Supplemental Data. Polycomb Silencing of KNOX Genes Confines. Shoot Stem Cell Niches in Arabidopsis Current Biology, Volume 18

Transcription

1 Supplemental Data Polycomb Silencing of KNOX Genes Confines Shoot Stem Cell Niches in Arabidopsis Lin Xu and Wen-Hui Shen - 1 -

2 Figure S1. Phylogram of RING1, BMI1 and RAD18 homologues in several organisms The phylogenic analysis was performed using MEGA3.0 package with bootstrapping set at 500 replicates

3 Figure S2. Alignment of AtRING1a and AtRING1b amino acid sequences Consensus symbols below the alignments indicate: identical residues (*), conserved (:) and semi-conserved (.) substitutions. The alignment was generated using CLUSTALW program

4 Figure S3. RT-PCR analysis of AtRING1a and AtRING1b expression in different organs of the wild-type Col plants - 4 -

5 Figure S4. Production and mature plant phenotype of Atring1a -/- Atring1b -/- mutant (A) A schematic representation of procedures in obtaining the double mutant Atring1a -/- Atring1b -/-. The two homozygous mutant alleles Atring1a -/- and Atring1b -/- were combined together by crossing. Then through selfing and genotyping by PCR, Line-29 with genotype Atring1a -/- AtRING1b +/- and Line-22 with genotype AtRING1a +/- Atring1b -/- were obtained. (B) Comparison of a 35-day-old wild-type Col plant and a 50-day-old mutant Atring1a -/- Atring1b - /- plant. Note that the mutant plant is sterile and cannot set siliques

6 Figure S5. Rescue of the Atring1a -/- Atring1b -/- mutant phenotype by transformation with AtRING1a or AtRING1b gene (A) Diagram of genomic organization at the AtRING1a and AtRING1b gene regions in two BAC clones. The XbaI-SalI fragment containing AtRING1a (patring1a) and the SalI-SacI fragment containing AtRING1b (patring1b) are used to rescue the Atring1a -/- Atring1b -/- mutant. (B) Comparison of 23-day-old plants and inflorescences of the Atring1a -/- Atring1b -/- mutant with the same mutant rescued by patring1a or patring1b. Bars = 5 mm

7 Figure S6. ChIP analysis of H3K27 trimethylation at STM, KNAT2, KNAT6 and AG in the mutants Atring1a -/- Atring1b -/- and cl f-/- compared with the wild-type Col (A) Diagram of STM, KNAT2, KNAT6 and AG gene structure indicating the regions examined by ChIP. Black boxes represent exons; lines represent promoter and introns; bars labed I-III represent regions amplified by PCR. (B) ChIP analysis with antibodies specific to trimethyl-h3k day-old plants of the wildtype Col and the mutants Atring1a -/- Atring1b -/- and clf -/- were analyzed. Input and no antibody (-) are shown as positive and negative controls

