Supplementary Fig. S1

Size: px
Start display at page:

Download "Supplementary Fig. S1"

Transcription

1 Supplementary Fig. S1 CL IP Unc931Flag IP: αh I: αflg Unc931 CL IP Unc931Flag FL IP: αflg I: αh Shorter fragment Supplementary Fig. S1: Unc931 associates with full length and Cterminal h fragment THP1 cells expressing H alone, H+Unc931FLG or +Unc931FLG. () Left panel indicates western blot of complete lysate (CL) with anti FLG specific b. Right panel indicates immunoprecipitation with anti H b (IP) followed by a western blot with anti FLG b (W). () Left panel indicates western blot of complete lysate (CL) with anti H b. Right panel indicates immunoprecipitation with anti FLG b (IP) followed by a western blot with anti H b (W).

2 Supplementary Fig. S2 LRR14 7Ns (Short) Undefined region 7N (Long) 471 7C(CtermK) LRR15 :...SPSGDSSEVGFCSNRTSVESYEPQVLEQLHYFRYDKYRSCRFKNKESFMSVNESCYKYGQTLDLS... CtermG: YDKYRSCRFKNKESFMSVNESCYKYGQTLDLS... CtermH: YRSCRFKNKESFMSVNESCYKYGQTLDLS... CtermI: SCRFKNKESFMSVNESCYKYGQTLDLS... CtermJ: FKNKESFMSVNESCYKYGQTLDLS... CtermK: ESFMSVNESCYKYGQTLDLS... IL8 [pg/ml] CtermG CtermH CtermI CtermJ 2 C R µg/ml IL8 Positive [%] CtermG CtermH CtermI CtermJ CtermK D R837 15µg/ml +7Ns +7Ns +7Ns +7Ns +7Ns CtermG CtermH CtermI

3 Supplementary Fig. S2: Coexpression of a shorter Nterminal h fragment with the Cterminal h fragment fails to restore functional activity of the Cterminal h fragment () Schematic diagram showing a range of N and C terminal h fragments. The undefined region in the Nterminal h fragment, in which cleavage occurs is shown in blue. green box shows the location of a cysteine thought to play a role in disulfide bond formation between the N and Cterminal fragments. In addition to the longer h Nterminal fragment, corresponding to amino acids 1476 of human Tlr7 (F7N) which was used in the main figures of the manuscript, a shorter Nterminal fragment was made (7Ns), which lacked cysteine at position 475. We also engineered a range of Cterminal h fragments CtermG to CtermJ, in addition to the CtermK used in all the main figures of the manuscript. () ELIS with anti IL8 antibody using tissue culture medium from THP1 cells encoding indicated constructs and stimulated for 24 hrs with or without R837 at concentration of 15µg/ml. Values indicate mean ± S.D. of triplicates. = THP1 cells expressing full length h; CtermG, H, I, J= THP1 cells expressing Cterminal fragments and = THP1 cells expressing. (C) Cellsurface biotinylation of THP1 cells expressing either Htagged full length h () or the indicated Htagged Cterminal h fragments followed by immunoprecipitation using Neutravidin (vidin) and Western lot (W) analysis for Htag. (D) Intracellular FCS staining with anti IL8 antibody of THP1 cells expressing indicated constructs and stimulated for 15 hrs in the presence (black bar) or absence of 15µg/ml R837. Values indicate % of positive cells. = THP1 cells expressing, = THP1 cells expressing full length h; CtermG, CtermH and CtermI = THP1 cells expressing Cterminal fragments; Each cell line was tested for its ability to synthesize IL8 alone () or when the shorter h fragment (7Ns) was coexpressed.

