representation of DNA replication using the foam nucleotide pieces.

More information

DNA RNA Protein. THE DISCOVERY AND STRUCTURE OF DNA (SB2a) What is DNA? SCIENTISTS WHEN? IMPORTANT DISCOVERY

DNA RNA Protein. THE DISCOVERY AND STRUCTURE OF DNA (SB2a) What is DNA? SCIENTISTS WHEN? IMPORTANT DISCOVERY DNA RNA Protein Notes THE DISCOVERY AND STRUCTURE OF DNA (SB2a) SCIENTISTS WHEN? IMPORTANT DISCOVERY Frederick Mieshcer Discovered in the white blood cells Phoebus Levene Oswald Avery Erwin Chargaff Alfred

More information

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS

More information

Big Idea 3C Basic Review

Big Idea 3C Basic Review Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end

More information

Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016

Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016 Warm Up Questions 1. Where is DNA located? 2. Name the 3 parts of a nucleotide. 3. Enzymes can catalyze many different reactions (T or F) 4. How many variables should you have in an experiment? 5. A red

More information

Protein Synthesis Transcription And Translation Lab Answers

Protein Synthesis Transcription And Translation Lab Answers Lab Answers Free PDF ebook Download: Lab Answers Download or Read Online ebook protein synthesis transcription and translation lab answers in PDF Format From The Best User Guide Database 1.. Anatomy and

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

measuring gene expression December 5, 2017

measuring gene expression December 5, 2017 measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA

More information

The common structure of a DNA nucleotide. Hewitt

The common structure of a DNA nucleotide. Hewitt GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided

More information

ORIGIN OF GENES, THE GENETIC CODE, AND GENOMES

ORIGIN OF GENES, THE GENETIC CODE, AND GENOMES ORIGIN OF GENES, THE GENETIC CODE, AND GENOMES Deep thoughts What are the minimal requirements for life? a) Catalysis b) Response to the environment c) Growth d) Metabolism e) Heredity (Vote for as many

More information

RNA Structure and the Versatility of RNA. Mitesh Shrestha

RNA Structure and the Versatility of RNA. Mitesh Shrestha RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis

More information

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis

More information

Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?

Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein? Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13

Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 http://www.explorelearning.com Name: Period : Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 Vocabulary: Define these terms in complete sentences on a separate piece of paper: amino

More information

From Gene to Protein Transcription and Translation

From Gene to Protein Transcription and Translation Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism

More information

Microarray Gene Expression Analysis at CNIO

Microarray Gene Expression Analysis at CNIO Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

EECS730: Introduction to Bioinformatics

EECS730: Introduction to Bioinformatics EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and

More information

Protein Synthesis Honors Biology

Protein Synthesis Honors Biology Protein Synthesis What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then

More information

O C. 5 th C. 3 rd C. the national health museum

O C. 5 th C. 3 rd C. the national health museum Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,

More information

2. From the first paragraph in this section, find three ways in which RNA differs from DNA.

2. From the first paragraph in this section, find three ways in which RNA differs from DNA. Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours

More information

produces an RNA copy of the coding region of a gene

produces an RNA copy of the coding region of a gene 1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the

More information

DNA Structure and Analysis. Chapter 4: Background

DNA Structure and Analysis. Chapter 4: Background DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com

More information

NOTES Gene Expression ACP Biology, NNHS

NOTES Gene Expression ACP Biology, NNHS Name Date Block NOTES Gene Expression ACP Biology, NNHS Model 1: Transcription the process of genes in DNA being copied into a messenger RNA 1. Where in the cell is DNA found? 2. Where in the cell does

More information

RNA spike-in controls & analysis methods for trustworthy genome-scale measurements

RNA spike-in controls & analysis methods for trustworthy genome-scale measurements RNA spike-in controls & analysis methods for trustworthy genome-scale measurements Sarah A. Munro, Ph.D. Genome-Scale Measurements Group ABRF Meeting March 29, 2015 Overview External RNA Controls Consortium

More information

Rapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours

Rapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/35 *AP is a registered trademark of the College Board, which does not

More information

DNA Structure & the Genome. Bio160 General Biology

DNA Structure & the Genome. Bio160 General Biology DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:

More information

Gene Expression - Transcription

Gene Expression - Transcription DNA Gene Expression - Transcription Genes are expressed as encoded proteins in a 2 step process: transcription + translation Central dogma of biology: DNA RNA protein Transcription: copy DNA strand making

More information

Name Class Date. Practice Test

Name Class Date. Practice Test Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.

More information

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one

More information

COMPUTER RESOURCES II:

COMPUTER RESOURCES II: COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer

More information

Gene Expression and Heritable Phenotype. CBS520 Eric Nabity

Gene Expression and Heritable Phenotype. CBS520 Eric Nabity Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.

More information

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested

More information

DNA Structure, Nucleic Acids, and Proteins

DNA Structure, Nucleic Acids, and Proteins DNA Structure, Nucleic Acids, and Proteins Strands Topic Primary SOL Related SOL Life at the Molecular and Cellular Level; Scientific Investigation Investigating DNA structure, nucleic acids, and protein

More information

Genomics and Gene Recognition Genes and Blue Genes

Genomics and Gene Recognition Genes and Blue Genes Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum

More information

Section DNA: The Molecule of Heredity

Section DNA: The Molecule of Heredity Ch 11: DNA and Genes - DNA: The Molecule of Heredity Inside This Section... What is DNA? The Structure of DNA DNA Replication What is DNA? Acid DNA is the blueprint of all living organisms. It controls

More information

Transcription. DNA to RNA

Transcription. DNA to RNA Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy

More information

Ch. 10 Notes DNA: Transcription and Translation

Ch. 10 Notes DNA: Transcription and Translation Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

Written by: Prof. Brian White

Written by: Prof. Brian White Molecular Biology II: DNA Transcription Written by: Prof. Brian White Learning Goals: To work with a physical model of DNA and RNA in order to help you to understand: o rules for both DNA & RNA structure

More information

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus

More information

Wednesday, November 22, 17. Exons and Introns

Wednesday, November 22, 17. Exons and Introns Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed

More information

Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.

Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

Genomics and Gene Recognition Genes and Blue Genes

Genomics and Gene Recognition Genes and Blue Genes Genomics and Gene Recognition Genes and Blue Genes November 3, 2004 Eukaryotic Gene Structure eukaryotic genomes are considerably more complex than those of prokaryotes eukaryotic cells have organelles

More information

If Dna Has The Instructions For Building Proteins Why Is Mrna Needed

If Dna Has The Instructions For Building Proteins Why Is Mrna Needed If Dna Has The Instructions For Building Proteins Why Is Mrna Needed if a strand of DNA has the sequence CGGTATATC, then the complementary each strand of DNA contains the info needed to produce the complementary

More information