Rictor Forms a Complex with Cullin-1 to Promote SGK1 Ubiquitination and Destruction

Transcription

1 Molecular Cell, Volume 39 Supplemental Information Rictor Forms a Complex with Cullin-1 to Promote SGK1 Ubiquitination and Destruction Daming Gao, Lixin Wan, Hiroyuki Inuzuka, Anders H. Berg, Alan Tseng, Bo Zhai, Shavali Shaik, Eric Bennett, Adriana E. Tron, Jessica A. Gasser, Alan Lau, Steven Gygi, J. Wade Harper, James A. DeCaprio, Alex Toker, and Wenyi Wei

2

3

4

5

6

7

8

9

10

11

12 Supplemental Figure Legends Figure S1. Rictor regulates SGK1 protein expression (related to Figure 1). A. Immunoblot analysis to examine the relative SGK1 expression levels in rictor +/+ and -/- MEFs. Results are shown as means + s.d. for three sets of experiments. A representative anti-sgk1 immunoblot was shown for rictor +/+ and -/- MEFs cultured in 10% FBS-DMEM medium. B. Real-time RT-PCR analysis to examine the relative sgk1 mrna expression levels in Rictor +/+ and -/- MEFs. Results are shown as means + s.d. for three sets of experiments. C. Real-time RT-PCR analysis to examine the relative sgk1 mrna expression levels in HeLa cells infected with the lentiviral shrictor construct (with shgfp as a negative control) and selected with 1 µg /ml puromycin to eliminate the non-infected cells. Results are shown as means + s.d. for three sets of experiments. D. HeLa cells were infected with the indicated lentiviral shrna constructs (with shgfp as a negative control) and selected with 1 µg /ml puromycin to eliminate the non-infected cells. Whole cell lystates were collected for immunoblot analysis. *: Please note that shsin1-a could not efficiently deplete endogenous Sin1 protein, which is included as a negative control. E. Immunoblot (IB) analysis of whole cell lysates (WCL) derived from HeLa cells treated with 20 M LY for the indicated durations of time. Where indicated, 10 M MG132 was added together with LY F. Immunoblot (IB) analysis of whole cell lysates (WCL) derived from HeLa cells treated with 200 nm Wortmannin for the indicated durations of time. Where indicated, 10 M MG132 was added together with Wortmannin. G. Immunoblot (IB) analysis of whole cell lysates (WCL) derived from HeLa cells treated with 100nM Rapamycin for the indicated durations of time. Where indicated, 10 M MG132 was added together with Rapamycin.

13 H. HeLa cells were infected with shrictor lentiviral construct (with shgfp as a negative control) and selected with 1 µg /ml puromycin to eliminate the non-infected cells. The resulting two cell lines were treated with 20 g/ml cycloheximide. At the indicated time points, whole-cell lysates were prepared and immunoblots were probed with indicated antibodies. The SGK1 band intensity was normalized to tubulin, then normalized to the t=0 controls. I-J. Wild type or Rictor-/- MEFs were serum starved for 24 hours. After addition of 100 nm Insulin (I) or 100 ng/ml IGF-1 (J), whole cell lysates were collected at the indicated time points for immunoblot analysis with the indicated antibodies. Figure S2. Rictor interacts with Cullin-1 to promote SGK1 ubiquitination (related to Figure 2). A. Immunoblot (IB) analysis of whole cell lysates (WCL) and anti-ha immunoprecipitates of HCT116 cells transfected with the indicated plasmids. Twenty hours post-transfection, cells were treated with the proteasome inhibitor MG132 overnight before harvesting. B. Immunoblot (IB) analysis of whole cell lysates (WCL) and anti-ha immunoprecipitates of 293T cells transfected with the indicated plasmids. Twenty hours post-transfection, cells were treated with the proteasome inhibitor MG132 overnight before harvesting. C. Immunoblot (IB) analysis of whole cell lysates (WCL) and anti-myc immunoprecipitates derived from 293T cells transfected with HA-Rictor and the indicated Myc-Cullin plasmids. Twenty hours posttransfection, cells were treated with the proteasome inhibitor MG132 overnight before harvesting. D. Immunoblot (IB) analysis of whole cell lysates (WCL) and anti-myc immunoprecipitates derived from 293T cells transfected with the indicated Myc-Cullin plasmids. Twenty hours post-transfection, cells were treated with the proteasome inhibitor MG132 overnight before harvesting.

