Supplemental Fig. 1. Mcr alleles show defects in tracheal tube size and luminal protein accumulation. (A-F) Confocal projections of living stage 15

SUPPLEMENTARY INFORMATION

Normalized dorsal trunk length (µm) Normalized dorsal trunk length (TC1-5) (µm) DOI: 1.138/ncb2467 a b c d btl>src64 Src42, btl>src64 e Src64 f g h DT Src64 DT Midgut Src64 Midgut i Src64 Atpα j k l DT

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb3374 Supplementary Figure 1 staccato mutations affect a late step of the tube fusion process. (a) Immunostaining of stage 15 embryos labeled with anti- Dys (green in merge) and a probe

fga phenotypes were also analyzed in the tracheal system, the organ responsible for

SUPPLEMENTARY TEXT Tracheal defects fga phenotypes were also analyzed in the tracheal system, the organ responsible for oxygen delivery in the fly. In fga homozygous mutant alleles, we observed defects

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying

T H E J O U R N A L O F C E L L B I O L O G Y

Supplemental material Wang et al., http://www.jcb.org/cgi/content/full/jcb.201405026/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Generation and characterization of unc-40 alleles. (A and

Sol narae (Sona) is a Drosophila ADAMTS involved in Wg signaling

Sol narae (Sona) is a Drosophila ADAMTS involved in Wg signaling Go-Woon Kim, Jong-Hoon Won, Ok-Kyung Lee, Sang-Soo Lee, Jeong-Hoon Han, Orkhon Tsogtbaatar, Sujin Nam, Yeon Kim, and Kyung-Ok Cho* Supplementary

Supplemental Data. Hachez et al. Plant Cell (2014) /tpc Suppl. Figure 1A

Suppl. Figure 1A Suppl. Figure 1B Supplemental Figure 1: Results of the commercial screening of interactants using split ubiquitin technique. (A) Isolated preys (192) using the bait construct pbt3-n- as

Figure S1. Verification of ihog Mutation by Protein Immunoblotting Figure S2. Verification of ihog and boi

Figure S1. Verification of ihog Mutation by Protein Immunoblotting Extracts from S2R+ cells, embryos, and adults were analyzed by immunoprecipitation and immunoblotting with anti-ihog antibody. The Ihog

supplementary information

DOI: 10.1038/ncb1898 Figure S1 stit is a direct target gene of Grh. (a) stit mrna and protein were detected in epidermis, foregut and hindgut of wild type embryos. (b) Quantitative real-time Reverse-Transcription

PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF

YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full//59/ra7/dc1 Supplementary Materials for Dok-7 ctivates the Muscle Receptor Kinase MuSK and Shapes Synapse Formation kane Inoue, Kiyoko Setoguchi, Yosuke Matsubara,

Nature Structural & Molecular Biology: doi: /nsmb.3308

Supplementary Figure 1 Analysis of CED-3 autoactivation and CED-4-induced CED-3 activation. (a) Repeat experiments of Fig. 1a. (b) Repeat experiments of Fig. 1b. (c) Quantitative analysis of three independent

The transmembrane protein Macroglobulin complement-related is essential for septate junction formation and epithelial barrier function in Drosophila

2014. Published by The Company of Biologists Ltd (2014) 141, 899-908 doi:10.1242/dev.102160 RESEARCH ARTICLE The transmembrane protein Macroglobulin complement-related is essential for septate junction

Control of cortex development by ULK4, a rare risk gene for mental disorders including schizophrenia

Control of cortex development by ULK4, a rare risk gene for mental disorders including schizophrenia Bing Lang, Lei Zhang, Guanyu Jiang, Ling Hu, Wei Lan, Lei Zhao, Irene Hunter, Michal Pruski, Ning-Ning

sides of the aleurone (Al) but it is excluded from the basal endosperm transfer layer

Supplemental Data. Gómez et al. (2009). The maize transcription factor MRP-1 (Myb-Related-Protein-1) is a key regulator of the differentiation of transfer cells. Supplemental Figure 1. Expression analyses

To assess the localization of Citrine fusion proteins, we performed antibody staining to

Trinh et al 1 SUPPLEMENTAL MATERIAL FlipTraps recapitulate endogenous protein localization To assess the localization of Citrine fusion proteins, we performed antibody staining to compare the expression

GFP CCD2 GFP IP:GFP

D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant

Figure legends for supplement

Figure legends for supplement Supplemental Figure 1 Characterization of purified and recombinant proteins Relevant fractions related the final stage of the purification protocol(bingham et al., 1998; Toba