4 Supplementary Fig. S3 LRR KQFKRLKVIDLSVNKISPSGDSSEVGFCSNRTSVESYEPQVLEQLHYFRYDKYRSCRFKNKESFMSVNESCYKY......KQFKRLKVIDLSVNKISPSGDSSEVGFCSNRTSVESYEPQVLEQLHYFYDKYSCRFKNKESFMSVNESCYKY......QFKLKVIDLSVNKISPSGDSSEVGFCSNRTSVESYEPQVLEQLHYFRYDKYRSCRFKNKESFMSVNESCYKY... C 8 mut 1 mut 2 THP1 6 4 IL8 [pg/ml] LRR15 mut2 : mut1: mut2: 467 mut1 Undefined region FL αh Shorter fragment 2 αctin R837 THP1 H mut1h mut2h αh D αh + αlamp1 Supplementary Fig. S3: Mutating residues in the Nterminal region of renders the receptor nonfunctional. () Schematic diagram showing an alignment of regions of the ectodomain of and mutants. Underline indicates possible furinlike recognition motifs and the undefined region in which cleavage is thought to occur is depicted in blue. oxes highlight the amino acid residues that were replaced by alanine in the mutants. () THP1 cells expressing indicated constructs were stimulated with R837 (15µg/ml) for 24 hrs, IL8 secretion was then measured by ELIS. (C) ntih western blot of total cell lysate of THP1 cells either expressing or mutants. (D) Confocal showing that both mut1 and mut2 colocalize with Lamp1. Htag staining is shown in red with the late endosome/lysosome marker Lamp1 shown in green. Nuclear counterstain (DPI) is shown in blue. THP1 cells expressing the indicated constructs were PM differentiated for 24 hours. Cells were then fixed, permeabilized, blocked and stained with the indicated antibodies. Images were taken with a Zeiss inverted 78 confocal microscope.

5 Table S1 Primer Primers used for cloning Fwd hh Rev hh h/4 PCR Fwd h/4 PCR Rev mh PCR Rev Sequence: 5 3 (restriction enzyme recognition site) CTTGTCCTGGTCCCGGTGGGG (cli) TGGTGTCGCGCTGCTTTGGCGTGTCT (SalI) GTGTGTCTCCCTGGTCTGTCCCTGTCGTGTGCC TCTTGGTGTGTCG 1 CGCCCCTGTGGTCTTTTCTCTGCGGTGTCGTCC GGGGTCCCT 2 TGGTCTCGGGCTGCTTTGGCGTGTCTGG (XhoI) h Mlu1 Fwd 2 h linker Rev Ist2 lenti Fwd Ist2 lenti Rev Ist2 cl1 Fwd Ist2 SalI Rev Flag Fwd Flag Rev cl1kozak Fwd CtermK FLG Fwd MluI Fwd CTCGCGTGGGCCCCTGGTGTTT (MluI) TCTGGTCCTTTGCCTCCCCTCCGCCCCCCCCCTTCCTC CTCCTCCGCCGTTTCCTTGCCCTGCT 3 CTTGTCCGGCCCGCCC (cli) (amhi) TTGCGGCCGCTTGGCGTGTCTGGCCTCTGGGGTGGTCC CGCTTCTTCTTCGCTTGTGCG 4 (NotI) CTTGTCGGGCCCCTGGTGTT (cli) TGGTGTCGCTTGGCGTGTCTGGCCTC (SalI) GCTCGCGTGCGCGGCTGTGGTTTCCTCTC CTTGTCGTCTCGTCTTTGTGTCTCTGCCCCGGGTTTGG TGTCCCCCTGGTGTTTCCTGTGGCC (cl1) GGCTGTCGCTCGCGTGCGCGGGGCTTCTTTC TGTCTG (cli) CGGCGCGTCCCCTGGTGTTTCCTGTGG (MluI) Nterm Rev (Long) GCCTGTCTTTCTGCCTCCTTGCTC (cli ) Nterm Rev (Short) IRES Fwd IRES Rev Mut1 Fwd Mut1 Rev Mut2 Fwd! Mut2 Rev CCGTGTCTCTGTTGTTTGTTCC(clI) CGGGGTCCTGTCCGCCCCTCTCCCTCCCCCCCCCCTCGTTC TGGCCGG (cli) CCGGGTCCTTGTGGCC (amhi) CTTTTTCGCTTGTGTTGCGCGGTTGCGTTC GTCTGCCTCGCTGCTCTTTCTTGCGTTGT GCTCCTCGCTGTTTGCCTTTGCCTGGTCTG TC GTCTTGCTTTCGTGCTTTTTGTGCCTGCTGGGTT GC 1 old: Part of Fwd primer binding in cdn. 2 old: Part of Rev primer binding in cdn. 3 Italic: cdn sequence coding for linker 4 Italic: cdn sequence coding for H epitope

Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated

Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated

More information

from α- to β-cleavage

from α- to β-cleavage Supplementary Information Specific antibody binding to the APP 672-699 region shifts APP processing from α- to β-cleavage Song Li 1,6,8, Juan Deng 1,7,8, Huayan Hou 1,8, Jun Tian 1, Brian Giunta 2,3, Yanjiang

More information

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying

More information

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43

More information

NAME TA SEC Problem Set 4 FRIDAY October 15, Answers to this problem set must be inserted into the box outside

NAME TA SEC Problem Set 4 FRIDAY October 15, Answers to this problem set must be inserted into the box outside MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 4 FRIDAY October 15,

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss

Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss SUPPLEMENTARY INFORMATION Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss Yunjong Lee, Senthilkumar S. Karuppagounder, Joo-Ho Shin, Yun-Il Lee, Han Seok Ko, Debbie Swing,

More information

GTTCGGGTTCC TTTTGAGCAG

GTTCGGGTTCC TTTTGAGCAG Supplementary Figures Splice variants of the SIP1 transcripts play a role in nodule organogenesis in Lotus japonicus. Wang C, Zhu H, Jin L, Chen T, Wang L, Kang H, Hong Z, Zhang Z. 5 UTR CDS 3 UTR TCTCAACCATCCTTTGTCTGCTTCCGCCGCATGGGTGAGGTCATTTTGTCTAGATGACGTGCAATTTACAATGA

More information

Supplementary Materials: Viral Protein Kinetics of Piscine Orthoreovirus Infection in Atlantic Salmon Blood Cells

Supplementary Materials: Viral Protein Kinetics of Piscine Orthoreovirus Infection in Atlantic Salmon Blood Cells S1of S7 Supplementary Materials: Viral Protein Kinetics of Piscine Orthoreovirus Infection in Atlantic Salmon Blood Cells Hanne Merethe Haatveit, Øystein Wessel, Turhan Markussen, Morten Lund, Bernd Thiede,

More information

affects the development of newborn neurons Brain Mind Institute and School of Life Sciences, Ecole Polytechnique Fédérale de

affects the development of newborn neurons Brain Mind Institute and School of Life Sciences, Ecole Polytechnique Fédérale de Shedding of neurexin 3β ectodomain by ADAM10 releases a soluble fragment that affects the development of newborn neurons Erika Borcel* a, Magda Palczynska* a, Marine Krzisch b, Mitko Dimitrov a, Giorgio

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran

More information

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

466 Asn (N) to Ala (A) Generate beta dimer Interface

466 Asn (N) to Ala (A) Generate beta dimer Interface Table S1: Amino acid changes to the HexA α-subunit to convert the dimer interface from α to β and to introduce the putative GM2A binding surface from β- onto the α- subunit Residue position (α-numbering)

More information

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC

More information

Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto

Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in

More information

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab. / 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Validation of RaPID with EDEN15

Nature Methods: doi: /nmeth Supplementary Figure 1. Validation of RaPID with EDEN15 Supplementary Figure 1 Validation of RaPID with EDEN15 (a) Full Western Blot of conventional biotinylated RNA pulldown with EDEN15 and scrambled control (n=3 biologically independent experiments, representative

More information

Supplemental Information. HEXIM1 and NEAT1 Long Non-coding RNA Form. a Multi-subunit Complex that Regulates. DNA-Mediated Innate Immune Response

Supplemental Information. HEXIM1 and NEAT1 Long Non-coding RNA Form. a Multi-subunit Complex that Regulates. DNA-Mediated Innate Immune Response Molecular Cell, Volume 67 Supplemental Information HEXIM1 and NEAT1 Long Non-coding RNA Form a Multi-subunit Complex that Regulates DNA-Mediated Innate Immune Response Mehdi Morchikh, Alexandra Cribier,