14 Figure S3. Rictor forms a novel complex with Cullin-1 and Rbx1 to control SGK1 turnover (related to Figure 3). A. Immunoblot (IB) analysis of 293T cell whole cell lysates (WCL) and anti-rictor and anti-mtor immunoprecipitates (IP). Rabbit IgG was used as a negative control for the immunoprecipitation procedure. WCL were collected with CHAPS buffer and IPs were washed with CHAPS buffer. B. Immunoblot (IB) analysis of whole cell lysates (WCL) and anti-ha immunoprecipitates derived from 293T cells transfected with HA-Cullin-1 and the indicated Myc-mTOR or Myc-Rictor plasmids. WCL were collected with CHAPS buffer and IPs were washed with CHAPS buffer. C. Immunoblot (IB) analysis of whole cell lysates (WCL) and anti-myc immunoprecipitates derived from 293T cells transfected with Myc-Cullin or Myc-mTOR plasmid. Twenty hours post-transfection, cells were treated with the proteasome inhibitor MG132 overnight before harvesting. IPs were performed with either NP40-containing EBC buffer or CHAPS buffer. D. Immunoblot (IB) analysis of whole cell lysates (WCL) and anti-ha immunoprecipitates derived from 293T cells transfected with HA-Cullin or HA-Sin1 plasmid. Twenty hours post-transfection, cells were treated with the proteasome inhibitor MG132 overnight before harvesting. IPs were performed with either NP40-containing EBC buffer or CHAPS buffer. E. Immunoblot (IB) analysis of whole cell lysates (WCL) and anti-myc immunoprecipitates derived from 293T cells transfected with HA-Rictor and the indicated Myc-Cullin-1 plasmids. Twenty hours posttransfection, cells were treated with the proteasome inhibitor MG132 overnight before harvesting. F. Immunoblot analysis of HeLa cells transfected with the indicated sirna oligos, after synchronization with nocodazole and release. G. Gel filtration experiment to illustrate that there might be two different pools of Rictor containing complexes and that Rictor comigrates with Cullin-1 and Rbx1. Immunoblot analysis of the indicated fractionations derived from the gel filtration experiment with HeLa whole cell lysates harvested in CHAPS buffer. Prior to running cell lysates, the molecular weight resolution of the column was first estimated by running native molecular weight markers (Urease ~550KD, mouse IgG ~180KD and

15 human serum albumin ~68KD) and determining their retention times on coomassie-stained SDS- PAGE protein gels. H. Immunoblot (IB) analysis of whole cell lysates (WCL) and anti-ha immunoprecipitates of 293T cells transfected with the HA-Rbx1 and Myc-Rictor plasmids (or empty vector as a negative control). Twenty hours post-transfection, cells were treated with the proteasome inhibitor MG132 overnight before harvesting. I. Immunoblot (IB) analysis of whole cell lysates (WCL) and anti-ha immunoprecipitates derived from 293T cells transfected with the indicated HA-Rbx1 plasmids. Twenty hours post-transfection, cells were treated with the proteasome inhibitor MG132 overnight before harvesting. J. Immunoblot (IB) analysis of whole cell lysates (WCL) and anti-myc immunoprecipitates derived from 293T cells transfected with Myc-Rictor plasmid (with empty vector plasmid as a negative control). Twenty hours post-transfection, cells were treated with the proteasome inhibitor MG132 overnight before harvesting. The immunopurified Cullin-1/Rictor complexes were incubated with purified recombinant SGK proteins (from Genway), purified E1, E2 and ubiquitin in 30 C for 45 minutes. The ubiquitination reaction products were resolved by SDS-PAGE and probed with anti-sgk1 antibody. *: non-specific band. K. Immunoblot (IB) analysis of whole cell lysates (WCL) and immunoprecipitates (IP) derived from 293T cells transfected with HA-Rictor or HA-Fbw7 constructs together with the indicated Myc- Cullin-1 or Myc-Skp1 constructs. Thirty hours post-transfection, cells were pretreated with 10 µm MG132 for 10 hours to block the proteasome pathway before harvesting. L. U2-OS cells were infected with lentiviral shrbx1 construct (with shgfp as a negative control) and selected with 1 µg /ml puromycin to eliminate the non-infected cells. Whole cell lystates were collected for immunoblot analysis. M. Immunoblot (IB) analysis of whole cell lysates (WCL) and immunoprecipitates (IP) derived from 293T cells transfected with the indicated Myc-Rictor and HA-Cullin-1 constructs together with the indicated sirna oligos.