Biology Open (2015) 000, 1 16 doi: /bio

Supplementary Material Annekatrin König and Halyna R. Shcherbata doi: 10.1242/ bio.201410553 Fig. S1. Histones are differentially modified in somatic and germline cells in the germarium. Wildtype (OregonR)

Figure S1. USP-46 is expressed in several tissues including the nervous system

Supplemental Figure legends Figure S1. USP-46 is expressed in several tissues including the nervous system Transgenic animals expressing a transcriptional reporter (P::GFP) were imaged using epifluorescence

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

Supporting information

Supporting information Construction of strains and plasmids To create ptc67, a PCR product obtained with primers cc2570-162f (gcatgggcaagcttgaggacggcgtcatgt) and cc2570+512f (gaggccgtggtaccatagaggcgggcg),

Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.

Supplementary Figure 1 Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. (left) Representative bright-field images of wild type (wt), heterozygous (het)

(A) Schematic depicting morphology of cholinergic DA and DB motor neurons in an L1

SUPPLEMENTAL MATERIALS Supplemental Figure 1 Figure S1. Expression of the non-alpha nachr subunit ACR-2. (A) Schematic depicting morphology of cholinergic DA and DB motor neurons in an L1 animal. Wide-field

Supplement Figure S1:

Supplement Figure S1: A, Sequence of Xcadherin-11 Morpholino 1 (Xcad-11MO) and 2 (Xcad-11 MO2) and control morpholino in comparison to the Xcadherin-11 sequence. The Xcad-11MO binding sequence spans the

Supplemental Data. Wang et al. (2016). Plant Cell /tpc

Supplemental Figure 1. Time-Course Analysis of Storage Proteins during Endosperm Development of the Wild-type 9311 and the gpa4-1 Mutant. (A) SDS-PAGE analyses of seed storage proteins during wild-type

Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various

Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

Supplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical

Supplemental Figure Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical in all six REEPs are highlighted in green. Additional

Nature Biotechnology: doi: /nbt.4166

Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained

Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin

Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin (WGA-Alexa555) was injected into the extracellular perivitteline

Supplementary Information

Supplementary Information Selective control of inhibitory synapse development by Slitrk3-PTPδ trans-synaptic interaction Hideto Takahashi 1, Kei-ichi Katayama 2, Kazuhiro Sohya 3,4, Hiroyuki Miyamoto 4,5,

Supplementary Fig. 1: Ultrastructural localization of Hh, Ihog and Disp in wing discs. A) Thawed 200 nm thick cryosections of wing disc expressing

Supplementary Fig. 1: Ultrastructural localization of Hh, Ihog and Disp in wing discs. A) Thawed 200 nm thick cryosections of wing disc expressing Hh-GFP were immunostained with an anti-gfp antibody followed

Supplemental Data. Farmer et al. (2010) Plant Cell /tpc

Supplemental Figure 1. Amino acid sequence comparison of RAD23 proteins. Identical and similar residues are shown in the black and gray boxes, respectively. Dots denote gaps. The sequence of plant Ub is

DRG Pituitary Cerebral Cortex

Liver Spinal cord Pons Atg5 -/- Atg5 +/+ DRG Pituitary Cerebral Cortex WT KO Supplementary Figure S1 Ubiquitin-positive IBs accumulate in Atg5 -/- tissues. Atg5 -/- neonatal tissues were fixed and decalcified.

Supplemental Fig. 1. Transient expression of dynamic reporters of DNA methylation (DYNAMETs) in plants. (A) Schematic representation of potential

Supplemental Fig. 1. Transient expression of dynamic reporters of DNA methylation (DYNAMETs) in plants. (A) Schematic representation of potential dynamic reporter of DNA methylation (DYNAMET). A DYNAMET

Supplementary Figure 1. Espn-1 knockout characterization. (a) The predicted recombinant Espn-1 -/- allele was detected by PCR of the left (5 )

Supplementary Figure 1. Espn-1 knockout characterization. (a) The predicted recombinant Espn-1 -/- allele was detected by PCR of the left (5 ) homologous recombination arm (left) and of the right (3 )

Supplementary Data Supplementary Figures

Supplementary Data Supplementary Figures Supplementary Figure 1. Pi04314 is expressed during infection, each GFP-Pi04314 fusion is stable and myr GFP-Pi04314 is removed from the nucleus while NLS GFP-Pi04314

To investigate the heredity of the WFP gene, we selected plants that were homozygous

Supplementary information Supplementary Note ST-12 WFP allele is semi-dominant To investigate the heredity of the WFP gene, we selected plants that were homozygous for chromosome 1 of Nipponbare and heterozygous

a) Stock 4: 252 flies total: 120 are P[w+]: 64 are CyO; 56 are TM3; all are females. 132 are w-: 68 are CyO; 64 are TM3; all are males.

