Nature Methods: doi: /nmeth Supplementary Figure 1. Identification of candidate factors for the generation of inhibitory neurons.

Size: px
Start display at page:

Download "Nature Methods: doi: /nmeth Supplementary Figure 1. Identification of candidate factors for the generation of inhibitory neurons."

Transcription

1 Supplementary Figure 1 Identification of candidate factors for the generation of inhibitory neurons. (a) Tuj1 + cells derived from human ES cells using different transcription factors 3 days after induction. Scale bars, 50 μm. (b) Schematic

2 representation of the strategy to test candidate GABAergic neuron-inducing factors. (c) Example traces recorded from in cells generated in different conditions. Left box: AMPAR-mediated spontaneous excitatory postsynaptic currents (sepsc) recorded from an example cell (Ngn2-iN cell). Expanded view of events reveals fast kinetics (middle). Center box: GABAR-mediated spontaneous inhibitory postsynaptic currents (IPSCs, top) with slower kinetics (middle) recorded from an example cell (AM+Dlx2-iN cell). Right box: Spontaneous EPSCs with fast kinetics and spontaneous IPSCs with slower kinetics recorded from an example cell (AM+Dlx5-iN cell). (d) Representative traces of spontaneous postsynaptic currents (spscs) with fast kinetics as recorded from an Ngn2+EGFPexpressing neuron (red, i), or spscs with slow kinetics as recorded from an AM+Dlx2-expressing neuron (blue, ii), that were blocked by NBQX (50 μm, AMPAR-antagonist) or picrotoxin (50 μm, GABA AR-antagonist), respectively. Insets = expanded views of boxed areas (dotted lines). (e) Bar-graphs show the average amplitude (top panels) and decay (bottom panels) of sepscs (red) and sipscs (blue) in cells infected with indicated transcription-factor combinations. Bar-graphs represent mean values ± SEM (n = 5-7 cells). Filled circles represent values measured from individual cells. Asterisks (red) indicate absence of EPSC events in AM+Dlx2-expressing neurons.

3 Supplementary Figure 2 Transcription factor combination AMD induces the differentiation of human pluripotent stem cells into a homogenous population of GABAergic neurons with high yield and reproducibility. (a) Representative traces of sipscs recorded from AMD-iN cells generated from three different human pluripotent stem cell lines. (b) AMD-iN cells generated from different cell lines show similar intrinsic properties in terms of membrane capacitance (C m, bi), inputresistance (R m, bii), and the average amplitude and frequency of the sipscs (biii and biv, respectively). Data are presented as mean ± SEM (one-way ANOVA, p > 0.05, n = 18 cells/condition), and filled circles represent values measured from individual cells.

4 Supplementary Figure 3 RNA-seq analysis of AMD-iN cells reveals expression of genes characteristic of different forebrain inhibitory neuron subtypes. (a-d) Shown are human-specific RPKM expression values for the indicated genes in AMD-iN cells 32 days after transgene induction and co-cultured with mouse glia for 4 weeks. Total RNA was collected and sequenced, but only human-specific reads were considered. DA, dopaminergic; Glu, glutamatergic; ACh, cholinergic; cin, cortical interneuron. Data are represented as mean of two biological replicates and the filled circles represent values measured from the 2 experiments.

5 Supplementary Figure 4 Detection of GABAergic neuron subtype markers in 5 WPI AD-iN cells. (a) The robust generation of GABAergic neurons expressing CR, CB and SST from different human ES and ips cells using Ascl1 and Dlx2. (b) ISL1 was observed in ~ 20% of the AD-iN cells and specific staining of NR2F2 in a small fraction of AD-iN cells (<2%) was detected (c). The bar graph shows the percentage of MAP2 positive cells that also express ISL1. Scale bar: 50 µm.

6 Supplementary Figure 5 Notch inhibitor enhanced the morphologic complexity of AD-iN cells.

7 (a) Schematic diagram represents experimental strategy for treating and characterizing cellular phenotype resulting from DAPT treatment in human neurons. (b-c) Brief DAPT treatment (3 or 4 days) at early stage during neuronal induction did not exhibit any effect on the neuronal morphology of AD induced neuronal cells revealed by MAP2 immunofluorescence. However, the mean process length of in cells significantly increased from day 4 to day 5 after transgene induction independent of DAPT treatment. (d-g) Whereas brief DAPT treatment during day 2-7 after transgene induction was sufficient to improve the complexity of the neuron morphology in terms of the max process length and the total neurite outgrowth (e, g), continuous DAPT treatment from day 2 onwards was necessary to further increase the number of branches (d).