More information

SUPPLEMENTAL MATERIALS

SUPPLEMENTAL MATERIALS SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,

More information

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal

More information

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated

More information

Online Supplementary Information

Online Supplementary Information Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan

More information

Chapter 4. Antigen Recognition by B-cell and T-cell Receptors

Chapter 4. Antigen Recognition by B-cell and T-cell Receptors Chapter 4 Antigen Recognition by B-cell and T-cell Receptors Antigen recognition by BCR and TCR B cells 2 separate functions of immunoglobulin (Ig) bind pathogen & induce immune responses recruit cells

More information

Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.

Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated

More information

Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction)

Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction) Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction) Epo Fw CTGTATCATGGACCACCTCGG Epo Rw TGAAGCACAGAAGCTCTTCGG Jak2 Fw ATCTGACCTTTCCATCTGGGG Jak2 Rw TGGTTGGGTGGATACCAGATC Stat5A Fw TTACTGAAGATCAAGCTGGGG

More information

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

More information

Table I. Primers used in quantitative real-time PCR for detecting gene expressions in mouse liver tissues

Table I. Primers used in quantitative real-time PCR for detecting gene expressions in mouse liver tissues Table I. Primers used in quantitative real-time PCR for detecting gene expressions in mouse liver tissues Gene name Forward primer 5' to 3' Gene name Reverse primer 5' to 3' CC_F TGCCCTGTTGGGGTTG CC_R

More information

PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF

PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract

More information

ENCODE DCC Antibody Validation Document

ENCODE DCC Antibody Validation Document ENCODE DCC Antibody Validation Document Date of Submission 09/12/12 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: SREBP1 (sc-8984) Target: SREBP1 Company/ Source: Santa Cruz Biotechnology

More information

Supplementary Table 1: List of CH3 domain interface residues in the first chain (A) and

Supplementary Table 1: List of CH3 domain interface residues in the first chain (A) and Supplementary Tables Supplementary Table 1: List of CH3 domain interface residues in the first chain (A) and their side chain contacting residues in the second chain (B) a Interface Res. in Contacting

More information

Supplementary Information

Supplementary Information Supplementary Information Extended Loop Region of Hcp1 is Critical for the Assembly and Function of Type VI Secretion System in Burkholderia pseudomallei Yan Ting Lim, Chacko Jobichen, Jocelyn Wong, Direk

More information

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon

More information

GFP CCD2 GFP IP:GFP

GFP CCD2 GFP IP:GFP D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant

More information

Porcine IL-12/IL-23 p40 ELISA kit

Porcine IL-12/IL-23 p40 ELISA kit Porcine IL-12/IL-23 p40 ELISA kit Catalog number: NB-E50014 (96 wells) The kit is designed to quantitatively detect the levels of Porcine IL-12/IL-23 p40 in cell culture supernatants. FOR RESEARCH USE

More information

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

Supplemental Data Supplementary Figure Legends and Scheme Figure S1. Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,

More information

Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana.

Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. SUPPLEMENTARY FIGURES Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. YFP:, :CFP, HA: and (A) and HA, CFP and YFPtagged and AVR1-CO39 (B) were expressed

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for

More information

SUPPLEMENTAL FIGURE LEGENDS. Figure S1: Homology alignment of DDR2 amino acid sequence. Shown are

SUPPLEMENTAL FIGURE LEGENDS. Figure S1: Homology alignment of DDR2 amino acid sequence. Shown are SUPPLEMENTAL FIGURE LEGENDS Figure S1: Homology alignment of DDR2 amino acid sequence. Shown are the amino acid sequences of human DDR2, mouse DDR2 and the closest homologs in zebrafish and C. Elegans.