16 N. Immunoblot (IB) analysis of whole cell lysates (WCL) and immunoprecipitates (IP) derived from 293T cells transfected with the indicated Myc-Rictor, Flag-Ub and HA- 60-SGK1 constructs together with the indicated sirna oligos. Thirty hours post-transfection, cells were pretreated with 10 µm MG132 for 10 hours to block the proteasome pathway before harvesting. O. Schematic representation of the various Myc-Rictor constructs used in B-D. P. Immunoblot (IB) analysis of whole cell lysates (WCL) and Myc-immunoprecipitates derived from 293T cells transfected with the indicated Myc-Rictor plasmids. Q. Immunoblot (IB) analysis of whole cell lysates (WCL) and anti-myc immunoprecipitates of 293T cells transfected with HA-Cullin-1 and the indicated Myc-Rictor plasmids. Twenty hours post-transfection, cells were treated with the proteasome inhibitor MG132 overnight before harvesting. R. Immunoblot (IB) analysis of whole cell lysates (WCL) and immunoprecipitates (IP) derived from 293T cells transfected with HA- 60-SGK1 together with His-Ub and various Myc-Rictor constructs. Twenty hours post-transfection, cells were treated with the proteasome inhibitor MG132 overnight before harvesting. The whole cell lysates were collected in EDTA-free lysis buffer and the His-pull down was carried out in the presence of 8 M Urea to disrupt possible protein interactions. Figure S4. Rictor is phosphorylated in vivo at T1135 (related to Figure 4). A. Rictor, but not Raptor can be phosphorylated by multiple AGC family of kinases in vivo. Immunoblot (IB) analysis of whole cell lysates (WCL) and immunoprecipitates (IP) derived from 293T cells transfected with Myc-Rictor or HA-Raptor together with the indicated HA-tagged AGC family of kinases. B. Detection of in vivo Rictor T1135 phosphorylation by mass spectrometry analysis. C. Immunoblot analysis (IB) of whole cell lysates (WCL) and immunoprecipitates (IP) derived from 293T cells infected with HA-tagged wild type or T1135A Rictor constructs.

17 D. Immunoblot (IB) analysis of whole cell lysates (WCL) derived from HeLa cells with or without - phosphatase treatment. E. HeLa cells were serum starved for 24 hours followed by addition of 100 nm Insulin. Various pharmacological kinase inhibitors (100 nm Rapamycin, 20 M LY294002, 200 nm Wortmannin and 10 M Akt inhibitor, with DMSO as a negative control) were added together with Insulin. Forty minutes later, whole cell lysates (WCL) were collected for immunoblot analysis. Figure S5. Phosphorylation of Rictor at T1135 disrupts the interaction between Cullin-1 and Rictor (related to Figure 5). A. Immunoblot (IB) analysis of whole cell lysates (WCL) and immunoprecipitates (IP) derived from 293T cells transfected with the indicated Myc-Rictor constructs in the presence or absence of HA- 60-SGK1. B. Immunoblot (IB) analysis of whole cell lysates (WCL) and anti-myc immunoprecipitates derived from 293T cells transfected with the indicated Myc-Rictor plasmids in the presence of Flag Twenty hours post-transfection, cells were either serum starved for 36 hours or 10% FBS was added to the serum starved cells for 1.5 hours before harvesting. Where indicated, 20 M LY was added to further suppress Rictor T1135 phosphorylation. C. 293T cells were transiently tranfected with Myc-tagged WT, T1135A and T1135E Rictor constructs. Thirty hours post-transfection, whole cell lystates were collected for immunoblots with the indicated antibodies, and also for GST pull-down assays to examine their ability to interact with GST protein (with GST protein as a negative control). D. Immunoblot (IB) analysis of whole cell lysates (WCL) and immunoprecipitates (IP) derived from 293T cells transfected with the indicated Myc-Rictor constructs in the presence or absence of HA- 60-SGK1. Where indicated, high-affinity interacting R18 peptides were added to the whole cell lysates 30 minutes prior to the Myc-IP.