8 Supplementary Figure 6 Ascl1 and Dlx2 induction generates mature neurons that form functional inhibitory synapses. (a) Spontaneous action potentials (APs) recorded from AD-iN cells, as replated on mouse glia at one week post-induction (WPI) and co-cultured for additional 4 (red, left) to 6 (blue, right) weeks (i); Representative traces (left) and average values (means ± SEM, n = 10

9 cells, right) of voltage-gated Na + and K + currents recorded from AD-iN cells at 6 weeks after glia co-culture (ii). (b) Immunoblot analyses of proteins extracted from AD-iN cells co-cultured with mouse glia cells or mouse glia only. Proteins are identified on the left (b-actin, GFAP, MAP2, Gephyrin, VELI, Munc18, Cask and SYT1 (Synaptotagmin-1). (c) Representative image showing vgat and Synapsin 1 (SYN1) expression in AD-iN cells co-cultured with mouse glia. (d) Representative traces of sipscs (blue trace, i) and extracellular stimulation-induced evoked IPSCs (blue trace, ii), as recorded from AD-iN cells 7 WPI, and were subsequently blocked by 50 µm picrotoxin (red traces, i and ii), a pharmacological blocker of GABA ARs.

10 Supplementary Figure 7 Continuous expression of AMD for 14 days was sufficient to induce neuronal cells with complex morphology and expressing synaptic marker SYN1. AMD-treated human ES cells where co-cultured with mouse glia from 7 days after AMD-induction. Doxycycline was withdrawn at different time (days after AMD-induction as indicated in the upper-left corner of each image). Immunofluorescence analysis was performed on day 28.

11 Supplementary Figure 8 Long term stability of the GABAergic fate and continuous maturation of AD-iN cells in vivo. (a,b) Representative image of an AD-iN cell graft in the mouse cortex 2 weeks post transplantation (w.p.t.). Transplanted cells were detected with EGFP (green) and human nuclei antibodies (blue) and expressed high levels of DCX (magenta). (b) Individual human DCX-positive cells show migrating morphologies. (c-e) After 3 months post transplantation (m.p.t.) we observed robust GABA and NeuN staining in the grafted cells. We also detected an increased number of NeuN+ cells over time.

12 Supplementary Figure 9 AMD-induced inhibitory neurons for human neurological disease modeling. (a) Sequence of shrnas targeting human Collybistin mrna. (b) Patch-clamp configuration for postsynaptic recordings performed on in cells expressing Collybistin shrnas (EGFP-positive). Collybistin KD in cells were co-cultured with Ngn2-induced human neurons (EGFP-negative, black arrowheads). Left, bright-field; Middle, EGFP-fluorescence view; and Right, as both views merged. Rec: recording electrode; Scale bars: 15 μm. The lower panel shows representative traces of AMPAR-mediated sepscs recorded from control (Ctrl, black) vs. Collybistin shrna #4 expressing (Sh#4, brown) neurons. (c) Cumulative plots (left) and average graphs (right) representing mean ± SE values of sepsc amplitude (i, top) and event frequency (ii, bottom), for control vs. Collybistin shrna #4 infected neurons. (d) Cumulative plots (left) and average values (mean ± SE, right) of intrinsic membrane properties: membrane capacitance (Cm, i), input resistance (Rm, ii), and resting membrane potential (Vm, iii), as recorded from control (Ctrl, black) vs. Collybistin shrna #4 expressing (Sh# 4, brown) human neurons. For cumulative plots, color-matched connected circles represent average values of corresponding parameters recorded from individual cells. For all experimental approaches, the numbers inside average bar-graphs indicate total number of cells recorded / number of independent batches. Statistical significance was tested by twotailed, unpaired, Student s t-test (ns = not significant, P > 0.05).

13 Supplementary Figure 10 Analysis of different transcription factor combinations confirmed that Ascl1 and Dlx2 are sufficient to generate SST-, CALB1(CB)-, CALB2(CR)-, VIP- and RELN-expressing cells. qrt-pcr analysis was performed for indicated genes using AD-iN cells or in cells generated by AD plus indicated factors. Expression levels (expressed as Ct values) are color coded as shown. In general, all the AD plus 1 conditions generated GABAergic neuron populations similar to those induced by AD or AD with Myt1l. All conditions generated in cells that robustly expressed SST, CALB1, SYN1 and vgat. Whereas the expression levels of PVAL and NPY are less prominent and more variable.

14 Supplementary Table 1. Antibodies used in this study Antibody Vendor Catalog# Calbindin (CB) Swant Calretinin Swant 6B3 2 Somatostatin Bachem T DARPP32 SCBT sc TTF1(NKX2-1) Invitrogen ISLET1 DSHB 39.3F7 2 Pan DLX gift from Yury M. Morozov 5 NeuN Millipore MAB377 2 GAD1 Millipore MAB GAD2 DSHB GAD6 6 Synapsin-1 Synaptic System DCX Cell Signaling 4604S 8 OLIG2 Millipore AB TUJ1 Covance MMS-435P 9 TUJ1 Covance MRB-435P 9 VGAT Synaptic System Human nuclei antigen Millipore MAB GFP Aves Labs GFP COUPTFII Perseus Proteomics PP-H MAP2 Abcam AB MAP2 Sigma Aldrich M GABA Sigma Aldrich A