Drosophila Problem Set 2018 1) You have created P element transformants of a construct that contains the mini-white gene, which confers an orange eye color in a homozygous white mutant background. For

Supplemental Materials

Supplemental Materials Supplemental Figure S. Phenotypic assessment of alb4 mutant plants under different stress conditions. (A) High-light stress and drought stress. Wild-type (WT) and alb4 mutant plants

SUPPLEMENTARY INFORMATION

b Supplementary Figure 1. Analysis of Vkg-Dpp interactions. a, In vitro pulldown showing binding of Dpp-HA to the GST-VkgC fusion protein. No interaction is detected between denatured Dpp-HA and GST-Vkg.

SUPPLEMENTARY INFORMATION

DOI:.38/ncb327 a b Sequence coverage (%) 4 3 2 IP: -GFP isoform IP: GFP IP: -GFP IP: GFP Sequence coverage (%) 4 3 2 IP: -GFP IP: GFP 33 52 58 isoform 2 33 49 47 IP: Control IP: Peptide Sequence Start

Supplemental Information

Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure

Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression

Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,

Supplemental Data. Sethi et al. (2014). Plant Cell /tpc

Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes

Supplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.

Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected

indicated numbers of pups at day of life (DOL) 10, or embryonic day (ED) B. Male mice of

SUPPLEMENTRY FIGURE LEGENDS Figure S1. USP44 loss leads to chromosome missegregation.. Genotypes obtained from the indicated numbers of pups at day of life (DOL) 10, or embryonic day (ED) 13.5.. Male mice

GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts

Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan

- PDI5. - Actin A 300-UTR5. PDI5 lines WT. Arabidopsis Chromosome 1. PDI5 (At1g21750) SALK_ SALK_ SALK_015253

Supplemental Data. Ondzighi et al. (2008). Arabidopsis Protein Disulfide Isomerase-5 Inhibits ysteine Proteases During Trafficking to Vacuoles Prior to Programmed ell Death of the dothelium in Developing

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Kanaani et al., http://www.jcb.org/cgi/content/full/jcb.200912101/dc1 Figure S1. The K2 rabbit polyclonal antibody is specific for GAD67,

Mitotic cell rounding and epithelial thinning regulate lumen

Mitotic cell rounding and epithelial thinning regulate lumen growth and shape Esteban Hoijman, Davide Rubbini, Julien Colombelli and Berta Alsina SUPPLEMENTARY FIGURES Supplementary Figure 1 (a-c) Localization

SUPPLEMENTARY INFORMATION

a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm

SUPPLEMENTARY INFORMATION

Supplementary Figure 1 sirna and shrna mediated depletion of ATP7A results in loss of melanosomal ATP7A staining. a-h, sirna mediated ATP7A depletion. Immunofluorescence microscopy (IFM) analysis of ATP7A

Supplemental Information. Stratum, a Homolog of the Human GEF Mss4, Partnered with Rab8, Controls the Basal Restriction

Cell Reports, Volume 18 Supplemental Information Stratum, a Homolog of the Human GEF Mss4, Partnered with Rab8, Controls the Basal Restriction of Basement Membrane Proteins in Epithelial Cells Olivier

Chitinases and Imaginal disc growth factors organize the extracellular matrix

Supplementary Information Chitinases and Imaginal disc growth factors organize the extracellular matrix formation at barrier tissues in insects Yanina-Yasmin Pesch a,b, Dietmar Riedel c, Kapil R Patil

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

Supplemental Information. Boundary Formation through a Direct. Threshold-Based Readout. of Mobile Small RNA Gradients

Developmental Cell, Volume 43 Supplemental Information Boundary Formation through a Direct Threshold-Based Readout of Mobile Small RNA Gradients Damianos S. Skopelitis, Anna H. Benkovics, Aman Y. Husbands,

Fig. S1. TPL and TPL N176H protein interactions. (A) Semi-in vivo pull-down assays using recombinant GST N-TPL and GST N-TPL N176H fusions and

Fig. S1. TPL and TPL N176H protein interactions. (A) Semi-in vivo pull-down assays using recombinant GST N-TPL and GST N-TPL N176H fusions and transgenic Arabidopsis TPL-HA lysates. Immunoblotting of input

a) Stock 4: 126 flies total: 120 are P[w+]: 64 are CyO; 56 are TM3; all are females. 132 are w-: 68 are CyO; 64 are TM3; all are males.