8 Table S1. List of primers used in this study. Name Sequence AGI ID Gene name Position (ATG or ACG= +1~+3) RT-PCR primers AtRING1a-F1 5 gactagtatgtctgtcaagaat AATAG At5g44280 AtRING1a +1~+21 AtRING1a-R1 5 AGAACCTGTGGAGACATTC At5g44280 AtRING1a +1192~+1173 AtRING1b-F1 5 cgggatccatgccttccttgaa GAGCTT At1g03770 AtRING1b +1~+21 AtRING1b-R1 5 CAGATATCCGCTAGATCAA CAAC At1g03770 AtRING1b +730~+707 STM-F4 5 AAGCTGAGGATAGAGAG At1g62360 STM +1920~+1937 STM-R3 5 GGATCGATCAAAGCATGG At1g62360 STM +2934~+2917 KNAT1-F1 5 TGTCAGAGTCCCATTCA At4g08150 KNAT1 +915~+932 KNAT1-R1 5 GCAACGAGAGGTTGTTATT3 At4g08150 KNAT ~+2667 KNAT2-F1 5 TGACGAGGAACTGAGAGAA G At1g70510 KNAT ~+5061 KNAT2-R1 5 GGTTCCATTCATTCGCGATG At1g70510 KNAT ~+5605 KNAT6-F1 5 GGTGTAATATCATCTGACG3 At1g23380 KNAT ~+4528 KNAT6-R1 5 TGTCGTCCATGCTTCACT At1g23380 KNAT ~+5083 WUS-F1 5 TAACAAGCCATATCCCAGC3 At2g17950 WUS +468~+486 WUS-R1 5 GCTTTAATCCCGAGCGA At2g17950 WUS +1603~+1586 CLV3-F1 5 TGTACTCATTAAGGCCTCTC At2g27250 CLV3-46~-27 CLV3-R1 5 CATGAAACTACAAGCTTAC At2g27250 CLV3 +408~+389 AG-F1 5 AATCAGCCAAATTGCGTCA A At4g18960 AG +3427~+3447 AG-R1 5 GCTTTATATTGCTTGCTCAA C At4g18960 AG +4423~+4402 AP3-F1 5 GAGACAAATAGAAATCTCC G At3g54340 AP3 +470~+489 AP3-R1 5 TAGACAATGATGGCACCAG At3g54340 AP ~+1679 AS1-F1 5 GAAGTTGCTCTTGAGTTTGG G At2g37630 AS1-426~+-406 AS1-R1 5 GCTCAACTCTCTTGTTACTC At2g37630 AS1 +358~+339 AS2-F1 5 CCTCTGAGCAACAGAAGCC At1g65620 AS2-371~-353 AS2-R1 5 CCGAGGCTTTGGTACTTAG3 At1g65620 AS2 +347~+329 ACTIN-F1 AAGTCATAACCATCGGAGCT G At5g09810 ACTIN +923~+943 ACTIN-R1 ACCAGATAAGACAAGACACA C At5g09810 ACTIN +1433~+1413 Genomic PCR primers AtRING1a-F2 5 CCAGATGTGTTTAGCTTGTG At5g44280 AtRING1a +502~+521 AtRING1a-R1 5 AGAACCTGTGGAGACATTC At5g44280 AtRING1a +1192~

9 AtRING1b-F1 AtRING1b-R1 Cloning primers AtRING1a-F1 AtRING1a-R2 AtRING1b-F1 AtRING1b-R2 AtRING1a- FLAG-F LHP1-F1 LHP1-R1 CLF-F1 CLF-R1 5 cgggatccatgccttccttgaa GAGCTT 5 CAGATATCCGCTAGATCAA CAAC 5 gactagtatgtctgtcaagaat AATAG 5 ccgctcgagcacgtccattaggc TCCAAGTTT 5 cgggatccatgccttccttgaa GAGCTT 5 ccgctcgagtcacactgtttgaa TTACTTG 5 agatctatggactacaaagacc ATGACGGTGATTATAAAGATC ATGATATCGATTACAAGGATG ACGATGACAAGggatccATGTCT GTCAAGAATAATAG 5 gaagatctatgaaaggggcaag TGGTG 5 ccgctcgagttaaggcgttcgat TGTACT 5 cgggatccatggcgtcagaagc TTCGC 5 ggaattcgcgttcttccacctgt AAC At1g03770 AtRING1b +1~+21 At1g03770 AtRING1b +730~+707 At5g44280 AtRING1a +1~+21 At5g44280 AtRING1a +3026~+3002 At1g03770 AtRING1b +1~+21 At1g03770 AtRING1b +2693~+2673 At5g44280 AtRING1a +1~+21 At5g17690 LHP1 +1~+20 At5g17690 LHP ~+2015 At2g23380 CLF +1~+20 At2g23380 CLF +4604~+4585 ChIP PCR primers STM-F1 5 CCTTAGATTTATCTTCCTGG At1g62360 STM (I) -362~-343 STM-R1 5 GGCTTTGCTATATAGCTATG At1g62360 STM (I) -36~-55 STM-F2 5 CATAGCTATATAGCAAAGC At1g62360 STM (II) -55~-36 STM-R2 5 AGAATAGGCAGGAGCACAA G At1g62360 STM (II) +285~+266 STM-F3 5 GAGAGAACACTTGATGATT G At1g62360 STM (III) +2667~+2686 STM-R3 5 GGATCGATCAAAGCATGG At1g62360 STM (III) +2934~+2917 KNAT2-F2 5 GATATTATACGCGACTAAC AG At1g70510 KNAT2 (I) -967~-947 KNAT2-R2 5 TTACGGTGGCCGACACCTA At1g70510 KNAT2 (I) -676~-695 KNAT6-F2 5 ACAAGTTTCATTTCCATAGC At1g23380 KNAT6 (I) +1087~+1106 KNAT6-R2 5 CATTCAGTACGCAACAAGC At1g23380 KNAT6 (I) +1425~+1406 AG-F2 5 AAGCTAGATTTGATTCTCTT At4g18960 AG (I) +353~+373 AG-R2 5 CTCAGATCTCCTTTAACTTT G At4g18960 AG (I) +646~+626 The lowercase letters in the primer sequences represent additional nucleotides to introduce restriction sites