15 Supplementary Table 2. TaqMan Gene Expression Assays from Thermo- Fisher Scientific (former Invitrogen) used in this study Gene Assay ID Gene Assay ID GAPDH Hs _g1 SST_A1 Hs _m1 NES Hs _g1 SST_A2 Hs _m1 SOX1 Hs _s1 VIP_A1 Hs _m1 OLIG2 Hs _m1 VIP_A2 Hs _m1 TUBB3 Hs _g1 NPY Hs _m1 SYN1 Hs _m1 NOS Hs _m1 vglut1 Hs _m1 NTR3A Hs _m1 vgat Hs _m1 CCK Hs _m1 GAD1 Hs _m1 RELN Hs _m1 GAD2 Hs _m1 NKX2.1 Hs _m1 GAT1 Hs _m1 LHX6 Hs _gH GAT2 Hs _m1 ZEB2 Hs _g1 GAT3 Hs _m1 SOX6 Hs _m1 DLX1 Hs _m1 SATB1 Hs _m1 DLX5 Hs _m1 CXCR4 Hs _s1 DLX6 Hs _m1 SP8 Hs _g1 PVALB_A1 Hs _m1 NR2F2 Hs _m1 PVALB_A2 Hs _m1 EMX1 Hs _m1 CALB1 Hs _m1 LHX8 Hs _m1 CALB2 Hs _m1 References 1. Schurmans, S. et al. Impaired long-term potentiation induction in dentate gyrus of calretinin-deficient mice. Proc. Natl Acad. Sci. 94, (1997). 2. Nicholas, C. R. et al. Functional maturation of hpsc-derived forebrain interneurons requires an extended timeline and mimics human neural development. Cell Stem Cell 12, (2013). 3. Victor, M. B. et al. Generation of Human Striatal Neurons by MicroRNA- Dependent Direct Conversion of Fibroblasts. Neuron 84, (2014). 4. Wang, P.-H., Wang, H.-C. & Tsai, C.-C. Estrogen replacement in female lung cancer during gefitinib therapy. Jpn. J. Clin. Oncol. 39, (2009). 5. Morozov, Y. M., Torii, M. & Rakic, P. Origin, early commitment, migratory routes, and destination of cannabinoid type 1 receptor-containing interneurons. Cereb Cortex 19 Suppl 1, i78 89 (2009).

16 6. Chang, Y. C. & Gottlieb, D. I. Characterization of the proteins purified with monoclonal antibodies to glutamic acid decarboxylase. The Journal of neuroscience (1988). 7. Pak, C. et al. Human Neuropsychiatric Disease Modeling using Conditional Deletion Reveals Synaptic Transmission Defects Caused By Heterozygous Mutations in NRXN1. Cell Stem Cell (2015). doi: /j.stem Hansen, D. V. et al. Non-epithelial stem cells and cortical interneuron production in the human ganglionic eminences. Nat Neurosci 16, (2013). 9. Pang, Z. P. et al. Induction of human neuronal cells by defined transcription factors. Nature 476, (2011). 10. Zhang, Y. et al. Rapid single-step induction of functional neurons from human pluripotent stem cells. Neuron 78, (2013). 11. Humphreys, B. D. et al. Intrinsic epithelial cells repair the kidney after injury. Cell Stem Cell 2, (2008). 12. Ribeiro, L. F. et al. Ghrelin triggers the synaptic incorporation of AMPA receptors in the hippocampus. Proc. Natl. Acad. Sci. U.S.A. 111, E (2014). 13. Vierbuchen, T. et al. Direct conversion of fibroblasts to functional neurons by defined factors. Nature 463, (2010).

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10202 Supplementary Figure 1: Rapid generation of neurons from human ES cells. a, Phase contrast image of feeder-free culture of human ES cells infected with Brn2, Ascl1, Myt1l (BAM)

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature22047 Supplementary discussion Overall developmental timeline and brain regionalization in human whole-brain organoids We first defined the timeline of generation of broadly-defined cell

More information

Supplemental Information. Pioneer Factor NeuroD1 Rearranges. Transcriptional and Epigenetic Profiles. to Execute Microglia-Neuron Conversion

Supplemental Information. Pioneer Factor NeuroD1 Rearranges. Transcriptional and Epigenetic Profiles. to Execute Microglia-Neuron Conversion Neuron, Volume 101 Supplemental Information Pioneer Factor NeuroD1 Rearranges Transcriptional and Epigenetic Profiles to Execute Microglia-Neuron Conversion Taito Matsuda, Takashi Irie, Shutaro Katsurabayashi,

More information

Rapid differentiation of human pluripotent stem cells into functional motor neurons by

Rapid differentiation of human pluripotent stem cells into functional motor neurons by Supplementary Information Rapid differentiation of human pluripotent stem cells into functional motor neurons by mrnas encoding transcription factors Sravan Kumar Goparaju, Kazuhisa Kohda, Keiji Ibata,

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of NSCs from hpscs in SDC medium.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of NSCs from hpscs in SDC medium. Supplementary Figure 1 Generation of NSCs from hpscs in SDC medium. (a) Q-PCR of pluripotent markers (OCT4, NANOG), neural markers (SOX1, PAX6, N-Cadherin), markers for the other germ layers (T, EOMES,

More information

NEURONAL CELL CULTURE MATRIX FOR BETTER MAINTENANCE AND SURVIVAL OF NEURONAL CELL CULTURES IN TISSUE CULTURE.