18 E. HeLa cells were transiently transfected with HA-WT-Rictor and Myc-T1135E-Rictor constructs. Thirty hours post-transfection, whole cell lysates were collected in CHAPS buffer and subjected to gel filtration chromography. Tandem size exclusion columns (Superose 6 and Superdex 200 columns in series) were used to enhance the separation efficiency. Immunonblot analysis were performed with various antibodies for the indicated fractionations. Prior to running the cell lysates, the molecular weight resolution of the column was first estimated by running native molecular weight markers (Urease ~550KD, mouse IgG ~180KD and human serum albumin ~68KD) and determining their retention times on coomassie-stained SDS-PAGE protein gels. *: non-specific band. F. Immunoblot (IB) analysis of whole cell lysates (WCL) and immunoprecipitates (IP) derived from 293T cells transfected with the indicated HA-Rictor and Myc-Cullin-1 constructs. G. Immunoblot (IB) analysis of whole cell lysates (WCL) and immunoprecipitates (IP) derived from HeLa cells transfected with the indicated HA-Cullin-1 construct (with Empty Vector plasmid as a negative control). Thirty hours post-transfection, cells were pretreated with 10 µm MG132 for 10 hours to block the proteasome pathway before harvesting. H. Immunoblot (IB) analysis of whole cell lysates (WCL) and immunoprecipitates (IP) derived from 293T cells transfected with the indicated Flag- 60-SGK1, HA-Cullin-1 and Myc-Rictor (WT or T1135E) constructs. Thirty hours post-transfection, cells were pretreated with 10 µm MG132 for 10 hours to block the proteasome pathway before harvesting. I. HeLa cells were transfected with the pcdna3-ha-cullin-1 constuct (with empty pcdna3 vector as a negative control). Forty hours post-transfection, cells were selected with 800 g/ml G418 for 2 weeks to generate the stable cell lines expressing HA-Cullin-1. Whole cell lysates were collected for HAimmunoprecipitations and immunoblots with the indicated antibodies. J. Immunoblot (IB) analysis of whole cell lysates (WCL) and HA-immunoprecipitates (IP) derived from stable HA-Cullin-1 HeLa cell line. Where indicated, HA-peptides were used as a negative control to

19 indicate that the interaction between Rictor and HA-Cullin-1 depends on successful HA immunoprecipitation. Figure S6. Phosphorylation of Rictor at T1135 impairs its ability to promote SGK1 ubiquitination and destruction (related to Figure 6). A. Immunoblot (IB) analysis of whole cell lysates (WCL) and immunoprecipitates (IP) derived from 293T cells transfected with HA- 60-SGK1, HA-Akt1 or HA-S6K together with Flag-Ub and the indicated Myc-Rictor constructs. Twenty hours post-transfection, cells were treated with the proteasome inhibitor MG132 overnight before harvesting. B. Immunoblot (IB) analysis of whole cell lysates (WCL) and anti-ha immunoprecipitates derived from 293T cells transfected with the HA- 60-SGK1 construct together with the indicated Myc-Rictor constructs. Twenty hours post-transfection, cells were treated with the proteasome inhibitor MG132 overnight before harvesting. C. Wild type or rictor-/- MEFs were transfected with the indicated Rictor plasmids (with empty vector as a negative control) together with the pbabe-puro retroviral empty vector. Twenty-four hours posttransfection, the cells were treated with 1 g/ml puromycin for hours to kill the non-transfected cells prior to collecting the whole cell lysates for immunoblots. D. Immunoblot analysis (IB) of HeLa cells transfected with the indicated sirna oligos. The pt1135- Rictor and SGK1 band intensities were normalized against tubulin, then normalized against the luciferase sirna treated sample. The quantification of the band intensities for pt1135-rictor and SGK1 in each lane is shown under the respective immunoblot image as indicated in the figure panel. E. Immunoblot analysis (IB) of HeLa cells transfected with the indicated sirna oligos, after synchronization with nocodazole and release. F. Immunoblot (IB) analysis of whole cell lysates (WCL) derived from a panel of breast cancer cell lines to demonstrate the positive correlation between Rictor T1135 phoshorylation and SGK1 abundance.