10 Supplemental Experimental Procedures Plant materials and growth conditions All Arabidopsis alleles were derived from the Columbia (Col) ecotype. Seeds of mutants Atring1a -/- (AL_945948), Atring1b -/- (SALK_117958), clf -/- (CLF-29) and lhp1 -/- (tlf2-2) were obtained from the Arabidopsis Biological Resource Center (ABRC) and Nottingham Arabidopsis Stock Centre (NASC) ( Double and triple mutants and GUS-reporter constructs, described in the text, were obtained by crossing appropriate plant lines. Plants were grown in the greenhouse under 16h light and 8h dark at 22 C. RT-PCR analysis Total RNA was prepared from plant tissues using TRI Reagent (Invitrogen, After treatment with DNase (Promega, complementary DNA was synthesized using a reverse transcription kit according to the manufacturer s recommendation (Promega). PCR amplification from the cdna template was performed using gene-specific primers (see Supplemental Table S1). Complementation of mutant plants The genomic fragments containing AtRING1a and AtRING1b were isolated from BAC K9L2 and BAC F21M11 by digestion with the restriction enzyme couples XbaI-SalI and SalI-SacI, respectively. They were cloned into the pcambia1300 vector (Cambia, and the resulting constructs were used to transform [26] the Atring1a - /- AtRING1b +/- and AtRING1a +/- Atring1b -/- plants, respectively. In the T1-generation of transformed plants, progeny with the mutant Atring1a -/- Atring1b -/- background containing a transgene were identified by genomic PCR analysis using gene-specific primers (see Supplemental Table S1). Histology and microscopy Small organs or seedlings of wild-type and mutant plants were examined using a LEICA MZ12 dissecting microscope (Leica France, Rueil-Malmaison, France). Higher magnification photographs were taken using a Nikon Eclipse 800 microscope (Nikon France, Champigny sur Marne, France), which was also used for examination of histology sections prepared as