NEURONAL CELL CULTURE MATRIX FOR BETTER MAINTENANCE AND SURVIVAL OF NEURONAL CELL CULTURES IN TISSUE CULTURE. NEURONAL CELL CULTURE MATRIX FOR BETTER MAINTENANCE AND SURVIVAL OF NEURONAL CELL CULTURES IN TISSUE CULTURE. D. R. Aguirre, N. DiMassa, Chrystal Johnson, H. Eran, R. Perez, C.V.R. Sharma, M.V.R. Sharma,

More information

Supplementary Information

Supplementary Information Supplementary Information Selective control of inhibitory synapse development by Slitrk3-PTPδ trans-synaptic interaction Hideto Takahashi 1, Kei-ichi Katayama 2, Kazuhiro Sohya 3,4, Hiroyuki Miyamoto 4,5,

More information

Supplementary Figure 1. Screening for monoclonal antibodies against GluA1 by immunoblotting.

Supplementary Figure 1. Screening for monoclonal antibodies against GluA1 by immunoblotting. Supplementary Figure 1 Screening for monoclonal antibodies against GluA1 by immunoblotting. Hippocampal extract was subjected to western blotting with the hybridoma supernatants of candidate monoclonal

More information

Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State

Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State Soonbong Baek, 1 Xiaoyuan Quan, 1 Soochan Kim, 2 Christopher Lengner, 3 Jung- Keug Park, 4 and Jongpil Kim 1* 1 Lab

More information

Supplementary figures (Zhang)

Supplementary figures (Zhang) Supplementary figures (Zhang) Supplementary figure 1. Characterization of hesc-derived astroglia. (a) Treatment of astroglia with LIF and CNTF increases the proportion of GFAP+ cells, whereas the percentage

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate

More information

Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP)

Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP) Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP) in the cortex (area 1 as defined in Fig. 2a), and corpus

More information

DCLK-immunopositive. Bars, 100 µm for B, 50 µm for C.

DCLK-immunopositive. Bars, 100 µm for B, 50 µm for C. Supplementary Figure S1. Characterization of rabbit polyclonal anti-dclk antibody. (A) Immunoblotting of COS7 cells transfected with DCLK1-GFP and DCLK2-GFP expression plasmids probed with anti-dclk antibody

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Effect of timing of DE dissociation and RA concentration on lung field specification in hpscs. (a) Effect of duration of endoderm induction on expression of

More information

GENESDEV/2007/ Supplementary Figure 1 Elkabetz et al.,

GENESDEV/2007/ Supplementary Figure 1 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 1 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 2 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 3 Elkabetz et al., GENESDEV/2007/089581

More information

Supplemental Information. Direct Reprogramming of Fibroblasts. via a Chemically Induced XEN-like State

Supplemental Information. Direct Reprogramming of Fibroblasts. via a Chemically Induced XEN-like State Cell Stem Cell, Volume 21 Supplemental Information Direct Reprogramming of Fibroblasts via a Chemically Induced XEN-like State Xiang Li, Defang Liu, Yantao Ma, Xiaomin Du, Junzhan Jing, Lipeng Wang, Bingqing

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible

More information

Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression

Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Mass spectrometry characterization of epoxide reactions.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Mass spectrometry characterization of epoxide reactions. Supplementary Figure 1 Mass spectrometry characterization of epoxide reactions. (a) Degree of amine reactivity of bovine serum albumin (BSA) with epoxide molecules having different numbers of epoxide groups:

More information

Triggering Calcium Responses in Various Human ipsc-derived Neural Cell Types. Giorgia Salvagiotto, PhD June 2016

Triggering Calcium Responses in Various Human ipsc-derived Neural Cell Types. Giorgia Salvagiotto, PhD June 2016 Triggering Calcium Responses in Various Human ipsc-derived Neural Cell Types Giorgia Salvagiotto, PhD June 216 Transformative Potential of ipsc Technology: Enabling for Drug Discovery, Toxicology, and

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and

More information

Supplemental figures (1-9) Gu et al. ADF/Cofilin-Mediated Actin Dynamics Regulate AMPA Receptor Trafficking during Synaptic Plasticity

Supplemental figures (1-9) Gu et al. ADF/Cofilin-Mediated Actin Dynamics Regulate AMPA Receptor Trafficking during Synaptic Plasticity Supplemental figures (1-9) Gu et al. ADF/Cofilin-Mediated Actin Dynamics Regulate AMPA Receptor Trafficking during Synaptic Plasticity Supplemental figure 1. The quantification method to determine the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION DOI: 1.138/NMAT3777 Biophysical regulation of epigenetic state and cell reprogramming Authors: Timothy L. Downing 1,2, Jennifer Soto 1,2, Constant Morez 2,3,, Timothee Houssin

More information

Supplementary Figure 1. Pathologically phosphorylated Tau is localized to the presynaptic terminals of Alzheimer s disease (AD) patient brains.