More information

Identification of Microprotein-Protein Interactions via APEX Tagging

Identification of Microprotein-Protein Interactions via APEX Tagging Supporting Information Identification of Microprotein-Protein Interactions via APEX Tagging Qian Chu, Annie Rathore,, Jolene K. Diedrich,, Cynthia J. Donaldson, John R. Yates III, and Alan Saghatelian

More information

Supplemental Information

Supplemental Information Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

Supplementary Figures

Supplementary Figures Supplementary Figures a HindIII XbaI pcdna3.1/v5-his A_Nfluc-VVD 1-398 37-186 Nfluc Linker 1 VVD HindIII XhoI pcdna3.1/v5-his A_VVD-Nfluc 37-186 1-398 VVD Linker 2 Nfluc HindIII XbaI pcdna3.1/v5-his A_Cfluc-VVD

More information

Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.

Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Supplementary Figure 1. Characterization and high expression of Lnc-β-Catm in liver CSCs. (a) Heatmap of differently expressed lncrnas in Liver CSCs (CD13 + CD133 + ) and non-cscs (CD13 - CD133 - ) according

More information

(Hadlock, Journal of Virology, 2000), (Keck, Journal of Virology, 2008) CBH-5 Domain B 412, 416, 417, 418, 420, 421, 422, 423, 483, 484, 485, 488,

(Hadlock, Journal of Virology, 2000), (Keck, Journal of Virology, 2008) CBH-5 Domain B 412, 416, 417, 418, 420, 421, 422, 423, 483, 484, 485, 488, Supplementary Table. mabs analyzed mab Antigenic Critical Binding Residues by Citations Domains Alanine Scanning 2 CBH-4B Domain A NA (Hadlock, Journal of Virology, 2), (Keck, Journal of Virology, 24)

More information

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact

More information

Supplementary material

Supplementary material Supplementary material Tracking mesenchymal stem cell contributions to regeneration in an immunocompetent cartilage regeneration model Daniela Zwolanek, María Satué, Verena Proell, Josè R. Godoy, Kathrin

More information

Protocol for induction of expression and cell lysate production

Protocol for induction of expression and cell lysate production Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected

More information

ENCODE RBP Antibody Characterization Guidelines

ENCODE RBP Antibody Characterization Guidelines ENCODE RBP Antibody Characterization Guidelines Approved on November 18, 2016 Background An integral part of the ENCODE Project is to characterize the antibodies used in the experiments. This document

More information

* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)

* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm) I: p-p9rsk I: p9rsk I: C I: p-p9rsk I: p9rsk 5 (ka) 5 5 (min) Ang II ( nm) p-p9rsk (Ser8) p9rsk p-p9rsk (Ser8) p9rsk (h) Mannitol 5 mm -Glucose 5 mm p9rsk (Ser8) (arbitrary units) p-p9rsk (Ser8) (arbitrary

More information

Supporting Information

Supporting Information Supporting Information Liu et al. 10.1073/pnas.0901216106 SI Materials and Methods Reagents. Thioglycolate and LPS from Escherichia coli 0111:B4 were from Sigma-Aldrich. PAM3CSK4 and poly(i:c) were from

More information

Overview of Solulink Products. June 2011

Overview of Solulink Products. June 2011 Overview of Solulink Products June 2011 1 Who we are Established in 2003, Solulink develops, patents, manufactures, and sells consumables to over 1,000 customers in life science, diagnostic, and pharmaceutical

More information

Isolation, culture, and transfection of primary mammary epithelial organoids

Isolation, culture, and transfection of primary mammary epithelial organoids Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

More information

Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy

Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy Supplementary Material Levels of protein drive the reparative process in acute muscle injury and muscular dystrophy Francesca Riuzzi 1,4 *, Sara Beccafico 1,4 *, Roberta Sagheddu 1,4, Sara Chiappalupi

More information

Zool 3200: Cell Biology Exam 3 3/6/15

Zool 3200: Cell Biology Exam 3 3/6/15 Name: Trask Zool 3200: Cell Biology Exam 3 3/6/15 Answer each of the following questions in the space provided; circle the correct answer or answers for each multiple choice question and circle either

More information

Translation of HTT mrna with expanded CAG repeats is regulated by

Translation of HTT mrna with expanded CAG repeats is regulated by Supplementary Information Translation of HTT mrna with expanded CAG repeats is regulated by the MID1-PP2A protein complex Sybille Krauß 1,*, Nadine Griesche 1, Ewa Jastrzebska 2,3, Changwei Chen 4, Désiree

More information

A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells

A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells Plant Cell, Tissue and Organ Culture (PCTOC) A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells Anna Týcová a,b, Rajen J. J. Piernikarczyk c, Michael

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Species predicted to react based on 100% sequence homology: Chicken, Bovine, Dog.