11 described in Yu et al. [26]. Confocal microscopy images were taken using a ZEISS LSM510 microscope (Carl Zeiss, Jena, Germany). Scanning electron microscopy images were taken using a Hitachi S-2460 (Hittachi, Japan). Preparation of thin section specimens and scanning electron microscopy were as described in Chen et al. [27]. Histochemical GUS activity assay Plant material for GUS activity assay was freshly collected and immersed in the GUS staining buffer [26]. After incubation under vacuum for 15min, to facilitate entry of the substrate, the enzymatic reaction was maintained by incubation at 37 C for 14h. Plant material was cleared by 70% ethanol, and observed directly under the dissecting microscope or fixed, sectioned and observed under the Nikon Eclipse 800 microscope. Protein subcellular localization Subcellular localization of AtRING1a and AtRING1b was investigated with GFP- or YFPfused proteins as described previously [26, 28]. The entire coding regions of AtRING1a and AtRING1b cdnas were obtained by RT-PCR from the wild-type Col inflorescences using the primer pairs AtRING1a-F1 with AtRING1a-R2 and AtRING1b-F1 with AtRING1b-R2 (see Supplemental Table S1), respectively. They were fused with the end of GFP or YFP cdna and subcloned under the control of the CaMV 35S promoter. Transgenic plants expressing GFP-fused AtRING1a or YFP-fused AtRING1b were obtained. The GFP and YFP fluorescence images of cells from transgenic plants were taken using the ZEISS LSM510 microscope. Yeast two-hybrid assays CLF and LHP1 cdnas were obtained by RT-PCR from the wild-type Col inflorescences using the primer pairs CLF-F1 with CLF-R1 and LHP1-F1 with LHP1-R1 (see Supplemental Table S1), respectively. These cdnas, as well as the AtRING1a and AtRING1b cdnas, were cloned into the pgbkt7 and pgadt7 vectors (Clontech, AS1 and AS2 constructs were described previously [29]. Construct combinations of a pgadt7- based and a pgbkt7-based expression vector were co-transformed into the yeast strain PHA69-4A, and transformants were selected for growth on media lacking tryptophan and leucine. The interaction between proteins was tested by growth of the transformants on media lacking tryptophan, leucine and adenine

12 Pulldown assays The AtRING1a cdna fused to 3xFLAG tag sequences was obtained by PCR amplification using primers AtRING1a-FLAG-F and AtRING1a-R2 (see Supplemental Table S1), and cloned under the control of the CaMV 35S promoter. Transgenic plants expressing FLAG- AtRING1a were obtained. The CLF and LHP1 cdnas were cloned into the BamHI-XhoI sites of pgex-4t-1 for production of GST-fused proteins. Production and purification of GST- CLF and GST-LHP1 proteins were performed according to the manufacturer s recommendation (Amersham-Pharmacia Biotech, Pulldown experiments were performed according to the previously described protocol [30]. Chromatin Immunoprecipitation (ChIP) ChIP was performed as previously described [28] using 15-day-old seedlings. Antibodies against H3 trimethyl-lys 27 (Upstate Catalogue no , and gene specific PCR-primers (see Supplemental Table S1) were used in the analysis. Supplemental References 26. Yu, Y., Steinmetz, A., Meyer, D., Brown, S., and Shen, W.H. (2003). The tobacco A- type cyclin, Nicta;CYCA3;2, at the nexus of cell division and differentiation. Plant Cell 15, Chen, C., Wang, S., and Huang, H. (2000). LEUNIG has multiple functions in gynoecium development in Arabidopsis. Genesis 26, Xu, L., Zhao, Z., Dong, A., Soubigou-Taconnat, L., Renou, J.P., Steinmetz, A., and Shen, W.H. (2008). Di- and tri- but not monomethylation on histone H3 lysine 36 marks active transcription of genes involved in flowering time regulation and other processes in Arabidopsis thaliana. Mol Cell Biol 28, Xu, L., Xu, Y., Dong, A., Sun, Y., Pi, L., Xu, Y., and Huang, H. (2003). Novel as1 and as2 defects in leaf adaxial-abaxial polarity reveal the requirement for ASYMMETRIC LEAVES1 and 2 and ERACTA functions in specifying leaf adaxial identity. Development 130, Yu, Y., Dong, A., and Shen, W. (2004). Molecular characterization of the tobacco SET domain protein NtSET1 unravels its role in histone methylation, chromatin binding, and segregation. Plant J. 40,