Supplementary Figure 1. Pathologically phosphorylated Tau is localized to the presynaptic terminals of Alzheimer s disease (AD) patient brains. Supplementary Figure 1. Pathologically phosphorylated Tau is localized to the presynaptic terminals of Alzheimer s disease (AD) patient brains. Ultrathin (70 nm) sections of healthy control or AD patient

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb327 a b Sequence coverage (%) 4 3 2 IP: -GFP isoform IP: GFP IP: -GFP IP: GFP Sequence coverage (%) 4 3 2 IP: -GFP IP: GFP 33 52 58 isoform 2 33 49 47 IP: Control IP: Peptide Sequence Start

More information

Sundari Chetty, Felicia Walton Pagliuca, Christian Honore, Anastasie Kweudjeu, Alireza Rezania, and Douglas A. Melton

Sundari Chetty, Felicia Walton Pagliuca, Christian Honore, Anastasie Kweudjeu, Alireza Rezania, and Douglas A. Melton A simple tool to improve pluripotent stem cell differentiation Sundari Chetty, Felicia Walton Pagliuca, Christian Honore, Anastasie Kweudjeu, Alireza Rezania, and Douglas A. Melton Supplementary Information

More information

- Supplementary Information -

- Supplementary Information - TRIM32 dependent transcription in adult neural progenitor cells regulates neuronal differentiation. - Supplementary Information - Anna-Lena Hillje 1, 2#, Maria Angeliki S. Pavlou 1, 2#, Elisabeth Beckmann

More information

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,

More information

A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity

A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity Peng Li 1,2, Fang Du 1, Larra W. Yuelling 1, Tiffany Lin 3, Renata E. Muradimova 1, Rossella Tricarico

More information

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure S1. Generation of a synaptobrevin2-mrfp knock-in mouse. (a) Targeting strategy of Syb2-mRFP knock-in mouse leaving the synaptobrevin2 gene locus intact except

More information

Supplementary Material for Yang et al., Generation of oligodendroglial cells by direct lineage conversion

Supplementary Material for Yang et al., Generation of oligodendroglial cells by direct lineage conversion Supplementary Material for Yang et al., Generation of oligodendroglial cells by direct lineage conversion Supplementary Figure 1. The presence of Plp::EGFP + /O4 + cells 21 days after transgene induction.

More information

Supporting Figure 1: Meis2 and Pax6 transcripts in the adult murine brain detected by in situ

Supporting Figure 1: Meis2 and Pax6 transcripts in the adult murine brain detected by in situ DEVELOP2013097295_supplementary figures Supporting Figure 1: Meis2 and Pax6 transcripts in the adult murine brain detected by in situ hybridization on vibratome sections. (A) Meis2-specific transcripts

More information

INNOVATIVE PRODUCTS FOR NEUROSCIENCE RESEARCH

INNOVATIVE PRODUCTS FOR NEUROSCIENCE RESEARCH INNOVATIVE PRODUCTS FOR NEUROSCIENCE RESEARCH NEURAL CELLS & MEDIA STEM CELLS & CULTURE REAGENTS TRANSFECTION CUSTOM SERVICES NEUROSCIENCE PRODUCTS CATALOG TABLE OF CONTENTS Neuroscience research demands

More information

Supplementary Table 1. Primary antibodies used in this study.

Supplementary Table 1. Primary antibodies used in this study. Supplementary Table 1. Primary antibodies used in this study. Antibodies Mouse monoclonal Antibody(Ab) Working dilution Oct4 1:2 Pax6 1:1 Company Notes 1 Santa Cruz Biotechnology Use only Cy3 2nd antibody

More information

Supplementary Figure 1. Serial deletion mutants of BLITz.