Species predicted to react based on 100% sequence homology: Chicken, Bovine, Dog. 1 of 5 11/1/2013 10:25 PM Product Pathways - Jak/Stat Pathway Phospho-Stat3 (Tyr705) Antibody #9131 Have you tried your application using our XP monoclonal antibodies? Try products: 9145 PhosphoSitePlus

More information

RayBio Human bfgf ELISA Kit

RayBio Human bfgf ELISA Kit RayBio Human bfgf ELISA Kit User Manual (for Cell Lysate and Tissue Lysate) (Revised Mar 1, 2012) RayBio Human bfgf ELISA Kit Protocol (Cat#: ELH-bFGF-001C) RayBiotech, Inc. We Provide You With Excellent

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Basic Antibody Structure. Multiple myeloma = cancerous plasma cells Monomer = 150,000. Chapter 4. Immunoglobulin Structure and Function

Basic Antibody Structure. Multiple myeloma = cancerous plasma cells Monomer = 150,000. Chapter 4. Immunoglobulin Structure and Function Chapter 4. Immunoglobulin Structure and Function. Functional Regions. Types of chains. Constant & Variable regions 4. Glycoprotein * * * Heavy chain= 446 aa Light chain= 4aa Each heavy and light chain

More information

Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines

Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Further information can be found at: http://stke.sciencemag.org/sites/default/files/researcharticlerevmsinstructions_0.pdf.

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

3. Results. 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors

3. Results. 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors 3. Results 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors To investigate the dimerisation of the endothelin receptor subtypes HEK293 cells were stably transfected with plasmids

More information

Lecture 25 (11/15/17)

Lecture 25 (11/15/17) Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);

More information

Flow Cytometry - The Essentials

Flow Cytometry - The Essentials Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.

More information

Supplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge

Supplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge Supplement Figure 1 Plin5 Plin2 Plin1 KDEL-DSRed Plin-YFP Merge Supplement Figure 2 A. Plin5-Ab MitoTracker Merge AML12 B. Plin5-YFP Cytochrome c-cfp merge Supplement Figure 3 Ad.GFP Ad.Plin5 Supplement

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Assessment of quaternary structure of soluble RSV F proteins. Soluble variants of F proteins from A2 and B1 RSV strains were expressed in HEK293 cells. The cell culture supernatants

More information

Supplemental Data. Sun et al. Plant Cell. (2012) /tpc FLS2 -cmyc -GFP FLS2 -HA. FLS2-FLAG FLS2 -HA BAK1-HA flg22 (10mM)

Supplemental Data. Sun et al. Plant Cell. (2012) /tpc FLS2 -cmyc -GFP FLS2 -HA. FLS2-FLAG FLS2 -HA BAK1-HA flg22 (10mM) Supplemental Data. Sun et al. Plant ell. ()..5/tpc..9599 A FLS-FLA FLS -HA BAK-HA flg (mm) - B FLS -cmyc -FP FLS -HA IP antibody cmyc FLA FP cmyc IP ; WB: α-ha IP; WB: α-ha IP: α-fla; WB: α-ha IP ; WB:

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

Transforming Growth Factor -Independent Shuttling of Smad4 between the Cytoplasm and Nucleus

Transforming Growth Factor -Independent Shuttling of Smad4 between the Cytoplasm and Nucleus MOLECULAR AND CELLULAR BIOLOGY, Dec. 2000, p. 9041 9054 Vol. 20, No. 23 0270-7306/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Transforming Growth Factor -Independent

More information

Supplementary Information

Supplementary Information Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative

More information

Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat

Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat pups at P6, P14, P22, P30 and adult (A) rats were subjected