Drosophila Problem Set 2012 1) You have created P element transformants of a construct that contains the mini-white gene, which confers an orange eye color in a homozygous white mutant background. For

Supplemental Data. Wang et al. (2017). Plant Cell /tpc NIP1;2 NIP7;1

Supplemental Data. Wang et al. (217). Plant Cell 1.115/tpc.16.825 NIP1;1 NIP1;2 NIP2;1 NIP3;1 NIP4;1 NIP5;1 NIP6;1 NIP7;1 Supplemental Figure 1. Distinct Localization of NIPs in Root Epidermal Cells. (Supports

Fig. S1. Molecular phylogenetic analysis of AtHD-ZIP IV family. A phylogenetic tree was constructed using Bayesian analysis with Markov Chain Monte

Fig. S1. Molecular phylogenetic analysis of AtHD-ZIP IV family. A phylogenetic tree was constructed using Bayesian analysis with Markov Chain Monte Carlo algorithm for one million generations to obtain

Supplemental Data Supplemental Figure 1.

Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)

Supplementary Figure 1. The LIR motif in Kenny is necessary for its targeting to the lysosomes. (a-b) Confocal sections from fat body cells from

Supplementary Figure 1. The LIR motif in Kenny is necessary for its targeting to the lysosomes. (a-b) Confocal sections from fat body cells from larvae expressing GFP-Kenny WT (a-a ) or GFP-Kenny F7A/L10A

(phosphatase tensin) domain is shown in dark gray, the FH1 domain in black, and the

Supplemental Figure 1. Predicted Domain Organization of the AFH14 Protein. (A) Schematic representation of the predicted domain organization of AFH14. The PTEN (phosphatase tensin) domain is shown in dark

DOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

Supplementary Figure 1.

Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate

Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking

Regulation of Acetylcholine Receptor Clustering by ADF/Cofilin- Directed Vesicular Trafficking Chi Wai Lee, Jianzhong Han, James R. Bamburg, Liang Han, Rachel Lynn, and James Q. Zheng Supplementary Figures

Fig. S1. Inhibition of Rh1 accumulation on the rhabdomere membrane in CG13089 PIG-U mutants. (A) Late pupae with dark wings were put into 0.

Fig. S1. Inhibition of Rh1 accumulation on the rhabdomere membrane in CG13089 PIG-U mutants. (A) Late pupae with dark wings were put into 0.2% agar after the pupal case was partially removed. Two fluorescent

Supplemental Materials

Supplemental Materials Flores-Pérez et al., Supplemental Materials, page 1 of 5 Supplemental Figure S1. Pull-down and BiFC controls, and quantitative analyses associated with the BiFC studies. (A) Controls

α-mannosidase II (HGL1/MANII) β1,2-n-acetyl-glucosaminyltransferase II (GNTII)

Oligosaccharyltransferase (OST) (STT3a, STT3b, DD1, DD2, DGL1) Glucosidase I, Glucosidase II ER-Mannosidase α-mannosidase I (MNI) β1,2-n-acetyl-glucosaminyltransferase I (CGL1/GNTI) α-mannosidase II (HGL1/MNII)

Nature Methods: doi: /nmeth Supplementary Figure 1. Schematics of SAM, dcas9-suntag and dcas9-vpr.

Supplementary Figure 1 Schematics of SAM, dcas9-suntag and dcas9-vpr. (a) Schematics of SAM. SAM consists of two chimeric proteins, dcas9 fused with VP64 and MS2-coat protein fused with p65 and HSF1 activator

Supplemental Data. Aung et al. (2011). Plant Cell /tpc

35S pro:pmd1-yfp 10 µm Supplemental Figure 1. -terminal YFP fusion of PMD1 (PMD1-YFP, in green) is localized to the cytosol. grobacterium cells harboring 35S pro :PMD1-YFP were infiltrated into tobacco

Supporting Online Material for

www.sciencemag.org/cgi/content/full/310/5753/1487/dc1 Supporting Online Material for Stem Cell Self-Renewal Controlled by Chromatin Remodeling Factors Rongwen Xi and Ting Xie* *To whom correspondence should

Supplementary Information. c d e

Supplementary Information a b c d e f Supplementary Figure 1. atabcg30, atabcg31, and atabcg40 mutant seeds germinate faster than the wild type on ½ MS medium supplemented with ABA (a and d-f) Germination

Supplemental Data. Liu et al. (2013). Plant Cell /tpc

Supplemental Figure 1. The GFP Tag Does Not Disturb the Physiological Functions of WDL3. (A) RT-PCR analysis of WDL3 expression in wild-type, WDL3-GFP, and WDL3 (without the GFP tag) transgenic seedlings.