Supplementary Figure 1. Serial deletion mutants of BLITz. Supplementary Figure 1 Serial deletion mutants of BLITz. (a) Design of TEVseq insertion into J -helix. C-terminal end of J -helix was serially deleted and replaced by TEVseq. TEV cleavage site is labeled

More information

PRIMARY NEURONAL CULTURE

PRIMARY NEURONAL CULTURE PRIMARY NEURONAL CULTURE Products for Your Research Scientists Helping Scientists WWW.STEMCELL.COM TABLE OF CONTENTS 3 Primary Neuronal Culture NeuroCult SM1 and BrainPhys Neuronal Medium 4 Increased Neuronal

More information

Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of

Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,

More information

Supplementary Figure 1 Characterization of OKSM-iNSCs

Supplementary Figure 1 Characterization of OKSM-iNSCs Supplementary Figure 1 Characterization of OKSM-iNSCs (A) Gene expression levels of Sox1 and Sox2 in the indicated cell types by microarray gene expression analysis. (B) Dendrogram cluster analysis of

More information

Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like

Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like morphology in co-culture with mouse embryonic feeder fibroblasts

More information

Supplementary Figure 1. Espn-1 knockout characterization. (a) The predicted recombinant Espn-1 -/- allele was detected by PCR of the left (5 )

Supplementary Figure 1. Espn-1 knockout characterization. (a) The predicted recombinant Espn-1 -/- allele was detected by PCR of the left (5 ) Supplementary Figure 1. Espn-1 knockout characterization. (a) The predicted recombinant Espn-1 -/- allele was detected by PCR of the left (5 ) homologous recombination arm (left) and of the right (3 )

More information

Supplementary Table 3d: PCR primers for genomic sequencing-based phasereconstruction

Supplementary Table 3d: PCR primers for genomic sequencing-based phasereconstruction Supplementary Table 3: Detailed lists of grnas, primers, donor constructs, antibodies, Gene Expression Omnibus (GEO) identifiers for Chip-seq and DHSs datasets and CRISPR/Cas9 genome edited cell lines

More information

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Moutin et al., http://www.jcb.org/cgi/content/full/jcb.201110101/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Tagged Homer1a and Homer are functional and display different

More information

Supplementary Table-1: List of genes that were identically matched between the ST2 and

Supplementary Table-1: List of genes that were identically matched between the ST2 and Supplementary data Supplementary Table-1: List of genes that were identically matched between the ST2 and ST3. Supplementary Table-2: List of genes that were differentially expressed in GD2 + cells compared

More information

SUPPLEMENTARY FIGURES AND VIDEOS

SUPPLEMENTARY FIGURES AND VIDEOS SUPPLEMENTARY FIGURES AND VIDEOS Supplementary Figure 1. Generation of Human Intestinal Organoids (HIOs). (a) Method for generating HIOs through directed differentiation of human pluripotent stem cells.

More information

Small molecule-based lineage switch of human adipose-derived stem cells into neural stem cells and functional GABAergic neurons

Small molecule-based lineage switch of human adipose-derived stem cells into neural stem cells and functional GABAergic neurons www.nature.com/scientificreports Received: 20 March 2017 Accepted: 8 August 2017 Published: xx xx xxxx OPEN Small molecule-based lineage switch of human adipose-derived stem cells into neural stem cells

More information

Supplementary Data. Supplementary Table S1.

Supplementary Data. Supplementary Table S1. Supplementary Data Supplementary Table S1. Primer Sequences for Real-Time Reverse Transcription-Polymerase Chain Reaction Gene Forward 5?3 Reverse 3?5 Housekeeping gene 36B4 TCCAGGCTTTGGGCATCA CTTTATCAGCTGCACATCACTCAGA

More information

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and

Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For

More information

A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs

A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs Supplementary Information A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs Bahram Valamehr, Ramzey Abujarour, Megan Robinson, Thuy Le, David Robbins,

More information

SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES

SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Generation of inducible BICD2 knock-out mice. A) The mouse BICD2 locus and gene targeting constructs. To generate an inducible Bicd2

More information

Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs.

Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs. kda 65 45 45 35 Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs. H9 hescs were differentiated with or without BMP4+BMP8A and cell lysates were collected for Western analysis

More information

Generation and post-injury integration of human spinal cord neural stem cells

Generation and post-injury integration of human spinal cord neural stem cells SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41592-018-0074-3 In the format provided by the authors and unedited. Generation and post-injury integration of human spinal cord neural stem

More information

with different microfluidic device parameters. Distribution of number of transcripts (y-axis) detected across nuclei, ranked in decreasing

with different microfluidic device parameters. Distribution of number of transcripts (y-axis) detected across nuclei, ranked in decreasing Supplementary Figure 1 DroNc-seq benchmarking experiments. (a) Overview of DroNc-seq. (b) CAD schema of DroNc-seq microfluidic device. (c) Comparison of library complexity from experiments with different

More information

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of

More information

Supplementary Figures and supplementary figure legends

Supplementary Figures and supplementary figure legends Supplementary Figures and supplementary figure legends Figure S1. Effect of different percentage of FGF signaling knockdown on TGF signaling and EndMT marker gene expression. HUVECs were subjected to different

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION In the format provided by the authors and unedited. Electromagnetized gold nanoparticles mediate direct lineage reprogramming into induced dopamine neurons in vivo for Parkinson s disease therapy Junsang

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use

More information

Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat

Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat pups at P6, P14, P22, P30 and adult (A) rats were subjected

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/282/ra53/dc1 Supplementary Materials for Estrogen Alters the Splicing of Type 1 Corticotropin-Releasing Hormone Receptor in Breast Cancer Cells Suchita Lal,