More information

Supplementary information, Figure S1

Supplementary information, Figure S1 Supplementary information, Figure S1 (A) Schematic diagram of the sgrna and hspcas9 expression cassettes in a single binary vector designed for Agrobacterium-mediated stable transformation of Arabidopsis

More information

pgbkt7 Anti- Myc AH109 strain (KDa) 50

pgbkt7 Anti- Myc AH109 strain (KDa) 50 pgbkt7 (KDa) 50 37 Anti- Myc AH109 strain Supplementary Figure 1. Protein expression of CRN and TDR in yeast. To analyse the protein expression of CRNKD and TDRKD, total proteins extracted from yeast culture

More information

Sonal Khare, Andrea Dorfleutner, Nicole B. Bryan, Chawon Yun, Alexander D. Radian, Lucia de Almeida, Yon Rojanasakul, and Christian Stehlik

Sonal Khare, Andrea Dorfleutner, Nicole B. Bryan, Chawon Yun, Alexander D. Radian, Lucia de Almeida, Yon Rojanasakul, and Christian Stehlik 2 Immunity, Volume 36 Supplemental Information An NLRP7-Containing Inflammasome Mediates Recognition of Microbial Lipopeptides in Human Macrophages Sonal Khare, Andrea Dorfleutner, Nicole B. Bryan, Chawon

More information

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Svegliati Baroni S, Santillo M, Bevilacqua F, et al. Stimulatory

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

TrueORF TM cdna Clones and PrecisionShuttle TM Vector System

TrueORF TM cdna Clones and PrecisionShuttle TM Vector System TrueORF TM cdna Clones and PrecisionShuttle TM Vector System Application Guide Table of Contents Package Contents and Storage Conditions... 2 Related, Optional Reagents... 2 Related Products... 2 Available

More information

Figure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9

Figure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9 Supplementary Information Ultrasensitive antibody detection by agglutination-pcr (ADAP) Cheng-ting Tsai 1 *, Peter V. Robinson 1 *, Carole A. Spencer 2 and Carolyn R. Bertozzi 3,4ǂ Department of 1 Chemistry,

More information

Kwon et al., Supplemental Figure 1

Kwon et al., Supplemental Figure 1 Kwon et al., Supplemental Figure 1 Mock, 14 dpi AvrRpm1, 14 dpi RabG3bDN RabG3bRNAi Supplemental Figure S1. Cell death phenotypes of leaves inoculated with Pst DC3000 (AvrRpm1) in 5-week-old young plants.

More information

Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse

Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp)

More information

Certificate of Analysis

Certificate of Analysis Certificate of Analysis pet6xhn Expression Vector Set Contents Product Information... 1 pet6xhn-n, pet6xhn-c, and pet6xhn-gfpuv Vector Information... 2 Location of Features... 4 Additional Information...

More information

Figure S1. MUT-16 localization in L4 hermaphrodite, adult hermaphrodite, and adult male germlines. MUT-16 DAPI. Phillips et al. S-1. male.

Figure S1. MUT-16 localization in L4 hermaphrodite, adult hermaphrodite, and adult male germlines. MUT-16 DAPI. Phillips et al. S-1. male. Supplementary Material for Phillips et al. Figure S1. MUT-16 localization in L4 hermaphrodite, adult hermaphrodite, and adult male germlines. Figure S2. Mutator foci and P granules localize independently

More information

Human Cell-Free Protein Expression Maxi System

Human Cell-Free Protein Expression Maxi System Cat. # 3285 For Research Use Human Cell-Free Protein Expression Maxi System Product Manual Table of Contents I. Description... 3 II. Components... 4 III. Materials Required but not Provided... 5 IV. Storage...

More information

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and

More information

Supplementary Information

Supplementary Information Supplementary Information promotes cancer cell invasion and proliferation by receptor-mediated endocytosis-dependent and -independent mechanisms, respectively Kensaku Shojima, Akira Sato, Hideaki Hanaki,

More information

Some types of Mutagenesis

Some types of Mutagenesis Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine

More information