20 Supplemental Experimental Procedures Plasmids: Plasmids to express myc-rictor, myc-raptor, HA-Raptor, myc-mtor and myc-mtor kinase dead were obtained from Addgene. The HA-Rictor vector was a kind gift from Dr. Do-Hyung Kim. The myc-rictor truncations and were gifts from Dr. Brendan Manning. Plasmids to express HA-myr- Akt were described previously (Gao et al., 2009); the HA-S6K1-CA and HA-S6K1-KD constructs were obtained from Dr. John Blenis; the HA-SGK1 and HA- 60-SGK1 constructs were a kind gift from Dr. Suzanne Conzen. pcdna3-ha-cullin1 was generated by inserting the Cullin-1 coding sequence into the pcdna3-ha vector. HA-tagged WT, N14, N23 and N41-Rbx1 constructs were kind gifts from Dr. Yue Xiong (Furukawa et al., 2002). The HA-Sin1 plasmid was a kind gift from Dr. Bing Su. Flag and pgex were kind gifts from Dr. Lewis Cantley and Dr. Hui-Kuan Lin, respectively. The Myc- K720R-Cullin-1 mutant, Rictor mutants and truncations were generated using the QuikChange XL Site- Directed Mutagenesis Kit (Stratagene) according to the manufacturer s instructions. Antibodies and Reagents: Anti c-myc antibody (SC-40), polyclonal anti-ha antibody (SC-805), anti-cyclin A antibody (SC-751), anti-skp1 antibody (sc-7163), anti-cullin-1 antibody (sc-70895), anti-rictor antibody (sc-81538), anti- Raptor antibody (sc-81537), anti-cyclin B antibody (SC-245), anti-phospho-ser422-sgk antibody (SC R) and anti antibody (SC-629) were purchased from Santa Cruz. Anti-mTOR antibody (2972), anti-pser2481-mtor antibody (2974), anti-pthr346-ndrg1 antibody (3217), anti-raptor antibody (2280), anti-s6k antibody (9202), anti-phospho-ser473-akt antibody (4051), anti-phospho- Thr389-S6K antibody (9205), anti-phospho-akt substrate antibody (9614), anti-phospho binding motif antibody (9608) were purchased from Cell Signaling. Anti-Rictor antibodies (A A, A A), anti-mtor antibodies (A A, A A), anti-raptor antibody (A A) and anti- Sin1 antibody (A A) were purchased from Bethyl. Anti-SGK1 antibody (KAP-PK015) was from

21 Stressgen. Anti-phospho-Thr1135- Rictor antibody was a kind gift from Cell Signaling. Anti-tubulin antibody (T-5168), polyclonal anti-flag antibody (F2425), monoclonal anti-flag antibody (F-3165), anti-vinculin antibody (V4505), peroxidase-conjugated anti-mouse secondary antibody (A4416) and peroxidase-conjugated anti-rabbit secondary antibody (A4914) were purchased from Sigma. Monoclonal anti-ha antibody (MMS-101P) was purchased from Covance. Monoclonal anti-cullin-1 antibody ( ) and anti-skp2 antibody ( ) were purchased from Invitrogen. Anti-Brdu antibody (555627) was purchased from BD Biosciences. Anti-Rbx1 anti-body (RB-069P1) was purchased from Neomarker. sirna and shrna treatment: shrna vectors to knock down Rictor, Raptor, mtor and Sin1 were purchased from Addgene. shrbx1 lentiviral vector was purchased from Open Biosystems. plko lentiviral expression vectors to knock down S6K and SGK were kind gifts from Dr. William Hahn. plko lentiviral vector to knock down Akt1 was described previously (Gao et al., 2009), and virus generated in 293T cells for infection, as described (Boehm et al., 2005). A luciferase GL2 sirna oligo was purchased from Dharmacon, and the sirnas to knock down PTEN were described previously (Gao et al., 2009). sirna oligos to deplete endogenous Rbx1 (AACUGUGCCAUCUGCAGGAACAA) (Jia et al., 2009), Cullin1 (GGUCGCUUCAUAAAC AACAUU) (Benmaamar and Pagano, 2005), and Rictor (AAACUUGUGAAGAAUCGUAUCUU (Sarbassov et al., 2005), AAAGACUACAGCAACAAAGAAUU (Joshi et al., 2008)) were synthesized by Dharmacon. Cocktailed sirnas targeting Skp1 were purchased from Invitrogen ( ). sirna oligos were transfected into subconfluent cells using Oligofectamine or Lipofectamine 2000 (Invitrogen) according to the manufacturer s instructions (Wei et al., 2004; Wei et al., 2005). Immunoblots and Immunoprecipitation: Cells were lysed in EBC (50 mm Tris ph 7.5, 120 mm NaCl, 0.5% NP-40) buffer or CHAPS buffer (25 mm HEPES ph7.4, 150 mm NaCl, 1 mm EDTA, 0.3% CHAPS) supplemented with protease inhibitors (Complete Mini, Roche) and phosphatase inhibitors (phosphatase inhibitor cocktail set I and II,