Supplemental Material

Supplemental Material 1 Figure S1. Phylogenetic analysis of Cep72 and Lrrc36, comparative localization of Cep72 and Lrrc36 and Cep72 antibody characterization (A) Phylogenetic alignment of Cep72 and Lrrc36

Supplementary Information. Isl2b regulates anterior second heart field development in zebrafish

Supplementary Information Isl2b regulates anterior second heart field development in zebrafish Hagen R. Witzel 1, Sirisha Cheedipudi 1, Rui Gao 1, Didier Y.R. Stainier 2 and Gergana D. Dobreva 1,3* 1 Origin

Expanded View Figures

Expanded View Figures Figure EV1. AM3-CLE45 control experiments and bam3 alleles. A Relative primary root length of indicated genotypes at 9 dag, in response to increasing amounts of CLE45 in the media.

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene

Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/9/429/ra54/dc1 Supplementary Materials for Dephosphorylation of the adaptor LAT and phospholipase C by SHP-1 inhibits natural killer cell cytotoxicity Omri Matalon,

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated

Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)

Figure S1 is related to Figure 1B, showing more details of outer segment of

Supplemental Information Supplementary Figure legends and Figures Figure S1. Electron microscopic images in Sema4A +/+ and Sema4A / retinas Figure S1 is related to Figure 1B, showing more details of outer

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection

Supplemental Figures Figure S1: Lymphatic vessel growth into the intestine is normal in Clec2 -/- embryos

Supplemental Figures Figure S1: Lymphatic vessel growth into the intestine is normal in Clec2 -/- embryos Staining of lymphatic vessels in E18.5 embryonic gut. Sections stained for lymphatic EC markers

Supplemental Movie Legend.

Supplemental Movie Legend. Transfected T cells were dropped onto SEE superantigen-pulsed Raji B cells (approximate location indicated by circle). Maximum-intensity projections from Z-stacks (17 slices,

Problem set D answers

Problem set D answers 1. You find a mouse with no tail. In order to determine whether this mouse carries a new mutation, you cross it to a normal mouse. All the F1 progeny of this cross are wild type.

Growth factor, augmenter of liver regeneration

Supplemental Table 1: Human and mouse PC1 sequence equivalencies Human Mouse Domain Clinical significance; Score* PolyPhen prediction; PSIC score difference C210G C210G WSC Highly likely pathogenic; 15

Lecture 20: Drosophila melanogaster

Lecture 20: Drosophila melanogaster Model organisms Polytene chromosome Life cycle P elements and transformation Embryogenesis Read textbook: 732-744; Fig. 20.4; 20.10; 20.15-26 www.mhhe.com/hartwell3

Trasposable elements: Uses of P elements Problem set B at the end

Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches

Supplementary Materials for

www.sciencemag.org/cgi/content/full/science.1245533/dc1 Supplementary Materials for A Mechanism for Reorientation of Cortical Microtubule Arrays Driven by Microtubule Severing Jelmer J. Lindeboom, Masayoshi

Figure S1a. The modular dcas9 fusion system works efficiently to suppress and activate endogenous gene expression in C. elegans

Figure S1a. The modular dcas9 fusion system works efficiently to suppress and activate endogenous gene expression in C. elegans A, a normal wild-type hermaphrodite N2 is shown. B, a dpy-5-supressed F1

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)

MEFs were treated with the indicated concentrations of LLOMe for three hours, washed

Supplementary Materials and Methods Cell Fractionation MEFs were treated with the indicated concentrations of LLOMe for three hours, washed with ice-cold PBS, collected by centrifugation, and then homogenized

Figure 1-Figure Supplement 1 Validation of knockdown efficiency for trpa1 RNAi and RyR RNAi lines.

Figure 1-Figure Supplement 1 Validation of knockdown efficiency for trpa1 RNAi and RyR RNAi lines. (A) Cartoon depicting the four characterized trpa1 isoforms. The target regions of trpa1 RNAi lines used

b number of motif occurrences

supplementary information DOI: 1.138/ncb194 a b number of motif occurrences number of motif occurrences number of motif occurrences I II III IV V X TTGGTCAGTGCA 3 8 23 4 13 239 TTGGTCAGTGCT 7 5 8 1 3 83