More information

Supplementary Figure 1. Mouse genetic models used for identification of Axin2-

Supplementary Figure 1. Mouse genetic models used for identification of Axin2- Supplementary Figure 1. Mouse genetic models used for identification of Axin2- expressing cells and their derivatives. Schematic representations illustrate genetic cell labeling strategies to identify

More information

Supplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860

Supplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860 Supplementary Figure 1 Generation of B2M -/- ESCs. (a) Maps of the B2M alleles in cells with the indicated B2M genotypes. Probes and restriction enzymes used in Southern blots are indicated (H, Hind III;

More information

Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking

Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking Chi Wai Lee, Jianzhong Han, James R. Bamburg, Liang Han, Rachel Lynn, and James Q. Zheng Supplementary Figures

More information

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb. Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length

More information

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into

More information

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Schematics of SAM, dcas9-suntag and dcas9-vpr.

Nature Methods: doi: /nmeth Supplementary Figure 1. Schematics of SAM, dcas9-suntag and dcas9-vpr. Supplementary Figure 1 Schematics of SAM, dcas9-suntag and dcas9-vpr. (a) Schematics of SAM. SAM consists of two chimeric proteins, dcas9 fused with VP64 and MS2-coat protein fused with p65 and HSF1 activator

More information

Supplementary Information. A superfolding Spinach2 reveals the dynamic nature of. trinucleotide repeat RNA

Supplementary Information. A superfolding Spinach2 reveals the dynamic nature of. trinucleotide repeat RNA Supplementary Information A superfolding Spinach2 reveals the dynamic nature of trinucleotide repeat RNA Rita L. Strack 1, Matthew D. Disney 2 & Samie R. Jaffrey 1 1 Department of Pharmacology, Weill Medical

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm

More information

To examine the silencing effects of Celsr3 shrna, we co transfected 293T cells with expression

To examine the silencing effects of Celsr3 shrna, we co transfected 293T cells with expression Supplemental figures Supplemental Figure. 1. Silencing expression of Celsr3 by shrna. To examine the silencing effects of Celsr3 shrna, we co transfected 293T cells with expression plasmids for the shrna

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Figure S1. Efficacy of STIM1 knockdown by electroporation of STIM1 sirnas. (a) Western blot of FDB muscles from 4 mice treated with either STIM1-specific sirna (KD)

More information

Htt-Q23 Htt-Q74. [Hsp70] (ng/ml) C HS C HS UREA. -Dox +Dox C HS C HS HSF1 GAPDH 37ºC. +Dox HSF1. Hsp70 GAPDH. Striatum

Htt-Q23 Htt-Q74. [Hsp70] (ng/ml) C HS C HS UREA. -Dox +Dox C HS C HS HSF1 GAPDH 37ºC. +Dox HSF1. Hsp70 GAPDH. Striatum % positive cells Ratio -S33-P/ mrna relative levels 37ºC 37ºC [] (ng/ml) A Hsp25 Bag3 Hspb5 Erdj3 Hsp9 Hsp6 PC12-Htt-Q74 -Dox +Dox C HS C HS -25-5 -25-1 -5 B D 5 4 3 2 1 Htt-Q23 Htt-Q74 ** ** C HS C HS

More information

Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various

Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or

More information

Supplemental Figure S1. PGRN Binding to Sortilin.

Supplemental Figure S1. PGRN Binding to Sortilin. 1 Neuron, volume 68 Supplemental Data Sortilin-Mediated Endocytosis Determines Levels of the Frontotemporal Dementia Protein, Progranulin Fenghua Hu, Thihan Padukkavidana, Christian B. Vægter, Owen A.

More information

Supporting Information

Supporting Information Supporting Information Fujii et al. 10.1073/pnas.1217563110 A Human Cen chromosome 4q ART3 NUP54 SCARB2 FAM47E CCDC8 Tel B Bac clones RP11-54D17 RP11-628A4 Exon 1 2 34 5 6 7 8 9 10 11 12 5 3 PCR region

More information

Development 142: doi: /dev : Supplementary Material

Development 142: doi: /dev : Supplementary Material Development 142: doi:1.42/dev.11687: Supplementary Material Figure S1 - Relative expression of lineage markers in single ES cell and cardiomyocyte by real-time quantitative PCR analysis. Single ES cell

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. Functional assays of hepatocyte-like cells induced from H1 hescs (a) P450 and AAT staining, PAS staining, LDL uptake assay, and ICG uptake and release assay

More information

Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss

Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss SUPPLEMENTARY INFORMATION Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss Yunjong Lee, Senthilkumar S. Karuppagounder, Joo-Ho Shin, Yun-Il Lee, Han Seok Ko, Debbie Swing,

More information

Seoul, , Republic of Korea.