22 Calbiochem). 2 mm 1,10-Phenanthroline was used for endogenous Cullin-1 immunoprecipitation to prevent the de-neddylation of Cullin-1. The protein concentrations of the lysates were measured using the Bio-Rad protein assay reagent on a Beckman Coulter DU-800 spectrophotometer. The lysates were then resolved by SDS-PAGE and immunoblotted with indicated antibodies. For immunoprecipitation, 800 g lysates were incubated with the appropriate antibody (1-2 g) for 3-4 hours at 4 C followed by one hour incubation with Protein A sepharose beads (GE Healthcare). Immuno-complexes were washed five times with NETN buffer (20 mm Tris, ph 8.0, 100 mm NaCl, 1 mm EDTA and 0.5% NP-40) before being resolved by SDS-PAGE and immunoblotted with indicated antibodies. MEF Transfection: rictor -/- or control MEFs were transfected with Lipofectamine LTX following the manufacturer s protocol (Invitrogen). Twenty four hours after transfection, cells were split into puromycin containing media and harvested 40 hours later to eliminate non-transfected cells. R18 Peptide Competition Assay R18 peptide was purchased from BIOMOL (P-214) and dissolved in water. Cell lysate was incubated with 25 M R18 peptide for 30min before the indicated IP was performed. Bromodeoxyuridine Labeling Bromodeoxyuridine (BrdU) labeling assay was performed as described previously (Wei et al., 2001). Experiments were repeated three times to generate the error bars.

23 Supplemental References Benmaamar, R., and Pagano, M. (2005). Involvement of the SCF complex in the control of Cdh1 degradation in S-phase. Cell Cycle 4, Furukawa, M., Ohta, T., and Xiong, Y. (2002). Activation of UBC5 ubiquitin-conjugating enzyme by the RING finger of ROC1 and assembly of active ubiquitin ligases by all cullins. J Biol Chem 277, Jia, L., Soengas, M. S., and Sun, Y. (2009). ROC1/RBX1 E3 ubiquitin ligase silencing suppresses tumor cell growth via sequential induction of G2-M arrest, apoptosis, and senescence. Cancer Res 69, Joshi, J., Fernandez-Marcos, P. J., Galvez, A., Amanchy, R., Linares, J. F., Duran, A., Pathrose, P., Leitges, M., Canamero, M., Collado, M., et al. (2008). Par-4 inhibits Akt and suppresses Ras-induced lung tumorigenesis. Embo J 27, Wei, W., Ayad, N. G., Wan, Y., Zhang, G. J., Kirschner, M. W., and Kaelin, W. G., Jr. (2004). Degradation of the SCF component Skp2 in cell-cycle phase G1 by the anaphase-promoting complex. Nature 428, Wei, W., Hemmer, R. M., and Sedivy, J. M. (2001). Role of p14(arf) in replicative and induced senescence of human fibroblasts. Mol Cell Biol 21, Wei, W., Jin, J., Schlisio, S., Harper, J. W., and Kaelin, W. G., Jr. (2005). The v-jun point mutation allows c-jun to escape GSK3-dependent recognition and destruction by the Fbw7 ubiquitin ligase. Cancer Cell 8,