Seoul, , Republic of Korea. NATURE Vol 463 25 February 21 NEWS & VIEWS and colleagues determination of the equation of state for a unitary Fermi gas represents an outstanding example of quantum simulation, providing valuable qualitative

More information

Supplementary Information

Supplementary Information Supplementary Information Figure S1. Neuropods contact nerves but not blood vessels. We used a vessel painting technique with the lipophilic dye DiI to determine the relationship of enteroendocrine cells

More information

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3 ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures Supplementary Figure 1. qrt-pcr analysis of the expression of candidate factors including SOX2, MITF, PAX3, DLX5, FOXD3, LEF1, MSX1, PAX6, SOX2 and SOX9

More information

BF Fox-3 HLA merge A 3

BF Fox-3 HLA merge A 3 Supplementary Figure 1 F Fox-3 merge 3 SN TRL L P L TRL SN P Supplementary Figure 1. Series of low magnification brightfield and immunofluorescence images (Fox-3 in green/, and in red). ircles indicate

More information

Notch1 (forward: 5 -TGCCTGTGCACACCATTCTGC-3, reverse: Notch2 (forward: 5 -ATGCACCATGACATCGTTCG-3, reverse:

Notch1 (forward: 5 -TGCCTGTGCACACCATTCTGC-3, reverse: Notch2 (forward: 5 -ATGCACCATGACATCGTTCG-3, reverse: Supplementary Information Supplementary Methods. RT-PCR. For mouse ES cells, the primers used were: Notch1 (forward: 5 -TGCCTGTGCACACCATTCTGC-3, reverse: 5 -CAATCAGAGATGTTGGAATGC-3 ) 1, Notch2 (forward:

More information

Changing fibroblasts into neurons: Direct lineage conversion. Journal Club Uli Herrmann

Changing fibroblasts into neurons: Direct lineage conversion. Journal Club Uli Herrmann Changing fibroblasts into neurons: Direct lineage conversion Journal Club Uli Herrmann 25.6.13 Outline Epigenetic landscape model Reprogramming cells Induced pluripotent stem cells Three papers: Direct

More information

Sabrina Jedlicka. Interactions of Neurons and Materials

Sabrina Jedlicka. Interactions of Neurons and Materials Sabrina Jedlicka Interactions of Neurons and Materials Neurological Disorders Over 600 known neurological disorders ú Diseases of the CNS and PNS Epilepsy Alzheimer s Parkinson s Etc. ú Diseases that attack

More information

Supplemental material

Supplemental material Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.

More information

Post-expansion antibody delivery, after epitope-preserving homogenization.

Post-expansion antibody delivery, after epitope-preserving homogenization. Supplementary Figure 1 Post-expansion antibody delivery, after epitope-preserving homogenization. (a, b) Wide-field fluorescence images of Thy1-YFP-expressing mouse brain hemisphere slice before expansion

More information

Isolation, culture, and transfection of primary mammary epithelial organoids

Isolation, culture, and transfection of primary mammary epithelial organoids Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

More information

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.

More information

supplementary information

supplementary information Figure S1 Distribution of heterokaryons in vermis and hemispheres of the cerebellum. Schematic dorsal view of an adult cerebellum with the vermis in the middle (red) flanked by the two hemispheres (grey).

More information

MeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132

MeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132 Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP

More information

Sabrina Jedlicka. Interactions of Neurons and Materials

Sabrina Jedlicka. Interactions of Neurons and Materials Sabrina Jedlicka Interactions of Neurons and Materials Developmental Cell Biology Some Perspective Stem cells: Undifferentiated cells that are capable of proliferation, self-maintenance and differentiation

More information

T-iPSC. Gra-iPSC. B-iPSC. TTF-iPSC. Supplementary Figure 1. Nature Biotechnology: doi: /nbt.1667

T-iPSC. Gra-iPSC. B-iPSC. TTF-iPSC. Supplementary Figure 1. Nature Biotechnology: doi: /nbt.1667 a T-iPSC Gra-iPSC B-iPSC TTF-iPSC Ectoderm Endoderm Mesoderm b Nature Biotechnology: doi:.38/nbt.667 Supplementary Figure Klf4 transgene expression Oct4 transgene expression.7 Fold GAPDH.6.5.4.3 Fold GAPDH

More information

Chemically defined conditions for human ipsc derivation and culture

Chemically defined conditions for human ipsc derivation and culture Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,

More information

TRIM31 is recruited to mitochondria after infection with SeV.

TRIM31 is recruited to mitochondria after infection with SeV. Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker

More information

Xu et al., Supplementary Figures 1-7

Xu et al., Supplementary Figures 1-7 Xu et al., Supplementary Figures 1-7 Supplementary Figure 1. PIPKI is required for ciliogenesis. (a) PIPKI localizes at the basal body of primary cilium. RPE-1 cells treated with two sirnas targeting to

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1: Identification of new regulators of MuSC by a proteome-based shrna screen. (a) FACS plots of GFP + and GFP - cells from Pax7 ICN -Z/EG (upper panel) and

More information